ID: 1183484254

View in Genome Browser
Species Human (GRCh38)
Location 22:38080949-38080971
Sequence CAGCGCGCCCACCATGCCGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183484252_1183484254 -4 Left 1183484252 22:38080930-38080952 CCATGAGCACCTCGAACTGCAGC 0: 1
1: 1
2: 1
3: 11
4: 208
Right 1183484254 22:38080949-38080971 CAGCGCGCCCACCATGCCGTAGG 0: 1
1: 0
2: 1
3: 4
4: 48
1183484250_1183484254 5 Left 1183484250 22:38080921-38080943 CCACAGCCGCCATGAGCACCTCG 0: 1
1: 0
2: 0
3: 13
4: 181
Right 1183484254 22:38080949-38080971 CAGCGCGCCCACCATGCCGTAGG 0: 1
1: 0
2: 1
3: 4
4: 48
1183484249_1183484254 6 Left 1183484249 22:38080920-38080942 CCCACAGCCGCCATGAGCACCTC 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1183484254 22:38080949-38080971 CAGCGCGCCCACCATGCCGTAGG 0: 1
1: 0
2: 1
3: 4
4: 48
1183484251_1183484254 -1 Left 1183484251 22:38080927-38080949 CCGCCATGAGCACCTCGAACTGC 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1183484254 22:38080949-38080971 CAGCGCGCCCACCATGCCGTAGG 0: 1
1: 0
2: 1
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183484254 Original CRISPR CAGCGCGCCCACCATGCCGT AGG Exonic
900362658 1:2297410-2297432 CAGCCCGCTCACCACGCTGTGGG + Intronic
901606329 1:10462144-10462166 CACCGCGCCCAGCCTGCCATGGG + Intronic
901914878 1:12490868-12490890 CAAGAAGCCCACCATGCCGTGGG - Intronic
902864339 1:19268610-19268632 CAGCGCTCCCAGCATGACCTCGG - Intergenic
902866561 1:19284034-19284056 CAGCGCCCCCAGCATGACCTCGG - Exonic
904374528 1:30071837-30071859 CAGTGGGCCCAGCACGCCGTGGG - Intergenic
912828043 1:112924122-112924144 CAGCGCCCCCAGCATGACCTCGG + Intronic
923343232 1:233025187-233025209 CAACGCGGCCACCATGCTGCAGG - Exonic
924179245 1:241424369-241424391 CACCGCGCCCACCCGGCCGATGG + Intergenic
1072571673 10:96663339-96663361 CACCGCGCCCAGCCTGCCATTGG - Intronic
1081535753 11:43995134-43995156 CACCGTGCCCAGCATGCAGTAGG - Intergenic
1082027913 11:47586261-47586283 CAGCCAGCCCACCATGCAGTTGG + Intergenic
1085692653 11:78676308-78676330 CAGCGCCACCTCCATGCCGTTGG + Exonic
1086385468 11:86302533-86302555 CTGCGCACCCTCCCTGCCGTAGG - Intronic
1095951403 12:47783804-47783826 CTGCCCGCCCACCATGCCCTTGG - Exonic
1101605949 12:106247842-106247864 CGCCGCGCCCGCCATGCCCTCGG - Exonic
1125375504 15:39024557-39024579 CTGCTCGCCCACCAGGCCGAGGG - Intergenic
1131362221 15:91803353-91803375 CAGCACTCCCAGCATGCTGTGGG + Intergenic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1132506576 16:312785-312807 CAGCCAGCCCACATTGCCGTAGG - Intronic
1132642372 16:983676-983698 CAGGGCGCCCACTGTGCCCTCGG - Intronic
1141477364 16:84282901-84282923 TAGGGTGCCCACCATCCCGTGGG + Intergenic
1150772423 17:68052812-68052834 CAGCGAGACCACAAGGCCGTCGG + Intergenic
1152783771 17:82237762-82237784 CAGGGCCCCCACCATGCCGTAGG - Exonic
1161215705 19:3094276-3094298 AAGCGCGCCCACCATGGGGGCGG - Intergenic
1162408745 19:10491783-10491805 CAGCCCGCCCACCACGCAGCCGG + Exonic
1164551107 19:29213041-29213063 CAGCGCGCCCGCCACCCCGCGGG + Exonic
1165388897 19:35527314-35527336 CAGGGGGCCCACCATGCTGCGGG - Exonic
1165388915 19:35527368-35527390 CAGGGGGCCCACCATGCTGCGGG - Exonic
1165388960 19:35527530-35527552 CAGGGGGCCCACCATGCTGCGGG - Exonic
1166809587 19:45507506-45507528 CAGCGCGCACCCCTTGCCGGTGG - Exonic
937877704 2:126837679-126837701 CAGCTCCCCCACCCTGCCATGGG - Intergenic
1175671071 20:60903230-60903252 CAGCTCGCCCTCCATGCAGCTGG + Intergenic
1179255689 21:39713352-39713374 CAGCCAGCCCACCATGACCTGGG - Intergenic
1183484254 22:38080949-38080971 CAGCGCGCCCACCATGCCGTAGG + Exonic
1183765965 22:39875346-39875368 CAGCGCGCCCGCCACCCCGCGGG - Intronic
1185270428 22:49927037-49927059 CAGAGCCCCCACGCTGCCGTGGG - Intronic
968870352 4:3238946-3238968 CAGCGCGTCCACCAGCCCGTGGG + Exonic
977337559 4:95717882-95717904 AAGCGTGCCCACCTTGCCTTTGG + Intergenic
978621957 4:110641474-110641496 TAGCGCGCCCAGCCTGCCGGAGG - Intronic
984994813 4:185419462-185419484 CAGCACCCCCACCAGGCCATGGG - Intronic
991435771 5:66596278-66596300 CAGCGCGCCTGCCCTGCCATTGG + Intergenic
992351067 5:75929387-75929409 CAGCTTCCCCACCATGCCTTAGG - Intergenic
999248302 5:150167048-150167070 AAGGGCGCCCCCCAGGCCGTCGG - Exonic
1009872304 6:69467484-69467506 CTCCGCCCCCACCCTGCCGTGGG + Intergenic
1035751814 8:2001853-2001875 CAGCGCGCCACCGACGCCGTGGG + Exonic
1037993503 8:23337209-23337231 CAGCACGTCCACCTTGCCTTTGG + Intronic
1049558716 8:143296825-143296847 CCTCGCGCCCACCAGGCCGCCGG - Exonic
1049651595 8:143772233-143772255 CACGGCGCCCACCTTGCTGTTGG - Intergenic
1049693651 8:143973458-143973480 CAGCGGGCCGGCCATGCCGGCGG + Intronic
1057030294 9:91769893-91769915 CTGAGCGCCCAGCATGCTGTGGG + Intronic
1061369602 9:130191068-130191090 CAGGGCGCCCACCATGTGCTGGG + Intronic
1189373071 X:40445408-40445430 CAGCCTCCCCACCATGCCCTAGG + Intergenic
1199313552 X:146349743-146349765 CTGAGTGCCCACCATGCCCTAGG + Intergenic