ID: 1183487822

View in Genome Browser
Species Human (GRCh38)
Location 22:38098831-38098853
Sequence GGATTCTGCTTGGGAAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183487822_1183487828 6 Left 1183487822 22:38098831-38098853 CCTGACTTTCCCAAGCAGAATCC 0: 1
1: 0
2: 0
3: 16
4: 189
Right 1183487828 22:38098860-38098882 CCCTCGTTTTGTCTCTGGAATGG 0: 1
1: 0
2: 0
3: 8
4: 140
1183487822_1183487826 1 Left 1183487822 22:38098831-38098853 CCTGACTTTCCCAAGCAGAATCC 0: 1
1: 0
2: 0
3: 16
4: 189
Right 1183487826 22:38098855-38098877 TTGCTCCCTCGTTTTGTCTCTGG 0: 1
1: 0
2: 0
3: 14
4: 159
1183487822_1183487830 7 Left 1183487822 22:38098831-38098853 CCTGACTTTCCCAAGCAGAATCC 0: 1
1: 0
2: 0
3: 16
4: 189
Right 1183487830 22:38098861-38098883 CCTCGTTTTGTCTCTGGAATGGG 0: 1
1: 0
2: 3
3: 14
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183487822 Original CRISPR GGATTCTGCTTGGGAAAGTC AGG (reversed) Intronic
905091571 1:35434763-35434785 GGGTTCTGGTTGGGACTGTCAGG + Exonic
906530620 1:46521675-46521697 GTATTCTCCTTGGTAAAGTGGGG + Intergenic
907394989 1:54183438-54183460 GAATTCTTACTGGGAAAGTCGGG + Intronic
910613281 1:89167838-89167860 TGAATCTGGTTGGGAATGTCAGG - Intronic
911014489 1:93317681-93317703 GGATGCTGTTTCTGAAAGTCTGG + Intergenic
911664467 1:100538349-100538371 GGATGCTGCTTGGGAGAAGCGGG + Exonic
912438016 1:109675402-109675424 GGATTCTGCTGGGCATAGTAAGG + Intronic
912440527 1:109693861-109693883 GGATTCTGCTGGGCATAGTAAGG + Intronic
914874466 1:151502403-151502425 GGACTCTGCTTGGGAAAACCTGG - Intergenic
915577634 1:156791012-156791034 GGCCTCTGCTTGGTGAAGTCAGG - Intronic
915766179 1:158365001-158365023 GCATGCTGCTTGGGAATGTGAGG - Intergenic
917706906 1:177643968-177643990 GAGTTCTGCTCTGGAAAGTCAGG + Intergenic
918862622 1:189851460-189851482 TGATTCTGTGTGTGAAAGTCAGG - Intergenic
919271515 1:195354191-195354213 AGATTATGCTTGGGAAATTTTGG - Intergenic
920195984 1:204227778-204227800 CCATTCTGCTTGGGCAGGTCAGG - Intronic
921900947 1:220450259-220450281 GGATACTGTTTAGGAAAATCAGG - Intergenic
1068656575 10:59582143-59582165 GAATTGTGATTGGGAAAGTGCGG + Intergenic
1070289799 10:75106712-75106734 GGATCCTGCTTCTTAAAGTCTGG + Intronic
1073894282 10:108136575-108136597 GGACTGTGGTTGGGAAAGTTTGG - Intergenic
1074176574 10:111011281-111011303 AGATTCTGTTTGGGATAGTTTGG - Intronic
1075924125 10:126236519-126236541 GGATACTGCATGGGAGAGTGTGG + Intronic
1076027882 10:127131279-127131301 GGCTTCTGTTTGGGAAGATCAGG - Intronic
1076220237 10:128728007-128728029 GTGATCTGCTTGGGAAGGTCAGG - Intergenic
1078355124 11:10627345-10627367 GGATTCTGTCTGGGGAAGCCGGG - Intronic
1079627625 11:22634691-22634713 GGATGGTGCTGGGGAATGTCTGG + Intronic
1079754533 11:24239746-24239768 GGACTCTGTTTGGGAAAACCAGG - Intergenic
1083332859 11:61907080-61907102 GGTTTCTGCTTTGTAAAGTGGGG + Intronic
1084840364 11:71841256-71841278 AGATTTTGCTGGGGAAAGACAGG - Intergenic
1088052168 11:105530241-105530263 AGATTCTGGTTTGGAGAGTCTGG + Intergenic
1088294702 11:108279411-108279433 GGAATATGCTTTGGAAAGTAGGG + Intronic
1089169499 11:116502273-116502295 GGATTTTGCTTTGAAAATTCTGG + Intergenic
1090824070 11:130371269-130371291 AGATTCTGATTCAGAAAGTCTGG + Intergenic
1095237765 12:39818889-39818911 GAATTCTGCTTGGGACAATCAGG - Intronic
1095371122 12:41468597-41468619 GGAATTTACTTGGGAAAGTGTGG - Intronic
1098457608 12:70692758-70692780 TAATTCTGCCTGGGAAGGTCAGG - Intronic
1101732334 12:107437058-107437080 GGGTTCTTCTTGAGAAAGCCTGG + Intronic
1102160825 12:110767254-110767276 GCATTCTGTTTGGGAATGCCAGG - Intergenic
1103851317 12:123935317-123935339 GTATTCTGCAAGGGAAAGGCAGG - Exonic
1104962026 12:132492809-132492831 GGAGCCTGCCTGGGAAAGTACGG + Intronic
1107559022 13:41544058-41544080 GGAGTCTCCTTGGGATAGCCAGG - Intergenic
1108883236 13:55147358-55147380 GGATTGTGAATGGTAAAGTCAGG - Intergenic
1110538808 13:76684509-76684531 GGATACTGCCTAGGAAAGTGGGG - Intergenic
1110620283 13:77586780-77586802 GGAATCTGAAAGGGAAAGTCTGG - Intronic
1111600260 13:90464191-90464213 AGATTCTTCTTGAGAATGTCAGG + Intergenic
1112623163 13:101073098-101073120 GGATGATGCTTGGGGAAGACAGG + Intronic
1117599619 14:57361988-57362010 GGATTCTGCCTCAGAAAGTATGG + Intergenic
1123768189 15:23502392-23502414 GTATTCTGATTGGGAAATTTAGG + Intergenic
1124961285 15:34397723-34397745 GGATTCTCCTGGAGAATGTCAGG + Intronic
1124977913 15:34543947-34543969 GGATTCTCCTGGAGAATGTCAGG + Intronic
1126118594 15:45231216-45231238 GGGTTCTGATTAGAAAAGTCTGG - Intergenic
1128916146 15:71564358-71564380 TGATTCTGCTGAGGAAAGTCAGG + Intronic
1129124851 15:73430785-73430807 TAATTCTGCCTGGGAGAGTCAGG + Intergenic
1129595686 15:76962361-76962383 GGTTTCTGGTTGGGAGAGTGAGG - Intergenic
1130612943 15:85378099-85378121 GGATTCTGATTCAGTAAGTCTGG - Intergenic
1132649113 16:1012585-1012607 GGAATCATCTTGGGAAAGGCAGG - Intergenic
1133143683 16:3767566-3767588 TGTTTCTGCAGGGGAAAGTCTGG + Intronic
1135165703 16:20137495-20137517 AGATTCTGCTTCAGTAAGTCTGG - Intergenic
1135261254 16:20982962-20982984 GGATTCTGGTGGGGTAAGTGGGG + Intronic
1135288486 16:21214300-21214322 GGATTCTGCTCCGGAAAAGCAGG + Exonic
1135379247 16:21980396-21980418 GCATTCTTCTTGGGGAATTCAGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1137784220 16:51124576-51124598 GGCTTCTGCTTCTGGAAGTCTGG - Intergenic
1139158737 16:64477180-64477202 GGATTCTTCTTGGATAAGTGAGG + Intergenic
1141587084 16:85041479-85041501 GGATTGTGCTTGGGAAAGGAAGG + Intronic
1141907940 16:87040115-87040137 GGATGCTGCTCCGGAAAGCCAGG - Intergenic
1142580081 17:936539-936561 GGATTCTGCTGCGGAAAAACTGG + Intronic
1144021901 17:11245276-11245298 GGCTTCCGGTTGGGAAAGGCAGG - Intronic
1144059175 17:11567214-11567236 AGATTCTGATTAGGAAAGTCTGG - Intergenic
1146642729 17:34553382-34553404 GGGTCCTGCTGGGGAAGGTCAGG - Intergenic
1147867381 17:43562124-43562146 GGGCTCTGCTTGGGGAAGTGGGG + Intronic
1149394184 17:56222011-56222033 AGATTCTGATTTGGAAGGTCTGG - Intronic
1150337210 17:64339200-64339222 GTCTTCGGTTTGGGAAAGTCGGG - Intronic
1150472817 17:65451641-65451663 ACATTCTACTTGGGAAAGACAGG + Intergenic
1155233651 18:23797825-23797847 GCATTGTACTTAGGAAAGTCTGG - Intronic
1155280361 18:24233397-24233419 GGATTCTGCAGGGGAGAGTAGGG - Intronic
1156214841 18:34987368-34987390 AGATTGTGATTGGGGAAGTCTGG - Intronic
1158306199 18:56108755-56108777 GGTTTCGGTTTGGCAAAGTCAGG + Intergenic
1167425321 19:49427191-49427213 GAATTCTGTTTGGGAAATTTCGG - Exonic
925120155 2:1411989-1412011 GGATTCTTCTTGGGAGAATGTGG - Intronic
925910173 2:8568786-8568808 GGATGCAGATTGGGAAAGTTTGG - Intergenic
927862977 2:26571494-26571516 GGATTGGGCTTGGGGAAGGCAGG + Intronic
928862015 2:35870042-35870064 GAATTCAGTTTGGGAAAGTTTGG + Intergenic
929635872 2:43520841-43520863 AGGTTCTGATTGGGAAAGTCAGG - Intronic
930419848 2:51136408-51136430 TGATTCTGTTTGAGAGAGTCAGG - Intergenic
931128264 2:59302055-59302077 GGCTTCTGCTCTGGGAAGTCTGG + Intergenic
931167878 2:59769144-59769166 AGATTCTGATGGAGAAAGTCTGG - Intergenic
935125356 2:100217850-100217872 CTATTCTGCTTAGGAAAGCCTGG - Intergenic
935756588 2:106280963-106280985 GGATTCTGTTTGAGTAGGTCAGG + Intergenic
936505672 2:113103791-113103813 GGATTCTGTTTGGGACATTCTGG + Intergenic
937844652 2:126566194-126566216 GGAGGCTGCTAGGGAAAGGCAGG + Intergenic
939144119 2:138391634-138391656 TCATTCTTCATGGGAAAGTCAGG - Intergenic
939584232 2:143987480-143987502 TAATTCTGCCTGGAAAAGTCAGG - Intronic
939608192 2:144277944-144277966 TGCTTCTCCTTGGGAAACTCAGG - Intronic
939959641 2:148555012-148555034 AGATTCTGCTTTGGGAGGTCCGG + Intergenic
940263239 2:151807472-151807494 GAATCCTGATTGGGAAAGGCTGG - Intronic
943763286 2:191632446-191632468 TGATTTTGCTTGGGATAGGCTGG + Intergenic
946194988 2:218027541-218027563 CTGTTCTGCTTGGGACAGTCTGG - Intergenic
946854426 2:223939187-223939209 AGTTTCTGATTTGGAAAGTCAGG - Intronic
948716751 2:239870164-239870186 GGATTCTCCTTCGGAATGACAGG - Intergenic
1169621589 20:7512949-7512971 GAATTCTACCTGGGAAAGGCAGG + Intergenic
1170800483 20:19586144-19586166 GGCGTCTGTTTTGGAAAGTCTGG + Intronic
1171379399 20:24722731-24722753 AGCTTGTGCCTGGGAAAGTCTGG - Intergenic
1173240587 20:41293245-41293267 AGATTCTGATTCAGAAAGTCTGG - Intronic
1174353418 20:49983443-49983465 GGACGCTGCTGGGGAGAGTCCGG + Intronic
1174544746 20:51317005-51317027 GCATTCTGCCTGGGAGAGCCTGG - Intergenic
1174707823 20:52675039-52675061 GGATTCAGTTTGAGAAAATCTGG + Intergenic
1174849748 20:53981299-53981321 GGATTCTGGTTAAGAAAGTCTGG - Intronic
1177581906 21:23034601-23034623 TTATTCTGCTTGGTAAATTCTGG + Intergenic
1181885932 22:26022537-26022559 GATTTCTGCATGGGAAAGCCAGG + Intronic
1182309263 22:29393100-29393122 AAATTCAGCCTGGGAAAGTCAGG + Intronic
1183487822 22:38098831-38098853 GGATTCTGCTTGGGAAAGTCAGG - Intronic
1183744061 22:39683460-39683482 GAATTCTGGTTTGGGAAGTCTGG - Intronic
950146720 3:10655383-10655405 GGATTCTGATTGAGCAGGTCTGG - Intronic
950628885 3:14268141-14268163 GGATCCTGCTGGGGAAGGGCAGG - Intergenic
951637197 3:24792551-24792573 TGATTCTGCTGGGGAACTTCTGG - Intergenic
952053270 3:29412547-29412569 TGATTCTTCTTGGGAGACTCAGG - Intronic
952552354 3:34493961-34493983 GGAACCTGCTTGGGAATGTAGGG - Intergenic
952982313 3:38746950-38746972 GGATTATGCTTAAGAAAGTTTGG - Intronic
954877258 3:53810226-53810248 GGAAGCTGCTGGGGACAGTCAGG - Exonic
954969642 3:54640198-54640220 GTATTCTCTTTGGGAATGTCAGG - Intronic
959537504 3:107502990-107503012 GCACACTGCTTGGGAAAGTATGG + Intergenic
963778889 3:149466794-149466816 AGATTCTGATTTAGAAAGTCTGG - Intergenic
964509912 3:157438570-157438592 GGATTCAGCGTGGAACAGTCAGG + Intronic
966787250 3:183632709-183632731 GGATTCTTTGTGGGAAAATCTGG - Intergenic
966901731 3:184491625-184491647 GGACTCTGCCGGGGACAGTCTGG + Intronic
967201752 3:187077937-187077959 TGATTCTGCTTGGGAATGGGCGG + Exonic
969781454 4:9407255-9407277 AGATTTTGCTGGGGAAAGACAGG - Intergenic
970663681 4:18313331-18313353 GGATTCTGATTCAGTAAGTCTGG - Intergenic
970689608 4:18607363-18607385 GGATTCTGATTCAGTAAGTCTGG + Intergenic
972777307 4:42253736-42253758 GGCTTCTGTTTAAGAAAGTCTGG + Intergenic
973333964 4:48937269-48937291 GGATTGTGCTTTAGAAAGTCAGG + Intergenic
975740042 4:77420823-77420845 GAATTCTGCCAGGGAGAGTCTGG + Intronic
979611637 4:122695524-122695546 GGAGTCTGCTGGAGAAATTCTGG + Intergenic
981716843 4:147760388-147760410 GGTTTCTACTTGGCAACGTCAGG + Intronic
981934996 4:150229504-150229526 TGTTTCTGCTTGGGACAGCCAGG + Intronic
982054867 4:151538456-151538478 AGATTCTGATTTGGAAGGTCTGG - Intronic
983993678 4:174154699-174154721 TGATTCAGCTTGGGACAGTTGGG + Intergenic
986093531 5:4534677-4534699 GGACCTTGGTTGGGAAAGTCTGG + Intergenic
986258169 5:6119178-6119200 GCATTCTGCCTGAGAAAGGCAGG + Intergenic
987038393 5:14039793-14039815 GGATTCTGATTCAGAAGGTCTGG - Intergenic
990277120 5:54209225-54209247 GGCTTCTGCTTTGGAAATTGAGG - Intronic
990779848 5:59347956-59347978 AGGTTCTGCTTGGGGAAGCCAGG - Intronic
990950935 5:61297725-61297747 GGATTCTCTTTGGTAAAGTGAGG - Intergenic
991166406 5:63568725-63568747 GGAGTCTGTCTGGGGAAGTCTGG + Intergenic
992913126 5:81418171-81418193 AAATTCTTCTTGGTAAAGTCAGG + Exonic
993188419 5:84649891-84649913 GGATTCTGCTTGGCTAACTATGG - Intergenic
993949241 5:94153301-94153323 GGATTCTGATTGGGAAAACATGG + Intronic
994232294 5:97321542-97321564 GGATTCTGTTTGGAAATGACAGG + Intergenic
995836301 5:116402913-116402935 GGCTTCTCATTGGGGAAGTCAGG + Intronic
997011902 5:129888293-129888315 TAACTCTGCTTGGGAAATTCTGG - Intergenic
998013863 5:138716864-138716886 GGAATCTGCTTGTAAAAGACAGG - Intronic
998478663 5:142442996-142443018 GGATTCTCCTTGGGCCAGTCAGG + Intergenic
998959827 5:147473264-147473286 GAATTCTACTTGGAAAACTCAGG - Intronic
999739446 5:154538970-154538992 GGCTTATACTTGGGAAAGTTGGG - Intergenic
1000372595 5:160551331-160551353 GGGTTCTGCTTGGGACATTCTGG - Intergenic
1001145947 5:169184825-169184847 GGATTCTGATTGTGTAAGTCTGG - Intronic
1003141699 6:3477338-3477360 GGATTCTGATTCTGTAAGTCTGG - Intergenic
1005249245 6:23925982-23926004 GCACTCTCCTTGGCAAAGTCTGG + Intergenic
1007069076 6:39022052-39022074 GGATTATACTTTGGAAACTCAGG - Intronic
1010203128 6:73299843-73299865 GGATTCTGCTGGGATAAGTGGGG + Intronic
1012377426 6:98579328-98579350 GGAGCCTGCCTGGGTAAGTCTGG - Intergenic
1012579990 6:100855637-100855659 GGAAACTGCTTAGGTAAGTCAGG - Intronic
1013033362 6:106357808-106357830 AAATTCTGCTTGGAAAAGCCAGG + Intergenic
1013824313 6:114193292-114193314 TAATTCTGCTTAGAAAAGTCAGG + Intronic
1014499083 6:122164092-122164114 GGATTCTGGCTGGCAGAGTCAGG + Intergenic
1017078313 6:150640573-150640595 GGGTTTTGCGTGGGAGAGTCCGG - Intronic
1017300205 6:152848565-152848587 TGATTCTGATTAGGAAAGTCAGG + Intergenic
1018280852 6:162183901-162183923 GGATTCTCCCTGGGGCAGTCAGG - Intronic
1021466590 7:20951265-20951287 AGTTTCTGTTTGGGAAAATCTGG - Intergenic
1023576056 7:41628142-41628164 AGATTCTGATTGGGGAGGTCTGG - Intergenic
1027262409 7:76474397-76474419 GGTTTCTGCTTGTAAAAGTCTGG + Intronic
1027313787 7:76972489-76972511 GGTTTCTGCTTGTAAAAGTCTGG + Intergenic
1027697872 7:81433880-81433902 GCATTGTGATTGGGCAAGTCTGG - Intergenic
1029036926 7:97532279-97532301 GGATTTTGCTTGGCAAACACAGG + Intergenic
1033009611 7:137606555-137606577 AGATTCTGCTTCAGTAAGTCGGG - Intronic
1034885870 7:154798394-154798416 GGATTCTGCTTGGAAGGATCTGG - Intronic
1036801126 8:11793576-11793598 GGATGCTGTCAGGGAAAGTCAGG - Intergenic
1036837979 8:12091477-12091499 AGATTTTGCTGGGGAAAGACAGG + Intergenic
1036859769 8:12337724-12337746 AGATTTTGCTGGGGAAAGACAGG + Intergenic
1037760864 8:21740635-21740657 GGATTCTCCTAGGGAGAGTCTGG - Intronic
1039456242 8:37709152-37709174 GGCTTCTGTTTGGTAAGGTCTGG - Intergenic
1039836492 8:41260389-41260411 ACATTCTGATTGGGAAAGTTTGG - Intergenic
1039993942 8:42514860-42514882 GGATTCAGCTTAGGGAAGCCTGG + Intronic
1041269104 8:56093581-56093603 TTCTTCTGCCTGGGAAAGTCAGG - Intergenic
1043516926 8:81003254-81003276 AGATTCTGATTTGGCAAGTCTGG + Intronic
1044428622 8:92082956-92082978 GGAATCTGGTAGGGAAAATCTGG + Intronic
1044553177 8:93534587-93534609 GAATTCTGCCTGGGATATTCTGG - Intergenic
1047786252 8:128156457-128156479 GAATTCTGATTGGGTAGGTCTGG - Intergenic
1048369804 8:133767417-133767439 TGATTCTGTTGGGGAAAGCCAGG + Intergenic
1049003487 8:139840622-139840644 GGATTCTGCACTGGACAGTCGGG + Intronic
1049383075 8:142327032-142327054 GGCAGCTGCTTTGGAAAGTCTGG + Intronic
1049634766 8:143681676-143681698 GGATTCTGCTTGGGAGCTGCTGG + Intergenic
1050453400 9:5807801-5807823 GAATTTTGCTTGTGGAAGTCAGG - Intronic
1051906759 9:22104249-22104271 GGATTTTACTTGGCAAGGTCAGG + Intergenic
1055397322 9:75889900-75889922 GGACTGTGCTTGGAAAAGTTGGG + Intergenic
1057772271 9:97979165-97979187 GGATGCTGCTTGGGTAAGGAAGG + Intergenic
1058636450 9:107042994-107043016 GGCTCCTGCTTGAGAAGGTCAGG - Intergenic
1059373050 9:113858895-113858917 GGATTCTGCTCTGGAAGGGCAGG - Intergenic
1186064989 X:5753638-5753660 AGATTAAGCTTGGGAAATTCTGG + Intergenic
1187199971 X:17125503-17125525 GGATTCTGATGAGGGAAGTCTGG + Intronic
1188343328 X:29032369-29032391 GGATTCTGCTTAGGTAGATCTGG - Intronic
1189228124 X:39430602-39430624 AGATTCTGATTGGGTAGGTCTGG - Intergenic
1195528797 X:105927055-105927077 GGATATTGCTTGGGATAGTAGGG + Intronic
1196232062 X:113235202-113235224 GGGTATTGCTTGAGAAAGTCTGG + Intergenic
1197112920 X:122797717-122797739 GCCTTCTGCTTGGGAAAAGCAGG + Intergenic
1201012995 Y:9567701-9567723 GGTTTCTGTTTGGGAAAGAAGGG + Intergenic