ID: 1183485075

View in Genome Browser
Species Human (GRCh38)
Location 22:38084204-38084226
Sequence CTGGACAAAAGCCTCTTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183485075_1183485091 24 Left 1183485075 22:38084204-38084226 CCTGCTAAGAGGCTTTTGTCCAG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1183485091 22:38084251-38084273 CAGGCCAGGCTGGGCCTCGGCGG 0: 1
1: 0
2: 8
3: 69
4: 531
1183485075_1183485092 27 Left 1183485075 22:38084204-38084226 CCTGCTAAGAGGCTTTTGTCCAG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1183485092 22:38084254-38084276 GCCAGGCTGGGCCTCGGCGGTGG 0: 1
1: 0
2: 2
3: 28
4: 429
1183485075_1183485088 21 Left 1183485075 22:38084204-38084226 CCTGCTAAGAGGCTTTTGTCCAG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1183485088 22:38084248-38084270 CCCCAGGCCAGGCTGGGCCTCGG 0: 1
1: 2
2: 11
3: 137
4: 767
1183485075_1183485086 15 Left 1183485075 22:38084204-38084226 CCTGCTAAGAGGCTTTTGTCCAG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1183485086 22:38084242-38084264 TGGGAGCCCCAGGCCAGGCTGGG 0: 1
1: 0
2: 8
3: 104
4: 768
1183485075_1183485080 -5 Left 1183485075 22:38084204-38084226 CCTGCTAAGAGGCTTTTGTCCAG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1183485080 22:38084222-38084244 TCCAGGAGGGGAGAAGAGACTGG 0: 1
1: 0
2: 6
3: 72
4: 543
1183485075_1183485083 5 Left 1183485075 22:38084204-38084226 CCTGCTAAGAGGCTTTTGTCCAG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1183485083 22:38084232-38084254 GAGAAGAGACTGGGAGCCCCAGG 0: 1
1: 2
2: 4
3: 45
4: 392
1183485075_1183485085 14 Left 1183485075 22:38084204-38084226 CCTGCTAAGAGGCTTTTGTCCAG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1183485085 22:38084241-38084263 CTGGGAGCCCCAGGCCAGGCTGG 0: 1
1: 2
2: 16
3: 117
4: 1027
1183485075_1183485094 28 Left 1183485075 22:38084204-38084226 CCTGCTAAGAGGCTTTTGTCCAG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1183485094 22:38084255-38084277 CCAGGCTGGGCCTCGGCGGTGGG 0: 1
1: 0
2: 0
3: 20
4: 236
1183485075_1183485084 10 Left 1183485075 22:38084204-38084226 CCTGCTAAGAGGCTTTTGTCCAG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1183485084 22:38084237-38084259 GAGACTGGGAGCCCCAGGCCAGG 0: 1
1: 0
2: 4
3: 50
4: 540
1183485075_1183485082 -4 Left 1183485075 22:38084204-38084226 CCTGCTAAGAGGCTTTTGTCCAG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1183485082 22:38084223-38084245 CCAGGAGGGGAGAAGAGACTGGG 0: 1
1: 0
2: 4
3: 56
4: 546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183485075 Original CRISPR CTGGACAAAAGCCTCTTAGC AGG (reversed) Intergenic
903801252 1:25970151-25970173 CTGGACACTAGCCTTTTAGTTGG - Intronic
905317687 1:37093979-37094001 CTGGACACAATCCTCTTGGGTGG - Intergenic
905514550 1:38552584-38552606 CTAGACAAAAGACTTTGAGCAGG + Intergenic
906273474 1:44499372-44499394 CTGGACAAAAGCCATTTCACAGG - Intronic
911008588 1:93253931-93253953 ATAGTCAAAAGCCTCTTTGCAGG - Intronic
913110595 1:115654087-115654109 TTGGACAAAATACCCTTAGCTGG - Intronic
914222831 1:145695729-145695751 TTTGACAACAGCCTCTTACCTGG - Intronic
915512429 1:156393489-156393511 CTGTACAAAAGCCTTGTACCTGG - Intergenic
917077203 1:171218145-171218167 ATGGAGTAAAGCCCCTTAGCAGG + Intergenic
918660149 1:187078276-187078298 CCGGACAATAGCCTCATAACTGG - Intergenic
921893089 1:220372028-220372050 CTTGACAAAAGACTCTTATATGG - Intergenic
922917968 1:229273901-229273923 CTGGACATTTGCCTCTGAGCTGG + Intronic
923918677 1:238538929-238538951 GTGGACTATAGACTCTTAGCTGG + Intergenic
924147758 1:241094656-241094678 CTGGACAAAATGCATTTAGCAGG + Intronic
1065368532 10:24957949-24957971 CAGGACAAAAGCCTCCAGGCTGG - Intergenic
1067043632 10:42971452-42971474 CTGGACTTAAGCCCCTTGGCAGG - Intergenic
1074341551 10:112635617-112635639 CAGTGCAAAAGCCTCTTAACTGG - Intronic
1076718591 10:132382029-132382051 CTGGACAAGAACCTCTTTTCTGG + Intergenic
1077295574 11:1824934-1824956 CTGCACAGAAGCCTCTGAACTGG - Intergenic
1079127822 11:17731278-17731300 CTGGACAAAAGCCTAGGGGCTGG + Intergenic
1083558092 11:63648518-63648540 TTTGAGAAAAGCCTCTTAGCAGG + Intronic
1089294651 11:117460398-117460420 CTGGACAAATGACTGTGAGCTGG + Intronic
1089734804 11:120543033-120543055 CTGGCTGAAAGCCTCATAGCTGG + Intronic
1090535083 11:127632095-127632117 CTGGAAACAAGCTTCTGAGCTGG + Intergenic
1100817102 12:98397001-98397023 GAGGCCAAAAGCATCTTAGCTGG + Intergenic
1106179154 13:27356231-27356253 CTGGACAAAGGCCTGGGAGCAGG - Intergenic
1106680828 13:32005374-32005396 GTGAACAAAAGTCTTTTAGCTGG + Intergenic
1108567909 13:51719359-51719381 CTGGACAAAAATCTCTTAGTGGG + Intronic
1117582811 14:57169815-57169837 ATGGACAACATTCTCTTAGCTGG - Intergenic
1117996051 14:61479325-61479347 CTGGAAAAGAGACTCTGAGCAGG + Intronic
1120439293 14:84515096-84515118 CTGCACAAAAGCTTTTTAACTGG + Intergenic
1124457981 15:29862478-29862500 GTATACAAAAGCCTCTCAGCTGG + Intronic
1126902122 15:53325368-53325390 GTGCACAAAAGCCTCTGATCTGG + Intergenic
1130146983 15:81281875-81281897 CTCAACAGAGGCCTCTTAGCTGG + Intronic
1130812254 15:87392155-87392177 CTGGAGAAAACCTTCTGAGCCGG + Intergenic
1133818998 16:9219963-9219985 CTTGACTAAAGCCACATAGCTGG - Intergenic
1133926074 16:10193588-10193610 CAGGACAAAAGCCTGTTTTCTGG + Intergenic
1136284022 16:29230833-29230855 TTGGACAGAAGCCTCAGAGCTGG + Intergenic
1136383871 16:29910900-29910922 CTGGACAAAAGCAGGTTGGCAGG - Intronic
1139839892 16:69869875-69869897 CTGGACCAAAGACTCCCAGCAGG + Intronic
1139963290 16:70730207-70730229 TTGGACAACAGCCTCCCAGCTGG + Intronic
1142089056 16:88200341-88200363 TTGGACAGAAGCCTCAGAGCTGG + Intergenic
1144129587 17:12233160-12233182 CTGTACAAAAGGCTCTGAGCTGG + Intergenic
1145040118 17:19571551-19571573 TTGGAAAAAAGCCTGTCAGCAGG + Exonic
1147503887 17:40994215-40994237 CAGGAAAGAAGCCTCTTGGCTGG - Intergenic
1150282638 17:63938347-63938369 CCTTACAAAAGCCCCTTAGCTGG - Intergenic
1152228100 17:79101977-79101999 CTGGAGTCCAGCCTCTTAGCTGG - Intronic
1159339204 18:67112824-67112846 TTGGACAAAAGCCATTTAACTGG + Intergenic
1163706692 19:18818423-18818445 CTGGATACAAATCTCTTAGCAGG - Intergenic
1167966190 19:53149282-53149304 CTGTACAAAGTCCTCTGAGCGGG + Exonic
1167973417 19:53204079-53204101 CTGTACAAAGCCCTCTGAGCAGG - Intergenic
1168443307 19:56390416-56390438 CTGTACAAATCCCTCTGAGCAGG + Exonic
1168445953 19:56414022-56414044 CTGTACAAATTCCTCTGAGCAGG - Exonic
925937017 2:8773889-8773911 CTTGAGAAAAGCATCTTAACAGG - Intronic
943809717 2:192169642-192169664 TTGGAAAAAAGCCTCCTAACAGG - Intronic
944081789 2:195796363-195796385 CTGGGCAAATCCCTCTTAACAGG - Intronic
944578998 2:201116270-201116292 CTGGACAAAAGTCCAATAGCCGG - Exonic
946642342 2:221798054-221798076 CTGGAGAATAGCCTGCTAGCTGG - Intergenic
948118648 2:235512689-235512711 CTGGGCAAAGGCATCTGAGCTGG + Intronic
948402576 2:237694401-237694423 CTGAACATTAGCCTCTTAACAGG - Intronic
1172293018 20:33789605-33789627 CTGAACCAGACCCTCTTAGCAGG - Intronic
1172352868 20:34256940-34256962 ATTAACAAAAGGCTCTTAGCAGG - Intronic
1173409599 20:42798088-42798110 CTGGGCAAAAGCCTAGCAGCAGG - Intronic
1173890438 20:46504655-46504677 CTGTACAGGAGCCTCTGAGCAGG + Exonic
1174836485 20:53860497-53860519 CAGGACAAAAGTATCATAGCAGG - Intergenic
1175878743 20:62244168-62244190 CAGGACAACAGCCTCTCACCTGG + Intronic
1183485075 22:38084204-38084226 CTGGACAAAAGCCTCTTAGCAGG - Intergenic
1183602040 22:38845281-38845303 CTGGACAAAATCCCCGTGGCTGG - Intergenic
1184534597 22:45077877-45077899 CTGGACCACAGCTTCTAAGCTGG - Intergenic
951380218 3:21974881-21974903 TTGGACAAAACCCTTTTAACTGG - Intronic
952622962 3:35368053-35368075 ATGGACAAAAGCATCCTTGCAGG - Intergenic
954859268 3:53674122-53674144 AGGGACAAAAGCCTCTTTCCTGG - Intronic
955589121 3:60515107-60515129 CTGGAGGAAAGCCTCTGACCTGG + Intronic
958839822 3:99190671-99190693 TTAGATAAAAGCCACTTAGCTGG - Intergenic
961592158 3:127989045-127989067 CTGGCAAAAAGCCTCCTACCTGG - Intergenic
961676057 3:128567408-128567430 CTGGACACAGGGCACTTAGCTGG + Intergenic
968092175 3:195905928-195905950 CTGGATATAAGCCTTTTATCAGG - Intronic
968529025 4:1080483-1080505 GTGGACAAAACCCACTTGGCTGG + Intronic
970162659 4:13204895-13204917 CTGGACAACATGCTCTTTGCTGG - Intergenic
970257385 4:14182800-14182822 ATGCCCAAAAGCCACTTAGCTGG - Intergenic
971444205 4:26724954-26724976 TTTGACAAATGCCTCTTGGCAGG + Intronic
976658569 4:87515239-87515261 CTTGATCAAAGTCTCTTAGCTGG - Intronic
978152337 4:105451849-105451871 CAGGACAAATGCATCTTAGCTGG - Intronic
980490360 4:133517267-133517289 GTGGACAAAAGCTTCTTAAATGG - Intergenic
981155568 4:141431002-141431024 CTGGATAAAAGCAACTCAGCTGG + Intergenic
983208025 4:164931589-164931611 CTAGAAATAAGCCTCTTAGGGGG - Intergenic
985656212 5:1132716-1132738 CTGGGCACACGCCTCTTAGGAGG - Intergenic
986750975 5:10787682-10787704 AAGGAGAAAAGCCTCTAAGCAGG - Intergenic
990922774 5:60985959-60985981 TTGGACACAAGCCATTTAGCTGG - Intronic
991966538 5:72096918-72096940 TTGGAGAAAAGCTTCTCAGCTGG - Intergenic
992166201 5:74054363-74054385 GTGAACAAAAGCCTATTAGAAGG - Intergenic
994401402 5:99284976-99284998 ATGGACAAAAGTATATTAGCTGG - Intergenic
994729660 5:103476850-103476872 CTAGACAAAAGCATCTTAGTGGG - Intergenic
995666127 5:114544602-114544624 ATCCTCAAAAGCCTCTTAGCTGG + Intergenic
996015013 5:118523663-118523685 CTGGATATAACCCTCTTTGCAGG + Intergenic
996688234 5:126308871-126308893 TTGGAAAAAAGCCAATTAGCTGG - Intergenic
1002199255 5:177518032-177518054 CAGTACAATGGCCTCTTAGCTGG + Intergenic
1002199348 5:177518755-177518777 CAGTACAATGGCCTCTTAGCTGG + Intergenic
1004432956 6:15562847-15562869 CTGGCCAACAGCCTCCTACCTGG + Intronic
1009963033 6:70547102-70547124 CTGGTAAAAAGACTCTAAGCAGG - Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1031380030 7:121074292-121074314 CTGGACAAGAGCCCCTTTTCTGG - Intronic
1036454950 8:8898364-8898386 CTTGACAAAAGACGCTTATCTGG - Intergenic
1039944867 8:42120409-42120431 CTGTACAACAGCCTCTTACTGGG + Intergenic
1048480738 8:134790251-134790273 CTGGACAAGAGCCTTTTAGGGGG - Intergenic
1049998787 9:1053803-1053825 CTGGCCAAAAGCATTTTAGAAGG + Exonic
1051395482 9:16615929-16615951 CTTGACTAAGGCCTCATAGCTGG + Intronic
1051703968 9:19856861-19856883 CTGGACAAATCCCCCTTATCTGG + Intergenic
1055732220 9:79289912-79289934 CTGGACAAACACCTCTTTGCAGG + Intergenic
1056183926 9:84112925-84112947 TTGGATAAAAGCCACTTAACTGG + Intergenic
1058638107 9:107056484-107056506 CTGGACCCAAGCCTCCTAACTGG - Intergenic
1058855216 9:109055349-109055371 CTGTAGAAAAGCCCATTAGCAGG - Intronic
1190512182 X:51184942-51184964 ATGGACAAAAGTCTCTTTGTGGG + Intergenic
1201396241 Y:13552241-13552263 CTGGACCCCAGCCTCATAGCGGG + Intergenic