ID: 1183489112

View in Genome Browser
Species Human (GRCh38)
Location 22:38107402-38107424
Sequence GCTGCTGGATCGACAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183489106_1183489112 13 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1183489106 22:38107366-38107388 CCGGGGGGCTGGGCTGTGTTGGG 0: 1
1: 0
2: 5
3: 62
4: 528
Right 1183489112 22:38107402-38107424 GCTGCTGGATCGACAGAGCCAGG 0: 1
1: 0
2: 1
3: 12
4: 212
1183489104_1183489112 21 Left 1183489104 22:38107358-38107380 CCACTCTTCCGGGGGGCTGGGCT 0: 1
1: 0
2: 0
3: 24
4: 175
Right 1183489112 22:38107402-38107424 GCTGCTGGATCGACAGAGCCAGG 0: 1
1: 0
2: 1
3: 12
4: 212
1183489103_1183489112 22 Left 1183489103 22:38107357-38107379 CCCACTCTTCCGGGGGGCTGGGC 0: 1
1: 0
2: 0
3: 14
4: 143
Right 1183489112 22:38107402-38107424 GCTGCTGGATCGACAGAGCCAGG 0: 1
1: 0
2: 1
3: 12
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183489112 Original CRISPR GCTGCTGGATCGACAGAGCC AGG Intronic
900142828 1:1145679-1145701 GCTGCAGGTCCGGCAGAGCCAGG + Intergenic
900959213 1:5908729-5908751 GCTGCTTGGCCGACAGGGCCAGG + Intronic
903380620 1:22894483-22894505 GCTGCTGGAGAGACTGAGACAGG + Intronic
904646179 1:31968302-31968324 GCAGCTGGGGCGACAGAGCAAGG + Intergenic
910924039 1:92380029-92380051 GCTGGTGGATCGCCTGAGGCTGG + Intronic
913046418 1:115077012-115077034 GGTGGTGGATCGCTAGAGCCCGG - Intronic
914087755 1:144469031-144469053 GCTGCTGGTTGGGCAGAGCTAGG - Intergenic
914310856 1:146465173-146465195 GCTGCTGGTTGGGCAGAGCTAGG + Intergenic
914314317 1:146495536-146495558 GCTGCTGGTTGGGCAGAGCTAGG - Intergenic
914500031 1:148237845-148237867 GCTGCTGGTTGGGCAGAGCTAGG + Intergenic
914591248 1:149107973-149107995 GCTGCTGGTTGGGCAGAGCTAGG - Intergenic
915009094 1:152667764-152667786 GCAGCAGCAGCGACAGAGCCTGG - Intergenic
915010359 1:152679553-152679575 GCAGCAGCAGCGACAGAGCCTGG - Intergenic
915399863 1:155614213-155614235 GCTGCAGGAGCTACAAAGCCTGG + Exonic
915417021 1:155750077-155750099 GCTGCAGGAGCTACAAAGCCTGG + Exonic
916028890 1:160859676-160859698 GCAGGTGGATCGCCTGAGCCCGG + Intronic
918240318 1:182615057-182615079 GCTGATGGTGCCACAGAGCCCGG - Intergenic
919013223 1:191992486-191992508 GCTGTTTGATAGACAGAGCAGGG - Intergenic
920857672 1:209675963-209675985 GCTGCCGGTTGGACAGGGCCCGG - Exonic
922200192 1:223394384-223394406 GCTGCTGCTGCGGCAGAGCCAGG + Exonic
923042536 1:230329746-230329768 GCTGCTGGGTCAACCCAGCCTGG + Intronic
923458496 1:234187035-234187057 TCCCCTGGATCCACAGAGCCAGG - Intronic
1072152193 10:92691914-92691936 GCTGCTGCACCGACAAGGCCTGG - Intronic
1073174257 10:101542663-101542685 GTGGGTGGATTGACAGAGCCTGG - Intronic
1075679670 10:124323249-124323271 GCTACAGGATGGACAGAGCTTGG - Intergenic
1076800708 10:132826742-132826764 GAAGCTGGAGCCACAGAGCCAGG + Intronic
1077888329 11:6402146-6402168 GCTAGTGGAGCCACAGAGCCAGG - Exonic
1078076725 11:8168920-8168942 GCAGCAGCAGCGACAGAGCCAGG + Exonic
1083752126 11:64766593-64766615 GCGGCTGGCTGGACTGAGCCTGG - Intronic
1085052924 11:73388980-73389002 GCTGCTGGGCAGGCAGAGCCCGG - Intronic
1085300046 11:75452637-75452659 GCTGCTGGAGGGACAGAGGCTGG + Intronic
1087345056 11:96961658-96961680 GCTGCTGAATCTCCAGTGCCTGG - Intergenic
1091697904 12:2640425-2640447 GATGCTGGATCCACAAAGCCTGG + Intronic
1092081008 12:5716355-5716377 ACTGCAGGATGGAAAGAGCCAGG - Intronic
1094599715 12:31898031-31898053 GCAGCAGGAGCTACAGAGCCGGG - Intergenic
1094616654 12:32042286-32042308 GCTGGAGGATCGATTGAGCCAGG - Intergenic
1095962695 12:47845258-47845280 GCTGAGGGATGGACAGAGCATGG - Intronic
1099080268 12:78170111-78170133 GTAGCTGGATATACAGAGCCTGG - Intronic
1101032677 12:100675990-100676012 GCTTCTGGATCCACCAAGCCAGG + Intergenic
1104134870 12:125927829-125927851 CCTGCTGCATAGACAGAGCAGGG - Intergenic
1104761798 12:131301142-131301164 CCTGGAGGATCCACAGAGCCGGG - Intergenic
1105943369 13:25170556-25170578 GAGGGTGGATCGACAGAGGCAGG + Exonic
1106112533 13:26789576-26789598 GCTGCTAGATGAACAGATCCAGG + Intergenic
1106361941 13:29039053-29039075 GATGCTGGATAGACCCAGCCAGG + Intronic
1108344851 13:49535483-49535505 GCTTCTGGTTCGATAGAACCCGG - Intronic
1108451937 13:50575858-50575880 GCTGCAGCATGAACAGAGCCTGG + Intronic
1108571191 13:51753135-51753157 GCTGAAGGATCAACAGAGTCTGG + Intronic
1108637295 13:52348302-52348324 GCTGTTGGAAGGAGAGAGCCTGG - Intergenic
1109128023 13:58543079-58543101 GCTGTTGGATCCACAGCTCCTGG + Intergenic
1112597564 13:100822486-100822508 GCTGGTGGATCAAATGAGCCAGG + Intergenic
1113867198 13:113534676-113534698 GCTGCTGGAGAGACTGAGCTGGG + Intronic
1113921331 13:113914613-113914635 GCTGCTGCACGGACAGAGCAGGG + Intergenic
1115365859 14:32556434-32556456 GCAGGTGGATCGATTGAGCCTGG - Intronic
1118392457 14:65306801-65306823 GCTGATGGTTAGAAAGAGCCTGG + Intergenic
1119867960 14:77989812-77989834 GCTGATGCAGCGACAGAGGCCGG - Intergenic
1119889921 14:78174922-78174944 CCTGCTGCCTTGACAGAGCCTGG + Intergenic
1120560203 14:85982579-85982601 GCTGCAGGAACTACAGACCCAGG + Intergenic
1121235872 14:92390948-92390970 GCTGCAAGATGGAAAGAGCCTGG - Intronic
1121317080 14:92968672-92968694 GCTGCTGTCTTAACAGAGCCTGG - Intronic
1122128896 14:99593765-99593787 TCTGCTGGGTGGCCAGAGCCAGG - Intronic
1122885424 14:104708374-104708396 CCTGCTGGATCGCCAGGCCCCGG + Intronic
1126226895 15:46281282-46281304 GCTGCTGGCTTGACAGCTCCAGG + Intergenic
1126338607 15:47614692-47614714 GGTCCTGGATCTACAGAGACTGG - Intronic
1127921550 15:63498438-63498460 GCTGCTGAATCTTCAGTGCCTGG + Intergenic
1128212560 15:65912791-65912813 ACTGCAGGATAGACAGAGGCAGG - Intronic
1128361049 15:66962022-66962044 GCTCCTGGAGAGACAAAGCCGGG - Intergenic
1128385185 15:67142609-67142631 GCTTCTGGATAGACAGAGAATGG + Intronic
1128977658 15:72165306-72165328 ACTGCTGGACTGACAGTGCCTGG - Intronic
1129799857 15:78405745-78405767 GCTGCATGCTCCACAGAGCCAGG + Intergenic
1130841645 15:87706390-87706412 GTTTCTGGCTCTACAGAGCCTGG - Intergenic
1130972500 15:88744556-88744578 GCTATTGGATGGACAGAGCAAGG + Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133660242 16:7909503-7909525 ACTGTTGGATCCACACAGCCTGG - Intergenic
1134227134 16:12399857-12399879 GCTCCTGGAACGGCAGAGTCCGG + Intronic
1135673570 16:24395181-24395203 GCTGGTGGCTAGACAGATCCAGG - Intergenic
1136115350 16:28091067-28091089 GCTGGTGGAGCGCCAGAGCCTGG - Intergenic
1136394504 16:29985819-29985841 GTTGCTGGCTCGGCACAGCCTGG + Exonic
1138478469 16:57285619-57285641 CCTGCTGTATCCACAGGGCCTGG - Intergenic
1139481016 16:67230737-67230759 GCAGCTGGAGCGCCGGAGCCGGG - Exonic
1139482777 16:67239836-67239858 CCTGCTGTATCTATAGAGCCTGG + Intronic
1140683611 16:77411265-77411287 GCTGATGAATTGACAGAGACCGG - Intronic
1140894251 16:79311142-79311164 GCTGCGGGAGGGAGAGAGCCTGG - Intergenic
1142597265 17:1035679-1035701 CCGGCTGGATAAACAGAGCCTGG + Intronic
1142903514 17:3027560-3027582 GCAGCTGGGTTCACAGAGCCAGG + Intronic
1143535818 17:7538753-7538775 GATGCTGGATGGACAGAACCTGG + Intergenic
1143835483 17:9688915-9688937 GCAGATGGATCAACTGAGCCCGG - Intronic
1144154793 17:12488902-12488924 GCTGCTGGAACTGCAGAGCAGGG - Intergenic
1144725499 17:17499911-17499933 GCTGATGGATGGGCTGAGCCGGG - Intergenic
1146776717 17:35625557-35625579 ACTGCTGTATCCTCAGAGCCTGG - Intronic
1147619342 17:41854614-41854636 GTTGCTGGATCAATGGAGCCAGG - Exonic
1147981856 17:44279825-44279847 GCTGCTGCCCCGCCAGAGCCTGG - Intergenic
1149990231 17:61379093-61379115 GCTGTTGGACCCCCAGAGCCAGG + Intronic
1150538078 17:66065520-66065542 GATGCTGGATGTAAAGAGCCAGG - Intronic
1151830771 17:76548759-76548781 GTTTCTGGATCCACAGTGCCTGG - Intronic
1152659204 17:81534665-81534687 GCTGCTGGATGGGCACAGGCAGG - Intronic
1152777870 17:82213517-82213539 GCGGATGGATGAACAGAGCCCGG + Intergenic
1160143959 18:76348997-76349019 GCTGCTGAATCTCCAGTGCCTGG + Intergenic
1160404324 18:78634739-78634761 GCTGCTGAATCTCGAGAGCCCGG - Intergenic
1160462401 18:79048903-79048925 GGAGCTGGACAGACAGAGCCAGG - Intergenic
1162306543 19:9877944-9877966 GCAGGGGGATCGACTGAGCCTGG - Intronic
1163772046 19:19197181-19197203 GCTGGTGGATGGACAGGGCTGGG - Exonic
1164821751 19:31256169-31256191 GCTGCAGGATGGAGAGAGACAGG + Intergenic
1165022246 19:32934550-32934572 GCTGGTGGCTCCAGAGAGCCTGG + Intronic
1166198374 19:41220757-41220779 GCTTCGGGATGGACAGATCCTGG + Exonic
1166898563 19:46040289-46040311 GCAGCTGGAGCCGCAGAGCCGGG + Exonic
1167458067 19:49608903-49608925 GCTGCTGAATTGACAGGGCCAGG + Intronic
1167572979 19:50301729-50301751 GCAGCTGGAACGGCAGATCCAGG + Exonic
1168113912 19:54210155-54210177 CCTGCTGGACTCACAGAGCCTGG + Intronic
1168580999 19:57555752-57555774 CCTCCTGGATCAACAGAGCATGG + Intronic
926990765 2:18677297-18677319 GCTGCTGGAGGGGCAAAGCCAGG + Intergenic
928117215 2:28554561-28554583 GCTGGAGGATCGCCTGAGCCTGG - Intronic
928122472 2:28592832-28592854 GCTCTTGGATTGACAGAGCCAGG - Intronic
931203547 2:60124734-60124756 GCACCTGGATAGACAGAGGCAGG + Intergenic
931457927 2:62426667-62426689 ACTGCTGGAGGCACAGAGCCTGG + Intergenic
931649034 2:64452431-64452453 CCTGCTGGATCCCCAGTGCCTGG + Intergenic
933782459 2:85811820-85811842 GATGCTGGATCCTCAGAGCCTGG + Intergenic
937986103 2:127638821-127638843 CCTGCTGGAGCCACAGGGCCAGG - Exonic
942279325 2:174344181-174344203 GCTCCTGGGTTGACAGAGCAGGG - Intergenic
945314888 2:208360590-208360612 GTGGCTGGATGGACAAAGCCAGG - Intronic
947724247 2:232387559-232387581 GCTGCGGGAAGGACAGAGGCAGG + Intergenic
948796723 2:240407020-240407042 GCTGCTGGAGGGACTGAGGCAGG + Intergenic
1170487227 20:16830640-16830662 GCTGCATGATCCAGAGAGCCAGG + Intergenic
1170787939 20:19483651-19483673 GCTACTGGATCTACATGGCCAGG + Intronic
1170839993 20:19916885-19916907 GCTGCTTGATATACAGATCCTGG + Intronic
1172487431 20:35306807-35306829 CCTGAGGGATCCACAGAGCCAGG + Intronic
1172760316 20:37316855-37316877 GCTGCTGTGTAGACAGAGCCAGG + Exonic
1173567545 20:44052436-44052458 GACACTGGATCGACAGAGGCAGG - Intronic
1174190744 20:48738698-48738720 GCTGCTGGCTGGAAACAGCCAGG + Intronic
1174295749 20:49543854-49543876 CCTGCTGTATCCCCAGAGCCTGG + Intronic
1175520040 20:59596781-59596803 ACTGCTGGATTGCCAGTGCCTGG + Intronic
1175726521 20:61322326-61322348 GCTGCGGGAGAGACTGAGCCTGG - Intronic
1176269487 20:64228429-64228451 GCTGGTAGATTGAGAGAGCCAGG + Intronic
1176284501 21:5012367-5012389 GCTGCTGGAGGGACAGGGGCAGG + Intergenic
1179872680 21:44251108-44251130 GCTGCTGGAGGGACAGGGGCAGG - Intronic
1181370110 22:22409125-22409147 GCTGCAGGATCCACAGAGGAAGG + Intergenic
1183489112 22:38107402-38107424 GCTGCTGGATCGACAGAGCCAGG + Intronic
1185385325 22:50529249-50529271 GCTGCTGTCCCGACTGAGCCAGG + Exonic
950264479 3:11563989-11564011 GCAGCTGAATGCACAGAGCCCGG + Intronic
950497699 3:13343848-13343870 ACTGATGGAACCACAGAGCCTGG + Intronic
950705269 3:14775571-14775593 GCTGCTCCATAGACAGAGCAGGG + Intergenic
957157808 3:76568041-76568063 GCTGGTGGATCGCTTGAGCCCGG - Intronic
960825032 3:121773442-121773464 GCTTCTGGATCCACAGAACAAGG + Intronic
961501968 3:127342670-127342692 GCTGCAGGCTCCACAGAACCTGG - Intergenic
963168419 3:142227566-142227588 GCAGTTGGATCGCCTGAGCCCGG - Intergenic
964021007 3:152010880-152010902 GCTGATGTATTGACAGTGCCAGG - Intergenic
967987951 3:195109314-195109336 GCTGCTGGCTTGGGAGAGCCAGG - Intronic
968871656 4:3245707-3245729 GCTGCTGGGGCTGCAGAGCCTGG - Intronic
968975831 4:3821653-3821675 GCTGATGGAGCGACACAGACTGG + Intergenic
969791184 4:9494843-9494865 GCTGCTGGTAGGACAGAGGCTGG + Intergenic
972615997 4:40698677-40698699 GCTGCTCCATGGACAGAGCAGGG - Intergenic
973889486 4:55354883-55354905 GCTGTTGTATCCCCAGAGCCTGG + Intronic
976946759 4:90779990-90780012 GCTGCTGAATTAACCGAGCCTGG + Intronic
977212142 4:94231185-94231207 GCTGCTGTGTCCACAGTGCCCGG + Intronic
977584428 4:98759531-98759553 GCCCCTGGATGGAAAGAGCCTGG + Intergenic
977929430 4:102735054-102735076 GCTGCTGTGTAGACAGAGCCAGG + Intronic
980070646 4:128240255-128240277 GCAGGAGGATCGCCAGAGCCTGG + Intergenic
981111607 4:140940857-140940879 GCTGCTCCATAGACAGAGCAGGG - Intronic
981751404 4:148095667-148095689 GCTGATGGAGTGACAGAGGCAGG + Intronic
982289027 4:153761121-153761143 GCTGGAGGATCGCCGGAGCCCGG + Intergenic
985785016 5:1888827-1888849 GGTGCTGGATCGAGAGCTCCAGG + Intergenic
985807297 5:2055981-2056003 GCGGGTGGATCAACAGAGGCTGG + Intergenic
988555958 5:32236317-32236339 GCAGATGGATCGCCTGAGCCCGG + Intronic
989578359 5:43009640-43009662 GCTGCTGGAAAGACTGAGGCGGG + Intergenic
989641928 5:43590941-43590963 GCTGCTCCATAGACAGAGCAGGG - Intergenic
991951816 5:71953874-71953896 GCAGCTGGAGCCACAGAACCTGG - Intergenic
996504445 5:124253698-124253720 GCTGCTTGAAAGACAGAGCTGGG + Intergenic
997845214 5:137279804-137279826 GCTGCTGGATTGGAAGGGCCAGG - Intronic
999407440 5:151319427-151319449 GCTGCTGGATCCCCTGAGACTGG - Intronic
1001431370 5:171665197-171665219 GTTGCTGGAACTACTGAGCCTGG + Intergenic
1001457657 5:171877421-171877443 GCTGCTTTATGGACAAAGCCAGG + Intronic
1002052382 5:176578422-176578444 GCTGCTGGACCGGGAGAGCCAGG + Exonic
1003142677 6:3484754-3484776 GCTGCTGGAGGTACAGTGCCAGG + Intergenic
1005419527 6:25634513-25634535 TCTTCTGGGTGGACAGAGCCTGG - Intergenic
1006343709 6:33462734-33462756 GCTGCTCCATAGACAGAGCAGGG - Intergenic
1006912025 6:37569788-37569810 GCTGATGGAGGGGCAGAGCCAGG + Intergenic
1007315000 6:40979948-40979970 GCTGCTGACTAGACACAGCCAGG - Intergenic
1007947235 6:45837468-45837490 GGTGCAGGCTCTACAGAGCCAGG + Intergenic
1008308848 6:49940026-49940048 GCTGCTCCATAGACAGAGCAGGG + Intergenic
1008368121 6:50706227-50706249 GCCACTGGAGCTACAGAGCCAGG - Intergenic
1011018201 6:82782063-82782085 GCTGCTGGGTGGACTGAGCTTGG + Intergenic
1012721402 6:102750749-102750771 GCTGCTCCATAGACAGAGCAGGG - Intergenic
1015460781 6:133488296-133488318 CCTGGTGGGTCTACAGAGCCTGG - Intronic
1018258755 6:161949069-161949091 GCTGCTGGATGAACAGAGCCTGG + Intronic
1019256208 7:53773-53795 GCTGGTGGGAGGACAGAGCCAGG + Intergenic
1019772183 7:2890616-2890638 TCTCCTGCATCCACAGAGCCTGG - Intergenic
1026848980 7:73713161-73713183 GGTGCAGGGGCGACAGAGCCAGG - Intronic
1030221360 7:107102449-107102471 GCTGCTCCATAGACAGAGCAGGG - Intronic
1032947226 7:136868801-136868823 GCTGCGGGTTGGCCAGAGCCTGG + Exonic
1035663421 8:1363803-1363825 GCTGCGGGTGTGACAGAGCCCGG + Intergenic
1035746688 8:1966238-1966260 GCTGCAGGGACCACAGAGCCAGG + Intergenic
1035777193 8:2197036-2197058 GCTGCTGCAGCCACAGAGGCTGG + Intergenic
1036156907 8:6350654-6350676 TCTGCTGTATCCCCAGAGCCTGG - Intergenic
1036497434 8:9282157-9282179 GCTGATGGCTCGTCTGAGCCAGG - Intergenic
1037571497 8:20161849-20161871 GCTGCTGGGTAGACTCAGCCCGG - Intronic
1037645954 8:20792996-20793018 TCTCCAGGATCCACAGAGCCTGG + Intergenic
1039942848 8:42106042-42106064 TCTGCTTGGTGGACAGAGCCGGG - Intergenic
1040034858 8:42860162-42860184 GCAGTTGGATCTACAGAGTCTGG + Intronic
1041173205 8:55166456-55166478 GCTGCTGTATCCACAGTGCTAGG - Intronic
1041349618 8:56935413-56935435 GCTGGTGGATCCAAAGGGCCTGG + Intergenic
1041350637 8:56944835-56944857 GCTGCTCCATAGACAGAGCAGGG + Intergenic
1046452535 8:114412541-114412563 GTTGCGGGATCGCCTGAGCCTGG + Intergenic
1048000557 8:130376260-130376282 CCTGCTGGGTCCACACAGCCAGG + Intronic
1049060499 8:140272749-140272771 GCTGGTTGTTCGAAAGAGCCTGG - Intronic
1049277065 8:141725234-141725256 GCTGCTGGATGGAGTGAGCAAGG - Intergenic
1049574206 8:143382956-143382978 GCAGCAGGGTGGACAGAGCCCGG - Exonic
1051079976 9:13282474-13282496 GCTGCTGAAAAGACAGATCCTGG + Intergenic
1053158575 9:35797305-35797327 GCTTCTGGATCCTCAGAGCCTGG - Intronic
1053610084 9:39704295-39704317 GCTACTCCATAGACAGAGCCAGG - Intergenic
1053868150 9:42462519-42462541 GCTACTCCATAGACAGAGCCGGG - Intergenic
1054088169 9:60766852-60766874 GCTACTCCATAGACAGAGCCAGG + Intergenic
1054243440 9:62638100-62638122 GCTACTCCATAGACAGAGCCAGG + Intergenic
1054557564 9:66672621-66672643 GCTACTCCATAGACAGAGCCAGG + Intergenic
1055434084 9:76274937-76274959 GCTGCTTGTTCAAAAGAGCCTGG - Intronic
1059254080 9:112912990-112913012 GCTGCTATATCCCCAGAGCCTGG - Intergenic
1060042177 9:120309110-120309132 GCTGCTGGGTAGAAAGAGACTGG + Intergenic
1060751856 9:126174734-126174756 GCTGCTGGAGCCACTCAGCCTGG + Intergenic
1060975282 9:127761627-127761649 GCTGCTGGAGAGCCAGAGGCTGG - Exonic
1061707287 9:132462916-132462938 GGTGCTGGAGAGACAGACCCAGG - Intronic
1062721775 9:138048247-138048269 GCAGCAGGAGTGACAGAGCCAGG + Intronic
1186760968 X:12721210-12721232 GCTTCTGAATCGCCACAGCCAGG - Exonic
1187496207 X:19798176-19798198 GCTGGAGGATTGACTGAGCCTGG - Intronic
1192412764 X:70949025-70949047 GCTGAAGGATCGATTGAGCCTGG + Intergenic
1192822024 X:74656209-74656231 GCTGCTGGTTCTAGAGAGCCAGG - Intergenic
1195003708 X:100666880-100666902 GCGGCTGGACTGACAGACCCGGG - Exonic
1197017845 X:121648727-121648749 GCTGCTCCATAGACAGAGCAGGG - Intergenic
1199782535 X:151075785-151075807 GCTGTTGTATCCCCAGAGCCTGG + Intergenic