ID: 1183489484

View in Genome Browser
Species Human (GRCh38)
Location 22:38108977-38108999
Sequence CTCTGGCTGCAGAGGTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 390}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183489484 Original CRISPR CTCTGGCTGCAGAGGTGTGA GGG Intronic
900157973 1:1211172-1211194 CTCTGGCTGGAGAGGGGTCTTGG - Intergenic
900193204 1:1360099-1360121 CTCTGGGTGCAGGGCTGAGAGGG + Intronic
900405111 1:2489580-2489602 CTGTGGCTGCAGCAGCGTGAAGG - Intronic
901688790 1:10959435-10959457 CACTGGCTGCAGAGGGGTTTTGG - Intronic
901798619 1:11694351-11694373 CTCTGGCTGGGGAGGTTGGAGGG + Intronic
902202144 1:14841616-14841638 CACTGGGTGCAGAGCTGGGAAGG - Intronic
902801644 1:18833881-18833903 GTGTGGCTGCAGAGGGGTGTAGG + Intergenic
903649157 1:24912516-24912538 CCTAGCCTGCAGAGGTGTGATGG - Intronic
904461318 1:30682037-30682059 CTGTGGCGGCAGAGGCGGGATGG + Intergenic
904866747 1:33585352-33585374 CTCTGAAGGCAGAGGTGAGATGG - Intronic
905527299 1:38648659-38648681 ATCTGGCTTCAGAGGGCTGAGGG + Intergenic
906141746 1:43537837-43537859 GTAGGGCTGCAGAGGTGGGAGGG + Intronic
906302516 1:44693513-44693535 TTGAGGCTGCAGAGCTGTGATGG - Intronic
906448653 1:45924564-45924586 CTCTGGCTGCAGTGGGGTACAGG - Intronic
906679992 1:47720014-47720036 CTCAGGCTGCAGAGGTGGGTGGG - Intergenic
907514664 1:54986085-54986107 CTCTGTGTCCAGATGTGTGACGG + Exonic
909982590 1:82120759-82120781 TTCTGAGTGCAGTGGTGTGAAGG - Intergenic
910507616 1:87968047-87968069 CTCTGGAAGCAGATGTCTGAAGG + Intergenic
910873565 1:91856617-91856639 GTCTGGCAGCAGAGGGGTGAAGG - Intronic
916168995 1:161986653-161986675 CCCTGGCAGCAGAGATTTGATGG + Intronic
916627051 1:166569655-166569677 CTCTGCCTGCAGAGCTTTGTAGG - Intergenic
917534320 1:175863454-175863476 CTCTGTCTGCAGAGGTATCAAGG - Intergenic
917635195 1:176929140-176929162 CAGTGGCTGGAGAGGTGAGAGGG + Intronic
917958605 1:180125219-180125241 ATGGGGCTGGAGAGGTGTGATGG + Intergenic
918135062 1:181664731-181664753 CCTTGGCTGCAGAGGTATGGCGG + Intronic
919842243 1:201618147-201618169 CTCTGGCAGCAGGGGTGGGGTGG - Intergenic
919854211 1:201694542-201694564 CCCTGGCTGCAGAGGGAGGAGGG + Intronic
920161446 1:204001406-204001428 CTGTGGGTGCAGAGCTGTGGAGG + Intergenic
920347732 1:205317489-205317511 CTCTGGCTGGTGTGGTGGGATGG - Intronic
920932536 1:210402067-210402089 CTGTGGCTGCAGGGGAGTAAAGG + Intronic
921174300 1:212580420-212580442 CTCAGGAGGCTGAGGTGTGAGGG - Intronic
921497333 1:215857739-215857761 CTCTGGCCACAGAGTTGTCATGG - Intronic
922704418 1:227781539-227781561 TTCTGGCTGCAAAGCTGCGAGGG - Intergenic
922711904 1:227840595-227840617 CAGTGGCTGCAGAGCTGAGATGG + Intronic
922994596 1:229945554-229945576 TTCTGCCTCCAGAGATGTGATGG + Intergenic
923551939 1:234971008-234971030 CTCTAGCTGAAGGGGGGTGAGGG - Intergenic
924441339 1:244087861-244087883 CTCTGGCTGCAGGAGTGCGTGGG + Intergenic
924458879 1:244240360-244240382 CTCAGGAGGCTGAGGTGTGAGGG + Intergenic
924535127 1:244929059-244929081 CTCAGGCAGCTGAGGTGGGAGGG - Intergenic
924895333 1:248332585-248332607 CTCGGGCCACAGAGGTGTGCTGG + Intergenic
1062862691 10:822726-822748 CTCTGAATGCAGTGGTGTGAAGG + Intronic
1068186495 10:53593042-53593064 CTCTTGCTGAAGAGGTGTTGTGG + Intergenic
1068213360 10:53951894-53951916 CGCTGGCTGCTGTGGTGGGAAGG + Intronic
1069855686 10:71439738-71439760 CTGGAGCTGCAGAGGTGGGAGGG + Intronic
1069915014 10:71782056-71782078 CTCAGGCTGCAGTGTTGGGAAGG - Intronic
1069994765 10:72335529-72335551 CCCTGGCTCCAGGGGTGTGGGGG - Exonic
1070273071 10:74976665-74976687 CTGTGGCTGCAGAGGTGACATGG - Intronic
1070948857 10:80414821-80414843 GACTGGCTGCAGAGGTACGAAGG + Intronic
1071141526 10:82515012-82515034 CTCTAGCTGCCAGGGTGTGAGGG + Intronic
1071432450 10:85617168-85617190 CTCTAGCTTCAGAGGAATGAAGG - Intronic
1071513372 10:86281355-86281377 CAGTGGCTGCAGAGGGGTTATGG + Intronic
1072440190 10:95447358-95447380 CTCTGGAGGCTGAGGTGGGAGGG + Intronic
1072731317 10:97849271-97849293 CTCGGGTTGCAGAGGAGAGAGGG + Intergenic
1072918375 10:99554770-99554792 CTCTGGCTGCAGTGGAGAGCGGG + Intergenic
1073107587 10:101041095-101041117 CTCTGGCTTCAGTGGTGGGTGGG + Exonic
1074135903 10:110626162-110626184 CTCAGGCAGCAGTGGTGTCAAGG - Intergenic
1074995391 10:118753978-118754000 CTCTGGCTGCAGAAGACTGAAGG + Intronic
1075023588 10:118968116-118968138 CTCTGGCTGAAGGAGTGTGCTGG - Intergenic
1075077951 10:119363814-119363836 CCCTAGCTGCAGAGGTGGCAGGG + Intronic
1075236753 10:120737425-120737447 CACGGGCAGCAGAGGTGGGATGG - Intergenic
1076075890 10:127533605-127533627 CTCTGGCTGCTGAGATGAGGTGG + Intergenic
1077310939 11:1888904-1888926 CCTGGGCTGCAGTGGTGTGAGGG - Intronic
1078169568 11:8919240-8919262 CTGTCCTTGCAGAGGTGTGATGG - Intronic
1081115316 11:39192720-39192742 CTCAGGCTGCACAGGAGTGCTGG + Intergenic
1081225747 11:40519996-40520018 ATCTGGCTTCAAAGCTGTGAAGG + Intronic
1081542981 11:44049502-44049524 CTCTGGCTGGAGAGCTGCTAAGG - Intronic
1081709544 11:45208056-45208078 CTCTGGCTGCTCAGTTGAGAGGG + Intronic
1082060647 11:47857048-47857070 CTCTGGAGGCTGAGGTGGGAGGG + Intergenic
1083323594 11:61862398-61862420 CTCTGGCTGGACTGGTGTCAGGG - Intronic
1083616231 11:64028034-64028056 CACTGGCTGCAGAGAGGTGGCGG - Intronic
1084335493 11:68455355-68455377 CTGTCACTGCAGAGGTGAGAGGG - Intergenic
1084378917 11:68798316-68798338 CGCTGGCTGCACCGGTGTGCTGG - Intronic
1084675345 11:70630788-70630810 CTCTGCCTCCAGAACTGTGAGGG + Intronic
1084698185 11:70768767-70768789 TGGTGGCTGCAGGGGTGTGAGGG + Intronic
1084934493 11:72579607-72579629 CTCTGGGGGGAGAGGAGTGATGG + Exonic
1085579315 11:77636751-77636773 CTCTGGCTGTAGACAAGTGATGG + Intronic
1085738852 11:79062767-79062789 CCCTGCCTGCTGTGGTGTGATGG + Intronic
1086222691 11:84468548-84468570 TTCTGGCTGCAGGGGAGTAAGGG - Intronic
1086909233 11:92452879-92452901 CTCAGGAGGCAGAGGTGGGAGGG - Intronic
1089832107 11:121337924-121337946 CTCTGCCAGCAGAGAAGTGAAGG + Intergenic
1093506500 12:19872679-19872701 CTGTGGCTGCACATGAGTGATGG + Intergenic
1093607161 12:21106138-21106160 CTCTGAATGGAGAGATGTGAGGG - Intronic
1094557155 12:31512322-31512344 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
1095264484 12:40138054-40138076 CTATGGCTGGAGAGGTGAGGTGG + Intergenic
1096085986 12:48865413-48865435 CTCTGGGTGAAGAGGTGAGGAGG + Intronic
1097065224 12:56315812-56315834 CCCTGGGAGCAGAGGTGGGACGG - Exonic
1097343898 12:58469951-58469973 ATGTGACTGCAGAGATGTGAAGG - Intergenic
1098541154 12:71659231-71659253 CTCTGGCAGCAGCAGTATGAAGG - Intronic
1101373318 12:104150053-104150075 CCCTGGCTTCAGAGGTGGAAGGG - Intergenic
1101802814 12:108036993-108037015 CTGTGGATGGAGAGGTGTGTGGG + Intergenic
1102256642 12:111418943-111418965 CGCGGGCTGGGGAGGTGTGATGG + Intronic
1102814170 12:115849495-115849517 CTCTGGCTGCTGAACTGTGCTGG - Intergenic
1103211379 12:119169387-119169409 CTCTGACTGCAGAGGTTTCTGGG + Intergenic
1103539689 12:121657525-121657547 TTCTGGCTGCAGAGTTTTTAAGG - Intronic
1103564699 12:121809831-121809853 TCCTGGCTGAAGAGGTATGAGGG - Exonic
1103675280 12:122651105-122651127 CTCTGGAGGCTGAGGTGGGAGGG - Intergenic
1104081483 12:125434185-125434207 CCGTGGCTGCAGAGGTCAGAGGG - Intronic
1104712029 12:130993998-130994020 CTCTGGCCACTGAGATGTGAGGG - Intronic
1105705661 13:22966165-22966187 CTCTGGCTGCAGATCTTAGAAGG - Intergenic
1105858564 13:24391150-24391172 CTCTGGCTGCAGATCTTAGAAGG - Intergenic
1106061872 13:26301094-26301116 CTCTAGCTGCAGAAGTGAAAAGG - Intronic
1108350822 13:49589372-49589394 CTCGGGCGGCTGAGGTGGGAAGG - Intergenic
1109283140 13:60380114-60380136 CACTGGATACAGAGGTGAGAAGG - Intergenic
1110836812 13:80093127-80093149 CCCTTGCTGGAGAGGTGTCACGG + Intergenic
1111883196 13:93985113-93985135 TTCTGGCTGGAAAGATGTGATGG - Intronic
1112506501 13:99979526-99979548 CAGAGGCTGCGGAGGTGTGAAGG - Intergenic
1113575267 13:111390743-111390765 CTCTGCCTGAGGAGGTGTGAGGG + Intergenic
1114456829 14:22860614-22860636 CTTTTGCTGCAGAAGTGTGGGGG - Intergenic
1114471657 14:22967398-22967420 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
1114711754 14:24785766-24785788 TTCCAGCTGCAGAGGTGGGAGGG + Intergenic
1115304455 14:31919413-31919435 CTCTGGCTGAAGGGGGATGAGGG - Intergenic
1118010348 14:61604489-61604511 CTGTGGCAGCAGAGGAGAGATGG + Intronic
1118076026 14:62300158-62300180 CTCTGGAGGCTGAGGTGGGAGGG - Intergenic
1118239876 14:64045894-64045916 AACTGGGTGCAGGGGTGTGAAGG - Intronic
1119005588 14:70924693-70924715 CTCAGGATGCTGAGGTGGGAGGG - Intronic
1121136806 14:91506656-91506678 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
1122930082 14:104929085-104929107 CTCTAACAGCAGAGGTGTCAAGG + Intronic
1126838469 15:52692462-52692484 CTCAGGAGGCTGAGGTGTGAGGG - Intronic
1127519737 15:59731728-59731750 CTCTGGCTGAAGCAGGGTGAAGG + Intergenic
1128075651 15:64823868-64823890 CTCGGGCTGCACAGGGCTGATGG + Exonic
1129082243 15:73051958-73051980 CTCTGGCTGCAGAGACCTGAGGG - Exonic
1130336103 15:82958567-82958589 CTCTGGCAGCAGATGGGAGAAGG + Intronic
1130589800 15:85204551-85204573 CACTGGCTGCAGGGGGGTGGGGG + Intergenic
1130654948 15:85786120-85786142 CACTAGCTGCAGAGGTATAAAGG + Intronic
1130694973 15:86122111-86122133 TTCTGGCTGCTGAGAGGTGAAGG - Intergenic
1131109887 15:89758534-89758556 CACAGGCCCCAGAGGTGTGAAGG - Intergenic
1131563263 15:93462644-93462666 CTGTGAGTGCAGAGGTGTGTTGG - Intergenic
1132405494 15:101539807-101539829 CTGTGTCTGCAGAGGTGGAAGGG + Intergenic
1132435271 15:101795626-101795648 CACTGGAGGCAGATGTGTGAAGG + Intergenic
1132839203 16:1970485-1970507 CTCTGGAGGCTGAGGTGAGAGGG - Intergenic
1133184817 16:4088397-4088419 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
1133914009 16:10092418-10092440 CTTTGCCTCCAGAGGTCTGAGGG + Intronic
1134122015 16:11591290-11591312 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
1134225943 16:12390236-12390258 CTCTGGCTGCAGAGCAGAGATGG - Intronic
1134453513 16:14377875-14377897 CTCTGGAGGCTGAGGTGTGGTGG + Intergenic
1135109059 16:19676363-19676385 CTCTGTCTGCAGGGGAGAGAGGG - Intronic
1135136749 16:19890490-19890512 CTCTGGAGGCTGAGGTGGGAGGG + Intergenic
1135763792 16:25159372-25159394 CTCCGGAGGCTGAGGTGTGATGG - Intronic
1136395930 16:29992531-29992553 CTCTGGCTGCTGAGGCTTGCGGG - Exonic
1136598242 16:31266236-31266258 CTCTGGGTGCAGAAGAGTGGGGG + Intronic
1137551881 16:49443036-49443058 CTCTGGCTCCTGGGGTGGGAGGG + Intergenic
1137624255 16:49897667-49897689 CTCTGGCTGGAGAAATCTGAGGG - Intergenic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1138534075 16:57650567-57650589 CTCTGGCTGCAGAGGTGAGTGGG - Intronic
1139255627 16:65539378-65539400 CTCTGGCTGCAGAGTGGAGAGGG - Intergenic
1139292554 16:65871803-65871825 CTCTGGCTGCAGCGGCACGATGG + Intergenic
1139403941 16:66703559-66703581 CTCTGGCTTCAGTGCAGTGATGG + Intergenic
1140271869 16:73473227-73473249 CTCAGGATGCTGAGGTGGGAGGG + Intergenic
1141140189 16:81492496-81492518 CTCTGGCTGCAGAGCAGGGAGGG + Intronic
1141526166 16:84613463-84613485 GTTGGGCTGCAGATGTGTGAGGG + Intronic
1141949362 16:87330781-87330803 CTCAGGCAGCGCAGGTGTGATGG - Exonic
1142292253 16:89198551-89198573 CTGTAGCCGCAGAGATGTGAGGG + Intronic
1142898483 17:2997355-2997377 CTCTGTCTCCAGAGCTGTCAGGG + Intronic
1143142329 17:4748106-4748128 ATCTGGCTGCAGAGTTGACAGGG - Intergenic
1143185441 17:5007329-5007351 CTGAGGATGGAGAGGTGTGAGGG + Exonic
1143252996 17:5536725-5536747 CTCTGGCTGCTGTGGTGTCTGGG + Intronic
1144462387 17:15468517-15468539 CTGTGGTTGCAGAGAAGTGAGGG - Intronic
1145975574 17:28981939-28981961 TTCTGGCTGCTCAGGTGTGGGGG + Exonic
1145984443 17:29035780-29035802 GTCTGGCTGCAGAGCTAGGAGGG + Intronic
1146049596 17:29539152-29539174 CTCTGGAGGCTGAGGTGTGGAGG + Intronic
1146319816 17:31838222-31838244 TTCTGGCTTCAGCTGTGTGATGG - Intergenic
1146549507 17:33768473-33768495 CTCAAGCTGAGGAGGTGTGATGG + Intronic
1146936230 17:36814179-36814201 ATCTGGCTGCAGAGGGCTGGGGG - Intergenic
1146944731 17:36865887-36865909 CTCAGGATGCCGAGGTGGGAGGG + Intergenic
1147223880 17:38959751-38959773 CTCAGGATGCTGAGGTGGGAGGG - Intronic
1147727962 17:42578398-42578420 CTCTGGAGGCTGAGGTGGGAGGG + Intergenic
1147776703 17:42907010-42907032 TTCTGGCAGAAGAGCTGTGAAGG + Intronic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1149091928 17:52794099-52794121 CTCTGGAGGCTGAGGTGTGAGGG - Intergenic
1151238285 17:72737753-72737775 TTCTGGCCGAAGAGGTATGAGGG - Intronic
1152508003 17:80765148-80765170 CTATGGATGCAGAGATGCGACGG - Intronic
1152756682 17:82089962-82089984 CCTTGGCTGCAGAGGACTGAGGG - Intronic
1152889623 17:82873110-82873132 CCCTGAATGCAGACGTGTGACGG + Intronic
1153205222 18:2692103-2692125 CTTGGGCTGCAGAGGTTGGAAGG - Intronic
1153255434 18:3165791-3165813 CCATGGCTGCAGAGGAGAGAAGG - Intronic
1153454301 18:5262793-5262815 CTCTTGCTGAAGAGGTGATATGG - Intergenic
1154164583 18:12005093-12005115 GTGTGGCTGCAGCGGTGTGAAGG - Intronic
1157877031 18:51283328-51283350 ATTTGACTGCAAAGGTGTGATGG - Intergenic
1161734765 19:5984837-5984859 CTTTGGCTGCAGAGGAGAGAGGG - Intergenic
1162025961 19:7894329-7894351 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
1162825331 19:13247853-13247875 CTGTGGCTGCACAAGTGTTAGGG + Intronic
1163341951 19:16714236-16714258 CTCTGGAGGCTGAGGTGGGAAGG + Intergenic
1163781225 19:19249749-19249771 GTCTGGCTGCAGGGAAGTGAGGG - Exonic
1164570710 19:29372396-29372418 CTGTAGCTGCTGAAGTGTGAGGG + Intergenic
1164707076 19:30327784-30327806 CTCAGGCCGCAGAGGTGAGAGGG - Intronic
1164950934 19:32336390-32336412 CTCTGGAGGCTGAGGTGGGAGGG + Intergenic
1166070057 19:40381690-40381712 CTCTTGCTGCACAGATGGGAGGG + Intronic
1166784805 19:45361299-45361321 CTCGGGCTGCAGAGTGGAGAAGG - Intronic
1166936369 19:46335626-46335648 CTCTGGAGGCTGAGGTGGGAGGG + Intronic
1167516290 19:49924892-49924914 TGCTGGCTGCAGAGGTGTCTGGG - Intronic
1167724366 19:51200517-51200539 CTCTGGCTTCTCAGGTGGGAGGG - Intergenic
1168669354 19:58229215-58229237 CTCCTGCTGCAGAGCTGGGAGGG + Intronic
1168669547 19:58230180-58230202 CTCTGGCTGCAGGGCTGGGGAGG - Intronic
925826858 2:7857883-7857905 AAATGGCTGCAGATGTGTGAAGG + Intergenic
925832393 2:7909400-7909422 CTCTGGCTGCAGTTGTGTTATGG - Intergenic
927855318 2:26524016-26524038 TGCTGGCTGCAGAGCTGAGATGG - Intronic
928074848 2:28254839-28254861 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
928373816 2:30759326-30759348 CTCTGGCTTAAGCGGTGTGAGGG - Intronic
928967595 2:36992830-36992852 CTCGGGCGGCTGAGGTGGGAGGG - Intronic
930612634 2:53560485-53560507 CTCTGGAGGCTGAGGTGGGAAGG - Intronic
932575021 2:72958082-72958104 CTCTGGCTGCAAAGCAATGATGG - Intronic
932828757 2:74967868-74967890 CTCAGGCTGCAGGCCTGTGAAGG + Intronic
933760352 2:85668180-85668202 CCCAGGCTGCAGAGGTGCCATGG - Exonic
934591309 2:95552468-95552490 CTCTGGAAGCTGAGGTGAGAGGG - Intergenic
937366293 2:121264381-121264403 CTCTGGCTGCAGAGTGGAAATGG + Intronic
937826241 2:126371425-126371447 AGCTGGCTGCACAGGTGTGTGGG - Intergenic
938841829 2:135171975-135171997 CTGTGGCTGAAGGGGAGTGAGGG + Intronic
939233059 2:139455173-139455195 CTCTAGCTGCTTAGGTGTCAAGG + Intergenic
940058804 2:149542001-149542023 GTGTTGCTGCAGAGGTGAGAAGG - Intergenic
940961403 2:159790496-159790518 CTCTGGCAGCAGAGAGGGGAAGG - Intronic
943396315 2:187339076-187339098 CCCTGGCTGCACAGTAGTGATGG - Intergenic
943697315 2:190950358-190950380 CTATGGCAGCAGAGGTGATAAGG + Intronic
944027417 2:195187969-195187991 CTCTTGCTGATGAGGTGGGAAGG - Intergenic
944323358 2:198375406-198375428 GTCAGGCTCCAGAGGAGTGAGGG - Intronic
944681853 2:202084394-202084416 CTCTGAATGCAGAGGCATGAAGG - Intronic
945932299 2:215867084-215867106 CTGTGGCAGAAGAGGTGAGAGGG - Intergenic
946164360 2:217854862-217854884 GTCTGGCTGCCGAGGTGGGGTGG - Intronic
946261225 2:218492895-218492917 CTCTAGATGCTGAGGTGGGAAGG + Intronic
947620135 2:231584782-231584804 CTCTGGAGGCTGAGGTGGGAGGG - Intergenic
1169550753 20:6698891-6698913 CTCTGTCTGGAGAGTTGTGCTGG + Intergenic
1169673667 20:8132008-8132030 CCCTGGTTGCAGAGGTGCTAGGG - Intergenic
1169748183 20:8964221-8964243 CTCTGGCTACAGAGGAGGGGAGG - Intronic
1171879337 20:30605415-30605437 CTCTGGAGGCTGAGGTGGGAGGG + Intergenic
1171944921 20:31368055-31368077 CACTTGCTGCAGAAGTTTGAGGG - Intergenic
1171996006 20:31731928-31731950 CTCTGGATGCTGAGATGAGAGGG - Intergenic
1172298835 20:33833505-33833527 CTCTGGCTGCTGTGGGGAGAAGG - Intronic
1172384367 20:34523288-34523310 CTCTGGCTGCTGTGGGGAGAAGG - Intronic
1172938241 20:38636368-38636390 CTCAGGCGGCTGAGGTGAGAGGG - Intronic
1172971007 20:38873039-38873061 CCCTGGCAGGAGAGGTGGGACGG - Intronic
1172977643 20:38918732-38918754 CCCTGGCTGGGGAGGTGTCAGGG + Exonic
1173922568 20:46757352-46757374 CTCAGGCTGCAGAGTTGGGACGG - Intergenic
1173997802 20:47352782-47352804 CACTGGCTGCAGAGCTGGCATGG + Intronic
1174107482 20:48172800-48172822 CTCTAGCTGGGGAGGGGTGATGG + Intergenic
1174698707 20:52586159-52586181 CTCTGGAGGCTGAGGTGAGAGGG - Intergenic
1175121344 20:56718369-56718391 CGAGGGCTGCAGAGGAGTGAAGG - Intergenic
1175967081 20:62665198-62665220 CTCTGGCAGCGGGGGTGGGAGGG - Intronic
1176229237 20:64023202-64023224 CACTGGCTGCAGCGGTGGGTGGG + Intronic
1177442383 21:21143138-21143160 GTCTCACTGCAAAGGTGTGAAGG + Intronic
1178003684 21:28192840-28192862 CTGTGTCTGCAGCAGTGTGAGGG - Intergenic
1178582455 21:33848082-33848104 CGCTGGCTGCGGAGCTGGGAAGG - Intronic
1178641149 21:34345566-34345588 CTGGGGGTGCAGAGGTGTGAAGG + Intergenic
1179363545 21:40734677-40734699 CTCTGGCTGGAATGGTGGGATGG - Intronic
1181813398 22:25419587-25419609 CTCAGGCTGGAGTGGTGTTAAGG - Intergenic
1182471418 22:30550761-30550783 CTCTGGAGGCTGAGGTGGGAGGG - Intergenic
1183079105 22:35444967-35444989 CTCTGGCCGCAGAGGAGTCTGGG - Intergenic
1183261288 22:36797523-36797545 CTCTGGGTGGAGAGGGGAGAGGG + Intergenic
1183311917 22:37114630-37114652 ATCTGGCCTCAGAGCTGTGAAGG - Intergenic
1183489484 22:38108977-38108999 CTCTGGCTGCAGAGGTGTGAGGG + Intronic
1183513050 22:38247039-38247061 TGGTGGCTGCAGAGGTTTGAAGG - Intronic
1183711368 22:39505642-39505664 CTCTGTTTACAGAGCTGTGATGG - Intronic
1183718406 22:39547949-39547971 CTCAGCCTGCAGAGGTCTGGGGG - Intergenic
1183743183 22:39679451-39679473 CAGGGGCTGGAGAGGTGTGAGGG + Intronic
1184472796 22:44705148-44705170 TTCTGGCTCCAGAACTGTGAGGG - Intronic
1184533827 22:45072970-45072992 CTCTGGCTGCAAAGCCCTGAGGG + Intergenic
1184809922 22:46824442-46824464 CTGTGGCTGCAGTGAAGTGAAGG + Intronic
949293940 3:2498586-2498608 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
949394810 3:3603235-3603257 CTCAGGCGGCTGAGGTGGGAGGG + Intergenic
950025935 3:9819904-9819926 GTCAGGCTGCAGGGGTTTGAGGG + Intronic
950101472 3:10359476-10359498 CTCTGACTCCAGAGGAGTGCTGG - Intronic
951996469 3:28735804-28735826 CTCTTGCTGGAGAGGTGTTGCGG + Intergenic
953543189 3:43840821-43840843 CTCTGGTTGCAGGAGTGTGCTGG + Intergenic
953976666 3:47386672-47386694 CTCTGGCTGCTCAGCAGTGAGGG + Intronic
954421013 3:50419010-50419032 CTCAGCCTGCAGAGGAGTGGGGG + Intronic
954443464 3:50534224-50534246 CCCTGGCAGCAGAGGTGGGGAGG + Intergenic
954758494 3:52856574-52856596 CTCTGGAAGCTGAGGTGGGAGGG + Intronic
955233049 3:57115822-57115844 CCCTGGCTTCAGAGGGGTAATGG - Intronic
955509799 3:59668182-59668204 TTCTGGATGCTGAGGTGGGAGGG - Intergenic
955879384 3:63527525-63527547 CTCTGTCTGCAGAGGTGCTCAGG - Intronic
956029622 3:65023655-65023677 CTCTGGTTCCAGAGCTGTAAAGG + Intergenic
960056711 3:113281049-113281071 CTCTGGCTGCAGGTGGCTGATGG - Exonic
961486811 3:127222492-127222514 CTCTGGTTGCAGTGGGGTGAGGG + Intergenic
961577985 3:127854114-127854136 CTCTGGCAGTAGAGGTGACAAGG + Intergenic
961773569 3:129267925-129267947 TCCTGGCTGCAGGTGTGTGATGG + Exonic
962275804 3:134012443-134012465 CTCTGCTTGCAGAGTTCTGATGG - Intronic
964434112 3:156634345-156634367 CTCTGGCAGCTGAGGTGTTGGGG - Intergenic
964714031 3:159703041-159703063 CTCTGAGTGCTGAGGTGTAAAGG + Intronic
964929046 3:161993434-161993456 CTCAGGATGCTGAGGTATGAAGG - Intergenic
965491098 3:169337655-169337677 CTCGGGCTTCAGAGTTTTGAGGG - Intronic
966856841 3:184200044-184200066 CTCTGGCTGCTCAGATGTGAGGG + Intronic
967229489 3:187324075-187324097 CTCTGACTGCTGAGTTGAGATGG + Intergenic
967722297 3:192828402-192828424 CTCCTGCTGCACAGGTGTGCTGG - Intronic
967732150 3:192916889-192916911 CTCTGGCCGCAGAGGAGCGCCGG - Intronic
967790538 3:193544050-193544072 CTTTGGCAGCATAGGTCTGAAGG + Intronic
968590183 4:1454610-1454632 ATGTGGCTGCAGAGGTGCGGTGG + Intergenic
968679359 4:1905952-1905974 CCCGGGCTGCAGAGGCTTGAAGG - Intronic
968790127 4:2654318-2654340 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
968793843 4:2688677-2688699 CTCTGGCTGTAGTGGGGAGAAGG + Intronic
968973950 4:3811422-3811444 CTTTGGCTGGAGGGGTGTCATGG + Intergenic
969112007 4:4850062-4850084 CTCAGGAGGCTGAGGTGTGAGGG + Intergenic
969365547 4:6692257-6692279 CTCTGGCTGGGGTGGTATGATGG + Intergenic
969715993 4:8868340-8868362 CGCTGGCTGCAGGGGAGAGAGGG + Exonic
971163456 4:24157858-24157880 TTCTGGCTGCAGAGTAGAGAGGG - Intergenic
971356842 4:25902825-25902847 CTCTGGAAGCTGAGGTGGGAGGG - Intronic
972990066 4:44813938-44813960 CTCTTGCTGGAGAGGTGTTGAGG + Intergenic
974217289 4:58866652-58866674 CCCTGGCTGCAGAGATATCAAGG - Intergenic
975274985 4:72486493-72486515 CTCTTGCTTCAGAGGCCTGATGG - Intronic
976816693 4:89156470-89156492 CTCAAGCTGCAGAGTTGAGAGGG - Intergenic
977526763 4:98155652-98155674 CTCAGGATGCTGAGGTGGGAGGG + Intergenic
980972009 4:139575688-139575710 CTCTGACTTCAGCGGTATGAGGG - Intronic
981434961 4:144709526-144709548 CTCTGGTGGCAGAGGGCTGAAGG + Intronic
982249825 4:153393484-153393506 CTCGGGAAGCTGAGGTGTGAGGG - Intronic
983051284 4:163050533-163050555 TTCTGGCTGCAGTGGAGTGGTGG - Intergenic
983350632 4:166583152-166583174 CTGAGGCTGCAGAGGTGGGCAGG - Intergenic
984417079 4:179475351-179475373 CTCTGGCTGGAGTGGAGTGTTGG - Intergenic
984788276 4:183589904-183589926 CTCAGGCTGCAGAGAGATGAAGG + Intergenic
985545728 5:508077-508099 CCCTGGCTCCACTGGTGTGAGGG - Intronic
986731153 5:10635972-10635994 TTCTGTCTGCAGAGGTGGGCTGG + Intronic
987016184 5:13822356-13822378 CTCTGGATGCTGAGGTGGGAGGG - Intronic
987724999 5:21686453-21686475 CTGTGACTCCAGATGTGTGATGG - Intergenic
992238006 5:74732060-74732082 CTCAGGATGCTGAGGTGGGAAGG - Intronic
992843239 5:80717372-80717394 CTCAGGCGGCTGAGGTGGGAAGG - Intronic
996801537 5:127408967-127408989 CTCAGGCGGCAGAGGTGGGAGGG + Intronic
999426453 5:151491371-151491393 ATCTGGCTGCAGAGGAGAGATGG - Exonic
999728131 5:154453933-154453955 CTCTGGAGGCTGAGGTGGGAAGG - Intronic
1001231988 5:169996725-169996747 CTCTGCCTGGAGATGTGCGAGGG + Intronic
1002436578 5:179235405-179235427 ATCTGGCTCCATTGGTGTGAAGG - Intronic
1002454552 5:179338766-179338788 CTCTGGCTGCAGAGTGGAGAAGG + Intronic
1002534818 5:179870325-179870347 CCCTGCCAGCAGAGGTGTGTGGG + Exonic
1003218092 6:4133748-4133770 ATCAGGCTGCAGAAATGTGAGGG - Intronic
1003590529 6:7433012-7433034 CTGGAGCTGCAGGGGTGTGAAGG + Intergenic
1003666869 6:8119448-8119470 ACCTGGATGCAGAGATGTGAGGG + Intergenic
1003706896 6:8542711-8542733 TTCTGACCCCAGAGGTGTGAGGG + Intergenic
1004013630 6:11712307-11712329 CTCTGAACGCAGAGGTGTGCTGG + Intronic
1004411928 6:15389265-15389287 CTCAGGCGGCTGAGGTGGGAGGG - Intronic
1005040654 6:21596632-21596654 CTCCGGCTGCAGAGGGGGCAAGG - Exonic
1006115818 6:31775740-31775762 CTGTGGCTGGAGAGAAGTGAGGG - Intronic
1006646343 6:35517008-35517030 CTCAGGTTGCATGGGTGTGATGG + Intergenic
1007257045 6:40536722-40536744 CTCTGGCTCCTGAGCTTTGAGGG - Intronic
1007549245 6:42716315-42716337 CTCTGGAGGCTGAGGTGGGATGG + Intronic
1007715938 6:43856218-43856240 CTCTGTCTGCAGAGCAGGGATGG + Intergenic
1008096269 6:47342666-47342688 CTCTGTCTTCAGGGGTGTGAAGG + Intergenic
1010732030 6:79401160-79401182 CTCTGGATTCAGAGTTGTGTCGG - Intergenic
1011459722 6:87590283-87590305 CCCTGGCTGGAGAGGAGGGAGGG + Intronic
1013120166 6:107133972-107133994 CTCAGGTGGCTGAGGTGTGAGGG + Intergenic
1015544267 6:134346001-134346023 CTGTGGCTGGAGAGGAGTGTAGG + Intergenic
1016924491 6:149329382-149329404 CCCTGGGTGCATAGTTGTGATGG + Intronic
1017878810 6:158545461-158545483 CTCTGGGAGCAGAGCTCTGAAGG + Intronic
1017970132 6:159304805-159304827 GTCTGGCTGAGGAGGGGTGAGGG + Intergenic
1018250683 6:161866899-161866921 CTCTGGCTGAAGAGGATGGATGG + Intronic
1018423862 6:163662979-163663001 CTCTGGTTGCAGGGGTGACATGG + Intergenic
1019219953 6:170465168-170465190 CTCTGGCTGCAGAGCTGTGCTGG - Intergenic
1019564648 7:1673391-1673413 CTCAGGGTGCACAGGGGTGAAGG - Intergenic
1019727154 7:2609386-2609408 CTCTGGAGGCCGAGGTGGGAGGG - Intronic
1021554411 7:21904769-21904791 CTCTGGCCACAGACCTGTGATGG - Intronic
1021746414 7:23745437-23745459 CACTGGCAGCAGATGTGTGGAGG + Intronic
1021869136 7:24986356-24986378 CTCTGGCTTCAGAGTAGAGAAGG - Intergenic
1024505304 7:50157480-50157502 AAATGGCTGCAGAGGTGGGAAGG - Intronic
1024588678 7:50862528-50862550 CTCTGCCAGCAGGGGTGTGATGG + Intergenic
1024987881 7:55211801-55211823 CTCTGGTTCCTGAGGTGCGATGG - Intronic
1026457699 7:70587183-70587205 CTCAGGAGGCAGAGGTGGGAGGG - Intronic
1026851662 7:73727717-73727739 CTCTGGAGGCTGAGGTGAGAGGG - Intergenic
1029574173 7:101392154-101392176 ATTTCACTGCAGAGGTGTGACGG + Intronic
1029958151 7:104661122-104661144 CTCTGGGTCCAGAGATGTCATGG - Intronic
1031043790 7:116864794-116864816 CTCTGGATGCCAAGGTGTGGAGG + Intronic
1031920241 7:127595087-127595109 ATCTGGCTGCAGGGGTGGAAGGG + Intronic
1033008343 7:137591644-137591666 CTCTTGCTGTACAGATGTGAGGG - Intronic
1033176816 7:139132334-139132356 CTTTGTCTGCAGAGCTGTTATGG + Intergenic
1033207609 7:139436345-139436367 GTGTGACTGCAGAGGTGTGAAGG - Intergenic
1034346810 7:150390403-150390425 TTCTGGCTGGAGAGGGCTGAGGG + Intronic
1034423566 7:151001527-151001549 GTCTGGCTGCAGAGAGATGATGG - Exonic
1035282774 7:157787857-157787879 CTGGGGGTGCAGAGGTGTGAGGG - Intronic
1035663079 8:1361984-1362006 TCCTGGCTGCAGAGGTGGAATGG + Intergenic
1035697915 8:1614290-1614312 CTCTGGCTGCAGAGGCCCCACGG - Intronic
1036669835 8:10775915-10775937 CTTTGGCTGCAGCGGGGTGGGGG + Intronic
1037567112 8:20127185-20127207 CTCTGGGTCCAGAGGTGCAAAGG + Intergenic
1037581664 8:20249223-20249245 CTCTGGCCGCAGAGGTGTAGGGG - Exonic
1038455425 8:27669476-27669498 CTCTGGCTGCTGAGCTGCCAGGG + Intronic
1040393944 8:46976612-46976634 CTCTGGAGGCTGAGGTGGGAAGG - Intergenic
1040695087 8:49986771-49986793 CTCGGGAGGCAGAGGTGGGAGGG + Intronic
1042483919 8:69331311-69331333 CTCCTGCCGCAGAGGTGTCAGGG + Intergenic
1043458525 8:80436442-80436464 CTCTGGAAGCTGAGGTGGGAGGG + Intergenic
1043953746 8:86338763-86338785 CTCTGGAGGCTGAGGTGGGAGGG - Intergenic
1044108056 8:88236639-88236661 CTCTGGAAGCTGAGGTGGGAGGG + Intronic
1044333032 8:90943857-90943879 CTCTGGTGGCTGAGGTGGGAGGG - Intronic
1045472999 8:102529037-102529059 CTCTGGCTGCCGGGGTGGGGCGG - Intronic
1046083335 8:109399911-109399933 CTCTGGCTGCAGATACGTGTAGG + Intronic
1047184367 8:122618762-122618784 CTCTGACTGCAGCTGTGTGGAGG - Intergenic
1048865948 8:138761961-138761983 CTCTGGATGCACTGATGTGAGGG - Intronic
1048995562 8:139791876-139791898 CGCGCGCTGCAGAGGGGTGATGG - Intronic
1049211970 8:141391143-141391165 CTCTGGCTGCTGAGGGTGGATGG + Intergenic
1049343862 8:142128221-142128243 GGCTGGCTGCAGAGCTGTGCTGG - Intergenic
1049657518 8:143805289-143805311 CTCGGGCCGCAGCGGCGTGATGG + Exonic
1049931120 9:457801-457823 CTCTGGCTTCAGCTGTGTGCAGG + Intronic
1051338129 9:16085494-16085516 CACTGGCTGCAGAGGTTTCCAGG - Intergenic
1051707717 9:19898251-19898273 ACCTGGCTGCAGAGCTGTGGGGG - Intergenic
1051806315 9:20996565-20996587 CTCTGGATAGAGAGGTGTCAAGG + Intergenic
1053166490 9:35847373-35847395 CACTGTGTGCAGAGGTGTGGGGG - Intronic
1053312827 9:37030160-37030182 CTCTGGGTGCACAGGTAAGACGG - Intronic
1053435919 9:38074396-38074418 CACTGGCTGCTGGGGTGAGATGG - Intergenic
1053450890 9:38193071-38193093 CTCTGAATTCACAGGTGTGAGGG + Intergenic
1055194121 9:73566052-73566074 CTCTGGCTGCAGTGGTGTGCTGG + Intergenic
1055613152 9:78043847-78043869 CTCTGGAGGCTGAGGTGGGAGGG - Intergenic
1056182367 9:84097712-84097734 CTCTGGAGGCTGAGGTGGGAGGG + Intergenic
1056308559 9:85316882-85316904 CTCTGGAGGCTGAGGTGGGAGGG - Intergenic
1056511846 9:87313913-87313935 CTCAGGCGGCTGAGGTGGGAGGG + Intergenic
1057265067 9:93611616-93611638 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
1057991579 9:99776177-99776199 CTTTCGCTGCAGATTTGTGAAGG + Intergenic
1058478141 9:105361941-105361963 CTCGGGAGGCAGAGGTGGGAGGG + Intronic
1058489546 9:105481878-105481900 CTCAGGCGGCAGAGGTGGAAGGG - Intronic
1059751851 9:117255062-117255084 TTCTGGCTGAAGAGGTGTTGGGG + Intronic
1060721594 9:125983264-125983286 CTCAGACTGCAGTGATGTGAGGG - Intergenic
1060758598 9:126230063-126230085 CTCTGGCTGCAGAGTGGAGAAGG + Intergenic
1060776042 9:126375574-126375596 CTCTGGCTGCTGTGCTGTGTGGG + Intronic
1060782398 9:126422383-126422405 CTCATGCTCCAGGGGTGTGAGGG - Intronic
1061162234 9:128902083-128902105 GGCTGGCTGCAGAGCTGAGAAGG - Intronic
1061593414 9:131613463-131613485 CTCTGACTGCAGAGGCAGGAAGG + Intronic
1062188327 9:135230408-135230430 CCCTGCCTGGAGAAGTGTGAAGG + Intergenic
1062271992 9:135714060-135714082 CTCAGGCTGTTGAGGGGTGAGGG - Intronic
1062433960 9:136538262-136538284 CAGTGGCTGCAGGGGTGGGAGGG - Intronic
1062567101 9:137168247-137168269 CTCAGGCTGCAGAGGAGCGCAGG - Exonic
1062637707 9:137500296-137500318 CCCAGGCTGCAGAGGTGGGACGG + Intronic
1185529587 X:806860-806882 CTGTGTCTGCAGAGCTGTGGTGG - Intergenic
1188435144 X:30150444-30150466 CACTGGCTGCTGAGGTGGGGTGG - Intergenic
1189050543 X:37640833-37640855 CTATGGCTGAAGAGGAGAGAAGG - Intronic
1189847061 X:45147886-45147908 CTAGGCATGCAGAGGTGTGAAGG - Intergenic
1189857450 X:45237661-45237683 TTCTGGGTGCAGAGGGGTGGGGG + Intergenic
1189897784 X:45673502-45673524 CGCTGGCAGCAGTGGTGTGGTGG - Intergenic
1190103964 X:47545142-47545164 CTCAGGATGCTGAGGTGGGAGGG + Intergenic
1191093815 X:56654072-56654094 CCCTTGCTGCAGAGGTGTTGTGG + Intergenic
1194779455 X:98006385-98006407 CTCAGATTGCAGAAGTGTGAAGG + Intergenic
1195545183 X:106105963-106105985 CTCTGGGGGCAGTGATGTGAGGG - Intergenic
1196687692 X:118526310-118526332 CTCTTGCTTCAGAGATGTGAAGG + Intronic
1196730602 X:118937901-118937923 CTCTAGCTGCATAGTTGTGCAGG + Intergenic
1197978142 X:132187164-132187186 CTCTGGCTGCAGTGCGGAGAAGG - Intergenic
1198180087 X:134199036-134199058 CTCTGGAGGCTGAGGTGGGAGGG - Intergenic
1198365050 X:135931807-135931829 CTCTGGGGGCTGAGGTGGGAAGG + Intergenic
1199428728 X:147734187-147734209 TTCTGACTGCAGCTGTGTGAGGG + Intergenic
1200236176 X:154468811-154468833 CCCTGGCTGCAGGAGTGTGCTGG + Exonic