ID: 1183492947

View in Genome Browser
Species Human (GRCh38)
Location 22:38126515-38126537
Sequence CACAGCCCAGGTTTGATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183492947 Original CRISPR CACAGCCCAGGTTTGATCTA GGG (reversed) Intronic
900934182 1:5754993-5755015 CAGAGCCAAGGTTTGAGCTCCGG - Intergenic
900999999 1:6144198-6144220 CACAGCACAGGTTTGATGAAGGG + Intronic
902243741 1:15105608-15105630 CAGAGCCCAGATTTGACCTTGGG + Intronic
902745445 1:18470681-18470703 CAAGGCCCAGTTTTGATCTGGGG + Intergenic
903082707 1:20824104-20824126 CACAGTTCAGGTTTCATCTCTGG + Intronic
903352798 1:22728329-22728351 CACACCTCAGGATTGTTCTAAGG - Intronic
904482694 1:30804086-30804108 CACAGCCCAGGTTGGGACAAAGG - Intergenic
904547732 1:31289380-31289402 CACAGCCACGGTTTTATCTGTGG + Exonic
904953577 1:34264124-34264146 AACGGCACAGGTTTGAACTATGG + Intergenic
905701260 1:40017059-40017081 GGCAGGCCAGATTTGATCTAGGG - Intergenic
906143279 1:43546056-43546078 CAGAGCCCAGGGGTGATCCAGGG + Intronic
906775621 1:48527024-48527046 CACAGCTCAGATTTCCTCTATGG - Intergenic
907251615 1:53143259-53143281 CACAGCCCACCTTTGAACTCAGG - Intergenic
910223773 1:84916159-84916181 CAAAGTCCTGGTTTGATCTCTGG - Intergenic
914978995 1:152395706-152395728 CACAGCCGAGGTTTGAACTTAGG + Intergenic
917365398 1:174226161-174226183 CACCTCCCAGTTTTGACCTAAGG - Intronic
918272882 1:182920241-182920263 CACAGCACAGGTTTGTTCTCTGG - Intronic
921065597 1:211620373-211620395 CTCAGCACAGGTTTGAGCCAAGG + Intergenic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1069534638 10:69243987-69244009 CACTGCCCAGGTGTGTTCTGCGG - Intronic
1070354065 10:75621831-75621853 GACAGCCCAGACTTGTTCTATGG - Intronic
1071262892 10:83937057-83937079 CACAGCCCTGGATTCATCTGAGG - Intergenic
1072318520 10:94226346-94226368 CAAAGCCTAGGTTTGAACTTAGG - Intronic
1074688057 10:115977826-115977848 TACTGCTCAGGTTTGTTCTAAGG + Intergenic
1075012825 10:118889313-118889335 CAGAGCCAAGGTTTGAACTTAGG - Intergenic
1075318709 10:121472253-121472275 CTCAGCCCAGGTTTGAAGTTTGG + Intergenic
1075995214 10:126871538-126871560 CACAGCCCAGCTTTGCTGTCTGG + Intergenic
1077797104 11:5504479-5504501 CACAACTCAGATTTGATCTTGGG + Intronic
1079975021 11:27080222-27080244 CAGAGCCAAAGTTTGATTTAAGG + Intronic
1088753727 11:112867822-112867844 CAGAGCCCAGGTTTTATTTGGGG + Intergenic
1088763765 11:112957317-112957339 GAGACCCCAGGTTTGATCTTAGG - Intergenic
1092748799 12:11698962-11698984 CACAGCCCAGATTTGAACACAGG + Intronic
1102128815 12:110508748-110508770 CACCGCCATGGTTTGATCCAGGG + Intronic
1102643895 12:114390954-114390976 CTCAGCCCAGCTGTGATCTCGGG - Intronic
1103560480 12:121790816-121790838 CAAAGCACAGGCTTGAGCTAGGG + Intronic
1104892425 12:132147011-132147033 CACAGCCCAGGTCTGCTTTATGG - Intronic
1106575287 13:30968771-30968793 CCCAGCCCAGCTTTGAGCTTAGG - Intronic
1111869984 13:93819255-93819277 CACATCCCAGATTTGATCCTTGG + Intronic
1113189060 13:107722667-107722689 GATAGCCCAGGTTTGATTTAAGG - Intronic
1117788096 14:59308633-59308655 CTCAGCCCAGGTTGTCTCTAGGG + Intronic
1117998500 14:61500785-61500807 CTCAGCCCATGTTTCATCTTTGG - Intronic
1129413074 15:75360466-75360488 CAGAGCCCAGGCCAGATCTAGGG - Intronic
1129894406 15:79092666-79092688 TGCAGCCCAGGTTTGGTCTGTGG - Intergenic
1131935345 15:97498015-97498037 CACAGGCCAGGTTTGGTTTATGG - Intergenic
1133038970 16:3049856-3049878 CACAGCCCAGGTTTGAACCCAGG - Intronic
1136347873 16:29688117-29688139 TTCAGCCCAGTTCTGATCTAAGG - Intronic
1138147943 16:54628932-54628954 CACAGCCCAGGTGAGATGAAAGG + Intergenic
1138526477 16:57610673-57610695 CACAACCCAGGTTTGTCCTCTGG - Intronic
1139192742 16:64883504-64883526 CACAGCTGGGATTTGATCTAAGG + Intergenic
1143966076 17:10757233-10757255 CAGAGCCCAGGTCTGGTCAAAGG - Intergenic
1144394077 17:14826586-14826608 CACAGCCCAGCTTTGGCCTGAGG - Intergenic
1145037946 17:19554237-19554259 CACAGCCCAGGCCTGATGTTGGG - Intronic
1146080469 17:29775664-29775686 AACAGCCAAGGTTAAATCTAAGG - Intronic
1146221963 17:31031856-31031878 CACAGCACAGGATTGAGCAAGGG - Intergenic
1147610001 17:41796291-41796313 CAAACCCCAGGTCTGACCTATGG - Intergenic
1149415261 17:56452843-56452865 TACAGCCCAGATTTGAACTCAGG - Intronic
1156382740 18:36578669-36578691 CTCAGCCCTGGTTTGATTTGGGG + Intronic
1162854720 19:13459547-13459569 CACAGCCCAGCTTTGTTCTCTGG - Intronic
1163480801 19:17555351-17555373 CACAGCCCGGGTTTTATACATGG + Intergenic
1164573281 19:29389460-29389482 CAGAGCACAGGTTTGAGCTGAGG - Intergenic
1165905414 19:39191501-39191523 CCCAGCCCAGGAATGATCTATGG - Intergenic
1166642607 19:44506773-44506795 CAAAGCCCAGGTCTCATCTGAGG - Intronic
926937008 2:18096115-18096137 CAGAGCCAAGGTTTGAACTCGGG + Intronic
927393156 2:22618897-22618919 CACAGCCCAGGTTTAAGGAAAGG + Intergenic
927860200 2:26555962-26555984 CAGAACCCAGGTAGGATCTAGGG + Intronic
931009706 2:57896137-57896159 CACGGCCCAGGTTTCATCACAGG + Intergenic
936767473 2:115870963-115870985 CACAACCAAGGTTTTATCAATGG + Intergenic
937731308 2:125233691-125233713 CACAGCCCAGGATTTAAATAGGG - Intergenic
938668191 2:133560990-133561012 CACAGCCCTGGTTTGGTTGATGG + Intronic
938896935 2:135761337-135761359 TACAGGCCAGGTTTGATCCTGGG - Intronic
943759125 2:191589413-191589435 CACAGACCAGATTTTATTTATGG - Intergenic
946389259 2:219405547-219405569 CAAAGTCCAGGCTTGATCTGTGG - Intergenic
946426626 2:219601873-219601895 CAAAGCCCAGCTATGATTTAGGG - Intronic
1169841282 20:9940662-9940684 GCTAGCCCAGGTTTGTTCTATGG + Intergenic
1178020048 21:28397284-28397306 CCAAGCCAAGCTTTGATCTAAGG + Intergenic
1181030731 22:20147877-20147899 CACAGCCCAGGGTGGACCCAGGG - Exonic
1181083156 22:20427165-20427187 CACAGCCCAGGGTTGCTCCTGGG - Intronic
1183492947 22:38126515-38126537 CACAGCCCAGGTTTGATCTAGGG - Intronic
1183934491 22:41254533-41254555 AGCAGCCCAGGTTGGCTCTAAGG + Intronic
950861397 3:16150527-16150549 CACAGCCCATGTTGAATCTCTGG + Intergenic
950979790 3:17289785-17289807 CAGAGCCAAGGTTTGACCCAAGG + Intronic
952341441 3:32450869-32450891 CATAGCCCAGGTTTGGTCCTAGG - Intronic
954795330 3:53158566-53158588 CACAGCCAAGGTTTGCTCTCAGG + Intronic
956414094 3:69009129-69009151 CAATGCCCAGCTTTGATCTCTGG + Intronic
958637268 3:96761522-96761544 CTTAGCCCATATTTGATCTATGG + Intergenic
961128952 3:124447488-124447510 CACAGCCAGGATTTGATCTGAGG + Intronic
961142797 3:124569340-124569362 CAGAGCCCAAGTTTTATCCACGG - Intronic
961609337 3:128124012-128124034 CACGCCCCGGATTTGATCTAGGG + Intronic
964834893 3:160927210-160927232 CACAGCCCAGCTTTGATTCTGGG - Intronic
966916563 3:184587540-184587562 CACAGCCCAGGTTCTAGCTTGGG + Intronic
966927439 3:184654518-184654540 CACAGCCCAGCCTTGGCCTAGGG - Intronic
969932504 4:10644514-10644536 CAGAGCCTAGGTTTGAGCTCAGG + Intronic
971088302 4:23306371-23306393 CACAGCCTGGGTTTGAACCATGG + Intergenic
974261715 4:59533252-59533274 CTCTGCCCAGCTTTGATATAAGG - Intergenic
975678288 4:76849960-76849982 GACAGTCCATGATTGATCTATGG + Intergenic
978831597 4:113092446-113092468 CAGACCCCAGCTTTGACCTATGG + Intronic
985774285 5:1832723-1832745 CCCAGCCCAGGTGTGAACAAAGG + Intergenic
986064055 5:4218652-4218674 CACAGATCAGATTTGACCTAAGG - Intergenic
986758591 5:10859613-10859635 AACAGGCCAGATTTGATCTGTGG + Intergenic
989169162 5:38458305-38458327 CACTGCCCAGGTTATAGCTAAGG - Exonic
990232286 5:53726469-53726491 CACATCTGAGATTTGATCTAAGG - Intergenic
993018744 5:82564978-82565000 CACAGCTCAGGGGTGATCTCAGG - Intergenic
994340303 5:98618871-98618893 CACAGTTCAGCTTTGATATAAGG + Intergenic
996867727 5:128146332-128146354 CTAAGTCCAGGATTGATCTAGGG + Intronic
998041643 5:138954326-138954348 CACAGCCCATGTTTGGCCCATGG - Intronic
1000369494 5:160521000-160521022 CACAGCTCAGGTTTTCTCTCAGG + Intergenic
1000540158 5:162529756-162529778 CCCACCCCAGCTTTCATCTACGG + Intergenic
1001018547 5:168163311-168163333 TACAGGCCAGGTTTGGTCCATGG - Intronic
1004191284 6:13465976-13465998 CTCAGCCTAGGTTGGATCTTAGG + Intronic
1004350709 6:14888032-14888054 CCAAGCCCAGGTTTGATTTTAGG - Intergenic
1006696340 6:35933544-35933566 CACAGCCAAGGGTTGATAAATGG + Intergenic
1009229329 6:61043462-61043484 CACAGCTCAGGGGTGATCTCAGG + Intergenic
1010753629 6:79642423-79642445 TAGAGCCCTGGCTTGATCTAAGG + Intronic
1019707004 7:2501719-2501741 CCCGGCCGAGGTGTGATCTAAGG + Intergenic
1030866376 7:114705719-114705741 CATAGCCCAGATGTGGTCTATGG + Intergenic
1033112768 7:138596791-138596813 CAGAGCCAAGTTTTGATATATGG + Intronic
1037921760 8:22811618-22811640 CACAGCCCAGGTGTGATGCTGGG - Intronic
1038463208 8:27734344-27734366 CACAGCACAGATTTGATCAAGGG + Exonic
1039880671 8:41623587-41623609 CAAAGCCAAAGTTTGAACTATGG - Exonic
1040750402 8:50698776-50698798 CACATCCCAAGGTAGATCTAGGG + Intronic
1041905330 8:63026681-63026703 AACAGCAAAGGTTTGAGCTATGG + Intronic
1042862047 8:73324818-73324840 CACAGTGCAGATTTGATCTGTGG - Exonic
1043059299 8:75479440-75479462 CAGAGCCCAGATTTGAACTGAGG + Intronic
1047693416 8:127379617-127379639 CAAAGCCTAGATTTTATCTAGGG + Intergenic
1048507661 8:135035390-135035412 CACAGCCCAGATTTGAACTCTGG + Intergenic
1053533017 9:38900332-38900354 GACAGCCTAGGTTTGAGCTGGGG - Intergenic
1054205244 9:62124761-62124783 GACAGCCTAGGTTTGAGCTGGGG - Intergenic
1054633118 9:67463609-67463631 GACAGCCTAGGTTTGAGCTGGGG + Intergenic
1054873869 9:70075206-70075228 TACTGCCCAGGTTTGAACCATGG - Intronic
1056260301 9:84841889-84841911 AACATCCCAGGTTGAATCTAGGG + Intronic
1057253412 9:93522843-93522865 CACAGTCCAGATTTGGTCCAGGG - Intronic
1059158498 9:112011720-112011742 GACGGCCCAGATTTGACCTATGG + Intergenic
1059416236 9:114164098-114164120 CACAGCCAAGGTTTGAACCCAGG - Intronic
1061401807 9:130372569-130372591 CACTGCCCAGGCTTGAACAAAGG - Intronic
1062205070 9:135331805-135331827 CAAAGCCCAGGTTTGAACCCTGG - Intergenic
1189346203 X:40243295-40243317 CTCAGCCCAGGTTTGAGCAGAGG + Intergenic
1191095903 X:56672660-56672682 TATAGCTCAGGTTTGATTTACGG - Intergenic
1191255758 X:58278927-58278949 CACAGCCCAGGTGTGAGCCAGGG + Intergenic
1192410988 X:70931923-70931945 AACAGGCCAGGTTTTATCAAAGG - Intergenic
1193855844 X:86600676-86600698 CACAGCCCAGGATTGATTTCAGG + Intronic
1194079980 X:89449496-89449518 CACAGCCTTGGTTTTATCTTGGG + Intergenic
1200118105 X:153777986-153778008 CACAGCTCATCTTTGATGTACGG + Exonic
1200432602 Y:3104770-3104792 CACAGCCTTGGTTTTATCTTGGG + Intergenic