ID: 1183483633

View in Genome Browser
Species Human (GRCh38)
Location 22:38077949-38077971
Sequence GTGTAGAGACACAAGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183483633_1183483641 -9 Left 1183483633 22:38077949-38077971 CCCAGCCCCTTGTGTCTCTACAC 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1183483641 22:38077963-38077985 TCTCTACACCTGGGAACGATGGG 0: 1
1: 0
2: 0
3: 3
4: 74
1183483633_1183483640 -10 Left 1183483633 22:38077949-38077971 CCCAGCCCCTTGTGTCTCTACAC 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1183483640 22:38077962-38077984 GTCTCTACACCTGGGAACGATGG 0: 1
1: 0
2: 0
3: 2
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183483633 Original CRISPR GTGTAGAGACACAAGGGGCT GGG (reversed) Intergenic
900175988 1:1291582-1291604 GTCCAGAGTCTCAAGGGGCTGGG - Exonic
900641351 1:3689448-3689470 GTGTTGTGCCCCAAGGGGCTGGG - Intronic
900737330 1:4307365-4307387 GGGCAGACACAGAAGGGGCTTGG - Intergenic
904132949 1:28288842-28288864 TTGTAGGGACAGAAGGAGCTGGG + Intergenic
905060677 1:35136836-35136858 GAGTAGAGACACAGAGGGCAGGG + Intergenic
905371592 1:37485387-37485409 GTGCAGAGACAGCGGGGGCTTGG - Intergenic
905966511 1:42102955-42102977 GGCTGGAGACACAAGGAGCTGGG + Intergenic
906744707 1:48213634-48213656 GTGCAGAGATACAAGAGGTTGGG + Intergenic
907239798 1:53075103-53075125 GTTCAGAGAGAGAAGGGGCTGGG - Intronic
907293431 1:53433419-53433441 GGGTAGAGACACAGAGGGCGGGG - Intergenic
908392909 1:63699489-63699511 TTGTAGAGACACAGGGGGTGAGG + Intergenic
908592166 1:65646612-65646634 GTGTAGAGATATAAGAGGTTGGG + Intergenic
909788460 1:79643452-79643474 GTGCAGAGATATAAGGGGTTGGG + Intergenic
915017098 1:152744385-152744407 CTGGAGGGACACATGGGGCTGGG - Intronic
916686566 1:167152511-167152533 AAGTAGAGACACACTGGGCTTGG + Intergenic
922331670 1:224582334-224582356 GTGCAGAGACAGATGTGGCTGGG + Intronic
1069877527 10:71572271-71572293 GGGCAGAGAGAAAAGGGGCTAGG - Intronic
1072115502 10:92366742-92366764 GTGCAGAGACACCTGGGGCTGGG + Intergenic
1075780780 10:125015897-125015919 GTGTGGACACACACGGGGCTGGG + Intronic
1076280555 10:129242776-129242798 GTGAAGAGAAACAACCGGCTAGG - Intergenic
1077806377 11:5595168-5595190 GTATAGAGAGAGAAGGGACTGGG - Intronic
1078533407 11:12154285-12154307 GTGTAGCCACACAAGGGCCCAGG + Intronic
1078577636 11:12515505-12515527 CTGTAGAGACCCAAAGTGCTTGG - Intronic
1078611055 11:12819965-12819987 GTGGAGAAACAGAATGGGCTGGG + Intronic
1078648913 11:13168920-13168942 GTGCAGAGACACCAGGGCCCCGG + Intergenic
1078692775 11:13598444-13598466 GTGTATACACACATGGGGGTGGG + Intergenic
1079119515 11:17671995-17672017 CTGCAGAGACACATGGGGATGGG + Intergenic
1079121523 11:17688494-17688516 GAATAGAGACACAACGGTCTGGG - Intergenic
1081746926 11:45479922-45479944 GTGTAGACCCACAAGAGGTTTGG + Intergenic
1082943413 11:58732749-58732771 GAGCAGGGACACAAGAGGCTAGG + Intergenic
1084155359 11:67310120-67310142 GTGTAGAGACTTCAGGGGCTGGG - Exonic
1084515626 11:69636844-69636866 GTGAACACACAGAAGGGGCTTGG + Intergenic
1084551689 11:69847303-69847325 GTGTAGAGGGAGAAGGGGCAGGG - Intergenic
1084692207 11:70734048-70734070 GGGAAGAGTCACCAGGGGCTGGG + Intronic
1087504738 11:99004927-99004949 GTGAAGAAACACATGCGGCTGGG - Intergenic
1090329481 11:125919769-125919791 GTGTAGAGAGGCAAGAGCCTAGG - Intronic
1091817997 12:3454135-3454157 GTGAAGAGACAGCAGGGGCTAGG - Intronic
1097038270 12:56138379-56138401 GTGGAGGGGCACACGGGGCTGGG - Intronic
1098339165 12:69433927-69433949 GTGTAGAGAGGCAAGAGGCCAGG + Intergenic
1099165811 12:79306050-79306072 GTGTAGAGAGAAAATGGGTTTGG - Intronic
1099902888 12:88734556-88734578 GTGTAGAGATAAATGGGGGTGGG - Intergenic
1101143376 12:101818670-101818692 GACTAAAGACACAAAGGGCTGGG - Intronic
1102476037 12:113189151-113189173 GTGTAGAGACATTTGGGGTTAGG + Intronic
1102928731 12:116846448-116846470 TTGTAGAGACATATGGGGCATGG + Intronic
1107757582 13:43641435-43641457 TTATAGAGACTCAAGGGCCTTGG - Intronic
1108275396 13:48804261-48804283 GTGTAGAAAAATAAGGTGCTTGG - Intergenic
1108477138 13:50831466-50831488 GTGTGGAGTCAGAAGGGGCTGGG + Intronic
1108498044 13:51044375-51044397 CTGGAGAGACAAAAGGGCCTGGG + Intergenic
1109499113 13:63214215-63214237 GTGCAGAGATATAAGAGGCTGGG - Intergenic
1120438263 14:84504947-84504969 GTGCAGAGATATAAGGGGTTGGG + Intergenic
1120788695 14:88559735-88559757 GTGTAGAAGCACTAGGGGATGGG - Intergenic
1125296981 15:38213815-38213837 TTGGAGAAACACAAGTGGCTTGG + Intergenic
1125629002 15:41132323-41132345 GGGTAGGGACACCAGGGGCAGGG - Intergenic
1126755697 15:51923089-51923111 GTGAAGAGGCAGAAGGGGCCAGG + Intronic
1126905666 15:53362237-53362259 GTGTAGAGACTCAGGGAGCCTGG + Intergenic
1129350834 15:74955227-74955249 GAGGGGAGACACAAGGGGCCAGG + Exonic
1131829018 15:96342594-96342616 ATACAGAGACACAAAGGGCTTGG + Intergenic
1134124251 16:11605462-11605484 GTAAAGAGAGACACGGGGCTGGG - Intronic
1136026752 16:27473642-27473664 GTGGAGGGACACAAGGGGACCGG + Intronic
1138342929 16:56302523-56302545 GTGTATAGCCAGATGGGGCTGGG - Intronic
1139292174 16:65868953-65868975 AGGTAGAGACAGAAGGTGCTTGG + Intergenic
1139446540 16:67001719-67001741 GTGGAGAGGCAGAAGGTGCTGGG - Intronic
1140374148 16:74431400-74431422 GTAAACAGACACAAGGAGCTCGG - Intergenic
1140696636 16:77541162-77541184 CTTTAAAGACACAAGGGGCTTGG - Intergenic
1141726566 16:85793216-85793238 TTGTACAGTCACAAGGGGCGTGG - Intronic
1142407836 16:89901045-89901067 GTGCAGAGACAGAACTGGCTGGG + Intronic
1142976570 17:3648240-3648262 GTGCAGAGACAGAAGGAGCTGGG - Intronic
1146370250 17:32261686-32261708 CTGCAGAGAGAGAAGGGGCTCGG + Intergenic
1146698272 17:34929370-34929392 GGGTAGAGAGAAAAGAGGCTGGG - Intronic
1147367101 17:39966229-39966251 GGGAAAAGACAAAAGGGGCTGGG - Intronic
1147385119 17:40076669-40076691 GGGGAGAGAGATAAGGGGCTTGG - Intronic
1147773460 17:42883748-42883770 GTTAAGAGGCATAAGGGGCTGGG - Intergenic
1147905210 17:43818111-43818133 CTGCAGGGACACAAGGGGATGGG + Intronic
1151688098 17:75661572-75661594 GTGAAGAGACTCAAGTGGCCTGG + Intronic
1152281808 17:79389278-79389300 GGGTAGAAACACAAAGGTCTGGG + Intronic
1152850343 17:82630155-82630177 GTGAAGAGACACCAGAGGATGGG - Intronic
1153171185 18:2317897-2317919 CTGTAGTTACTCAAGGGGCTGGG - Intergenic
1154126612 18:11697825-11697847 GTGTTGAGACTGAAGGGCCTTGG + Intronic
1154137183 18:11790233-11790255 GTGCAGAGACCCCAGGGGCAGGG - Intronic
1154492412 18:14932170-14932192 GGGATGAGGCACAAGGGGCTGGG - Intergenic
1155416860 18:25607424-25607446 GGGTAGAGAGAGAGGGGGCTTGG + Intergenic
1157618584 18:49002270-49002292 GTGGGGAGTCCCAAGGGGCTGGG + Intergenic
1157797041 18:50584230-50584252 GAGAAGAGACATAAAGGGCTTGG - Intronic
1160312739 18:77811179-77811201 GTGGAAAGACACAAAGGGCGAGG - Intergenic
1165184975 19:34010966-34010988 GTATAGAGAAACAAGGAGATAGG - Intergenic
1167901954 19:52628801-52628823 GTGCAGAGATATAAGGGGTTGGG - Intronic
1167934908 19:52897814-52897836 GGGTTGAGAAACAAGGGGCCTGG + Intergenic
927346636 2:22051632-22051654 ATGTATAGACACATGGGTCTAGG - Intergenic
929192574 2:39153176-39153198 GTGTAAAGAGCCAAGGGGTTAGG - Intergenic
929211443 2:39361194-39361216 ATGTAGAGACAAAAGGGTGTGGG - Intronic
929570066 2:43017162-43017184 GTGGAGAGAGGCAAGGGGATGGG - Intergenic
930717192 2:54604206-54604228 GTATAGAGAAAGAAGGGGCAGGG + Intronic
931240943 2:60452216-60452238 ATGTATAGAAACAAGGGGTTGGG + Intronic
934774506 2:96928583-96928605 TTGAAGAGACTCAAGGGACTGGG + Intronic
936122023 2:109755209-109755231 GTGTAGAAGTACAAGTGGCTTGG - Intergenic
936222671 2:110616265-110616287 GTGTAGAAGTACAAGTGGCTTGG + Intergenic
937294903 2:120804260-120804282 GTGCAAAGACACCAGGGACTTGG - Intronic
938009217 2:127815149-127815171 GTGTAAAGACAATAGTGGCTGGG - Intergenic
938075371 2:128330137-128330159 GTGGAGAGACACAAGGTGATAGG - Intergenic
939565232 2:143779350-143779372 GTGTTTACATACAAGGGGCTGGG - Intergenic
939902550 2:147867883-147867905 GTGTAGAGGCACAAGGCACAAGG - Intronic
941105779 2:161351147-161351169 GTGTAGTGACTCAAGGGGATGGG + Intronic
944103878 2:196058449-196058471 GTGGAGAGACACATGGGGATAGG - Intronic
948489852 2:238305568-238305590 GTGTAGAAAGAGAAGTGGCTTGG - Intergenic
948698195 2:239744340-239744362 GTGGAGATCCACATGGGGCTTGG - Intergenic
1170920096 20:20669923-20669945 GTGTAGAAACACAAGGTACTTGG - Intronic
1171164150 20:22956037-22956059 GTGTAGAGAAGCAGGGGGATTGG + Intergenic
1171500485 20:25589153-25589175 GTGAAGAGACACATAGGGCAAGG + Intergenic
1172815519 20:37682937-37682959 GTAAAGAGACACAGTGGGCTGGG + Intergenic
1173311462 20:41899819-41899841 ATGTAGATACACATGGTGCTGGG + Intergenic
1173434160 20:43017449-43017471 GTGCAAACACACACGGGGCTGGG - Intronic
1173502423 20:43563982-43564004 GGGGAGGGACACATGGGGCTAGG - Intronic
1173781445 20:45760361-45760383 GTGCAGAGATATAAGGGGTTGGG - Intronic
1176249393 20:64113069-64113091 GTGTGGACACACATGTGGCTGGG + Intergenic
1176273900 20:64252736-64252758 GTGGAGAGATGCAAGGGGATAGG + Intergenic
1176346914 21:5756916-5756938 GTGTACATACACACGGGGCCAGG + Intergenic
1176353728 21:5877500-5877522 GTGTACATACACACGGGGCCAGG + Intergenic
1176497913 21:7567539-7567561 GTGTACATACACACGGGGCCAGG - Intergenic
1176541235 21:8154986-8155008 GTGTACATACACACGGGGCCAGG + Intergenic
1176560186 21:8338031-8338053 GTGTACATACACACGGGGCCAGG + Intergenic
1177564145 21:22796381-22796403 GGGAAGAGACCCAAGCGGCTGGG - Intergenic
1179231649 21:39509214-39509236 GTGGAGAGAGAAACGGGGCTTGG + Intronic
1179502338 21:41818071-41818093 GCGTAGAGACAGGAGGGGCAGGG - Intronic
1181112164 22:20608567-20608589 GTGTTGAGGCCCAAAGGGCTGGG - Intergenic
1183483633 22:38077949-38077971 GTGTAGAGACACAAGGGGCTGGG - Intergenic
1184640580 22:45867969-45867991 GCGCAGAGATCCAAGGGGCTCGG - Intergenic
1203246177 22_KI270733v1_random:71405-71427 GTGTACATACACACGGGGCCAGG + Intergenic
952448041 3:33402591-33402613 ATGTTAAGGCACAAGGGGCTCGG + Intronic
952502762 3:33979189-33979211 GAGTAGAGTCACTAGGGGGTTGG + Intergenic
952536081 3:34310406-34310428 GTGTACAGACACATGGAGCCAGG - Intergenic
953639109 3:44688904-44688926 GTCTAGACAAACAAGGGGGTGGG + Intergenic
954463284 3:50639814-50639836 GTGTAGAAGCAGAAGGTGCTGGG - Intronic
955747346 3:62153297-62153319 GTTAACAGACATAAGGGGCTTGG - Intronic
956669288 3:71671332-71671354 CTGCAGAGAGACCAGGGGCTTGG + Intergenic
956748545 3:72328776-72328798 GAGAAGAGAAAAAAGGGGCTAGG + Intergenic
961069787 3:123912003-123912025 GTGTAGAGATCCTAGGGGCAGGG - Intronic
961386394 3:126525438-126525460 GTCTGGACACACAAGGGGCAAGG - Intronic
966676208 3:182593288-182593310 GTGGAGAGACAAGAGTGGCTTGG + Intergenic
967521227 3:190435281-190435303 ATGTAGAGACACAAGGAGAAGGG - Intronic
968943588 4:3652110-3652132 GTGCAGAAGCACAAGGGGCAAGG - Intergenic
975494964 4:75027266-75027288 GTGTAGAGACCCAATAGGCAGGG - Intronic
978069081 4:104444005-104444027 GTGGAGAGATAGAAGGGGCAAGG - Intergenic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
986151607 5:5134929-5134951 TTGTGGAAACACAGGGGGCTGGG + Intergenic
989950546 5:50292846-50292868 GTGGAGGGACACATGGGGGTGGG + Intergenic
990403854 5:55468270-55468292 TTGTAAAGAAAAAAGGGGCTGGG - Intronic
992379100 5:76219589-76219611 GGGGAGAGAGACAAGAGGCTGGG - Intronic
994103919 5:95924212-95924234 GTGTAGATACACAATGGAATAGG - Intronic
998070965 5:139197886-139197908 GGGAAGAGACACACGGGTCTCGG + Intronic
998380996 5:141725357-141725379 GTGTTGAGCAACAAGTGGCTTGG - Intergenic
999689374 5:154133707-154133729 GGGTAGGGACACAAGGAGATTGG - Intronic
1001403521 5:171460518-171460540 CTCTAGAGACAGAAGGGCCTGGG - Intergenic
1001686264 5:173597094-173597116 GTGTGGACACACCAGGGGCATGG - Intergenic
1001759877 5:174198602-174198624 CTGGAGAGACCCAAGGGGGTAGG + Intronic
1002176881 5:177405617-177405639 GTGGAGGGAGAGAAGGGGCTGGG + Intronic
1002939695 6:1705288-1705310 TCGTAGAGACACAAGGTGATGGG + Intronic
1004529179 6:16437649-16437671 AGGAAGAGACACAAGGAGCTTGG - Intronic
1005437248 6:25827780-25827802 GTGTGTATACACCAGGGGCTGGG + Intronic
1011112186 6:83850954-83850976 CTGTAGAGATAGAAGGGGTTTGG - Intergenic
1011212482 6:84969166-84969188 GTGTAAAGACACAAGTGACCAGG - Intergenic
1011635983 6:89373667-89373689 GTGTGCAGACACAAGTGACTTGG + Intronic
1012013684 6:93827247-93827269 GTGTGTAGAAACAAGGAGCTGGG - Intergenic
1017166320 6:151411486-151411508 CAGTAGAGGCAGAAGGGGCTTGG + Intronic
1018640586 6:165900588-165900610 GTGTATATACACATGGGGGTTGG - Intronic
1019736796 7:2654098-2654120 GTGTATACACACACGGGGCCGGG + Intronic
1019979643 7:4612015-4612037 GAAAAGAGACACAAGGGGCCAGG + Intergenic
1022300157 7:29095337-29095359 GTGTAGAAACACTCTGGGCTGGG - Intronic
1022478240 7:30725987-30726009 GTGTGAAGACACACGGGGCAAGG + Intronic
1022511655 7:30938646-30938668 CTGCAGAGACACAGGGGCCTGGG - Intergenic
1022986362 7:35658302-35658324 ATTGATAGACACAAGGGGCTAGG + Intronic
1024301029 7:47887830-47887852 CTGTAGAGGCAAGAGGGGCTGGG + Intronic
1027418102 7:77993808-77993830 ATTTAGAGACACACGGGGCTGGG + Intergenic
1035140394 7:156753611-156753633 GTATAGAGACACAGGGCGCAAGG + Intronic
1038074665 8:24058085-24058107 CAGTAGAGGCACAAGGGCCTGGG - Intergenic
1044853386 8:96451079-96451101 GAGTAGTGACACCAGGAGCTGGG + Intergenic
1047483198 8:125304441-125304463 GTGTAGAGAGACCCGGGGCAAGG + Intronic
1049978884 9:885607-885629 GAGCAGACACACAAGCGGCTGGG - Intronic
1051231794 9:14962815-14962837 GTGTGGAAACACAATGGCCTGGG - Intergenic
1053510047 9:38679983-38680005 GTTTATAGACAAAAGGGGGTAGG + Intergenic
1055809842 9:80138385-80138407 GTGCAGAGATACAAGAGGTTGGG - Intergenic
1057087987 9:92228257-92228279 ATTTAGAGATACAAGGGGTTAGG + Intronic
1059989597 9:119852864-119852886 GGGGTGAAACACAAGGGGCTGGG + Intergenic
1060784791 9:126442633-126442655 GTGCAAAGACACAAGGAGCAGGG - Intronic
1061224738 9:129274523-129274545 GTGTAGACACGCAAGGGACTCGG + Intergenic
1061789483 9:133051603-133051625 GTGTAGAGGGCCAGGGGGCTGGG - Intronic
1062023600 9:134330391-134330413 GTCTAGGGCCACAAGGGCCTGGG + Intronic
1203462511 Un_GL000220v1:54477-54499 GTGTACATACACACGGGGCCAGG + Intergenic
1186113084 X:6276897-6276919 GTGCAGAGATATAAGGGGTTGGG + Intergenic
1187138495 X:16570943-16570965 GGGCAGAGACACAAGCAGCTAGG + Intergenic
1192037368 X:67578779-67578801 GTGCATAGACAGAATGGGCTGGG + Intronic
1192469250 X:71382666-71382688 GTGTGAAGAAAAAAGGGGCTTGG + Intronic
1192656417 X:72999587-72999609 GTCCAGAGACAGCAGGGGCTTGG - Intergenic
1192665703 X:73083414-73083436 GTCCAGAGACAGCAGGGGCTTGG + Intergenic
1194366911 X:93023979-93024001 GTGCAGAGATATAAGGGGTTGGG - Intergenic
1195107803 X:101617386-101617408 GTGTGGAGAAAGAAGGGGCCAGG + Intronic
1196502881 X:116405957-116405979 GTGTAGAGAAACAAGAGGCATGG - Intergenic
1197102442 X:122672366-122672388 GTGTACAGCCACAAGGGGTTAGG + Intergenic
1198379702 X:136072286-136072308 CTGGAGAGACACAAGAGTCTTGG + Intergenic
1198599591 X:138269000-138269022 GTGCAGAGATATAAGGGGTTGGG + Intergenic
1199288352 X:146078504-146078526 GAGGAGGGACACAAGGGGGTAGG + Intergenic
1200675133 Y:6140235-6140257 GTGCAGAGATATAAGGGGTTGGG - Intergenic