ID: 1183498881

View in Genome Browser
Species Human (GRCh38)
Location 22:38166257-38166279
Sequence CCAGCCAAAGGGAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 398}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183498881_1183498892 4 Left 1183498881 22:38166257-38166279 CCTTCCACCCTCCCTTTGGCTGG 0: 1
1: 0
2: 0
3: 38
4: 398
Right 1183498892 22:38166284-38166306 GTGGATGTGATGGCTGGATCTGG No data
1183498881_1183498891 -2 Left 1183498881 22:38166257-38166279 CCTTCCACCCTCCCTTTGGCTGG 0: 1
1: 0
2: 0
3: 38
4: 398
Right 1183498891 22:38166278-38166300 GGAAAGGTGGATGTGATGGCTGG 0: 1
1: 0
2: 15
3: 58
4: 433
1183498881_1183498890 -6 Left 1183498881 22:38166257-38166279 CCTTCCACCCTCCCTTTGGCTGG 0: 1
1: 0
2: 0
3: 38
4: 398
Right 1183498890 22:38166274-38166296 GGCTGGAAAGGTGGATGTGATGG 0: 1
1: 0
2: 2
3: 52
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183498881 Original CRISPR CCAGCCAAAGGGAGGGTGGA AGG (reversed) Intronic
900363927 1:2302905-2302927 CCAGCCACGGGGCTGGTGGAGGG + Intronic
900807026 1:4774258-4774280 CCAGCCACAGGGAATGTGGGGGG + Intronic
903522949 1:23967607-23967629 GCGACCAAAGGGTGGGTGGAAGG - Intronic
903546229 1:24124965-24124987 TCACCCATAGGGAGGCTGGATGG + Intronic
904246287 1:29190432-29190454 ACAGCTATAAGGAGGGTGGAAGG + Intergenic
904534606 1:31190822-31190844 CCAGGCAGAGTCAGGGTGGAAGG - Intronic
906322041 1:44823014-44823036 CCAGCCCAAGGGACGGGGTAGGG - Intronic
906777668 1:48544259-48544281 CCAGCCAAATGGAGACTGGCTGG - Intronic
907830618 1:58061019-58061041 CCTGCCAAAGGGAGGGATGGAGG - Intronic
907906829 1:58790088-58790110 TCAGCCAAAGGCAGTGTGGCTGG - Intergenic
912563813 1:110570528-110570550 CCACCCGCAGGGAGGGAGGAGGG - Intergenic
913192470 1:116425215-116425237 CCAGCCAAAGGGAGCAATGAGGG + Intergenic
913341162 1:117759231-117759253 CCTGCCAGAGCGAGTGTGGACGG - Intergenic
914737138 1:150428553-150428575 ACAGGGAAAGGGAGGGAGGAAGG - Intronic
915836818 1:159183473-159183495 CCAGCCAGAAAGAGGGTGGATGG + Intronic
916786916 1:168093022-168093044 CCAGCGGAAGGGCAGGTGGAGGG + Intronic
917006996 1:170426389-170426411 CCAGCCAAGGGAAGCATGGAGGG + Intergenic
917666954 1:177234339-177234361 CCAGTCAAAGGGAGGTGGCATGG - Intronic
918022341 1:180707340-180707362 CTAGCCTATCGGAGGGTGGAGGG - Intronic
919479119 1:198064643-198064665 CCAGCCAAAGGCTGGAGGGAAGG - Intergenic
919501656 1:198344997-198345019 ACAGCTAAGGGGAGGGTAGATGG - Intergenic
920288972 1:204903200-204903222 CAAGACAAAAGGAGGGTGGTGGG + Intronic
921986207 1:221315620-221315642 CCAGAAAAAGGGGGAGTGGATGG + Intergenic
922058959 1:222069158-222069180 CCAGCTACAGGGAGTGTTGATGG - Intergenic
922801030 1:228364881-228364903 CCTGCCACAGGCAGGGTGGGTGG - Intronic
923516026 1:234698669-234698691 CTAGCTAGAGGGAGGGTGGCAGG - Intergenic
923933140 1:238726518-238726540 CCAGAGGAAGGGAGGGTGCAGGG + Intergenic
1063159943 10:3411977-3411999 CAAGACAAAGGGAGGCTGGCAGG - Intergenic
1065136993 10:22681300-22681322 AGAGCTAAAGGGAGGTTGGAGGG + Intronic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065845963 10:29743600-29743622 ACAGCCAACAGGAGGCTGGAAGG - Intergenic
1067582056 10:47452231-47452253 CCAGGAACAGGGAGGTTGGAGGG + Intergenic
1069590663 10:69639786-69639808 GGAGCCCTAGGGAGGGTGGAAGG + Intergenic
1069877039 10:71569237-71569259 ACAGCCAATGAGAGGGTGGGAGG - Intronic
1070282155 10:75057926-75057948 CCAGACAGCAGGAGGGTGGAGGG - Intronic
1070298882 10:75188399-75188421 ACAGCCCAGGGGAGGGAGGAGGG - Intergenic
1070400710 10:76051102-76051124 TCAGCCAAAGGGAAGGAGGGAGG + Intronic
1072047879 10:91674851-91674873 CCAGCCAATGGGAAGGAGGAAGG - Intergenic
1072061289 10:91813458-91813480 CCAGATAAAGGCATGGTGGAAGG + Intronic
1072415336 10:95242255-95242277 CCTCCCAAAGGAAGGGAGGAAGG - Intronic
1072844718 10:98817058-98817080 TCAACCAAAGGGAGGGAGGGAGG - Intronic
1073295910 10:102438613-102438635 CCAGCCCCAGTGAGGGAGGAGGG - Intergenic
1073462831 10:103676468-103676490 CCAGCCTAAGTGGGTGTGGACGG + Intronic
1074857998 10:117487547-117487569 CCAGCAAAAAGGAGGAAGGAAGG - Intergenic
1076205883 10:128602309-128602331 CCAGCCTCAGGGCAGGTGGACGG - Intergenic
1076272514 10:129166468-129166490 ACGGCCCAAGGGAGGGTGGAGGG + Intergenic
1076323075 10:129598158-129598180 CCAGCCTCAGGGTGGGTGCATGG + Intronic
1076895733 10:133310468-133310490 CCTGCCGAAGGGAGGCTGGAGGG + Intronic
1077119232 11:899224-899246 CCAGGCACAGGGACTGTGGAAGG + Intronic
1077209301 11:1361074-1361096 CCACCCCAAGTGACGGTGGAGGG + Intergenic
1077332013 11:1987967-1987989 CCAGCCTAAGGCAGTGGGGACGG - Intergenic
1077782690 11:5348710-5348732 CCACCCAGACGGAGGGTGGGTGG + Intronic
1078417381 11:11177113-11177135 CCAGCTATAGGGATGATGGAAGG - Intergenic
1078436375 11:11328991-11329013 CCTGCCTAAGGGATGGTGGGGGG - Intronic
1079053448 11:17183846-17183868 CCTCCCAAAGGGAGGGTGCTGGG - Intronic
1080664372 11:34322791-34322813 CCAGCTACTGGGAGGGTGGGGGG - Intronic
1082837237 11:57660090-57660112 CCAGAGAAAGGTGGGGTGGAGGG + Intronic
1083331452 11:61900301-61900323 CCAGCCTAAGACAGGGTGGAAGG + Intronic
1083412053 11:62500745-62500767 CCAGCCAAAGGGGAGATGAAAGG - Intronic
1083783655 11:64931631-64931653 CCCGCCAGAGGGAGGCTGGGAGG + Intronic
1084540373 11:69782603-69782625 CCAGGGAGAGGGAGGGGGGAGGG - Intergenic
1085174426 11:74473818-74473840 CCAGGCAAGGGGTGGGAGGAAGG + Intergenic
1086988699 11:93278991-93279013 CAAGCCAAAGGGAGAGAGGAAGG - Intergenic
1087257587 11:95973789-95973811 TCAGCAAAAGGGAAGGAGGAAGG - Intergenic
1088250403 11:107857102-107857124 CCAGCAGAAGGAAGGGAGGAAGG + Intronic
1088723530 11:112614873-112614895 CCTGTCAGAGGGAGGGTTGATGG + Intergenic
1088723767 11:112617100-112617122 CCTGTCAGAGGGAGGGTTGATGG + Intergenic
1089039643 11:115434677-115434699 CCAGCCACAGGAAGGGCTGATGG - Intronic
1089136334 11:116252244-116252266 CCAGCCAAAGGAAAGGTAGCAGG + Intergenic
1089217668 11:116845083-116845105 GCAGGCAAAGGGAGAGAGGAAGG - Intronic
1089395862 11:118136051-118136073 CGAGCCAATGGGAGGTTGGAGGG + Exonic
1090483152 11:127085915-127085937 CCAGGCTAAGGGGTGGTGGAAGG + Intergenic
1090761976 11:129845886-129845908 GCAGCAAAAGGTAGGGTGGGTGG + Intronic
1090908706 11:131099383-131099405 CAACCCAAATGGAGGGTAGATGG + Intergenic
1091208474 11:133836311-133836333 GCAGGCAAAGGGAGGCTGGGAGG + Intergenic
1202814994 11_KI270721v1_random:43143-43165 CCAGCCTAAGGCAGTGGGGACGG - Intergenic
1091491570 12:937118-937140 CCATCTAAAGGAAGGGTGGACGG - Intronic
1091746242 12:2994933-2994955 CCTGCCACAGGGCGGGTAGATGG - Exonic
1091841467 12:3624290-3624312 CCTGGAGAAGGGAGGGTGGAGGG - Intronic
1092021009 12:5202142-5202164 CAAGCCCGAGGGAGTGTGGAGGG + Intergenic
1093512621 12:19947131-19947153 TCAGACAGCGGGAGGGTGGAAGG - Intergenic
1093889938 12:24508025-24508047 GCAGCCTGAGGGTGGGTGGAAGG + Intergenic
1094222515 12:28009487-28009509 CCAGGGAGAGGGAGGGTGGCAGG + Intergenic
1094362862 12:29649088-29649110 GCAGCCAAGGGGAGAGTGGTGGG - Intronic
1095170305 12:39027040-39027062 CCAACCAAAGAGAGAGTGAAAGG + Intergenic
1095875096 12:47071413-47071435 CCAGACAAAAGGAGGCAGGAGGG + Intergenic
1096099558 12:48961419-48961441 GCAGCCAGAGGGAGGGAGAAAGG - Intergenic
1096714663 12:53483821-53483843 CCAGCCCCAGGGCGGGTGGAAGG - Intronic
1096867895 12:54576092-54576114 CCAGCCCAGGTGAGGGTGGCTGG + Exonic
1097069363 12:56343589-56343611 GCAGGGAAAGGGAGGGAGGATGG + Intronic
1097474969 12:60042429-60042451 ACAGAAAAAGGGAGGGAGGAAGG + Intergenic
1098051159 12:66454766-66454788 CCAGCCTAAGGAAGATTGGAAGG - Intronic
1098317854 12:69210968-69210990 TCAGGGGAAGGGAGGGTGGATGG - Intergenic
1098323749 12:69278867-69278889 CCAACCAAAGTGAGAGTGGGGGG - Intergenic
1101433477 12:104645650-104645672 TAAGCCAAGGGGAGGGTGGGGGG - Intronic
1101439927 12:104695961-104695983 CCTGCCAAAGTGGGGGTGGGAGG - Intronic
1103367659 12:120394849-120394871 CCAGCCAACGGGCAGGTGGGAGG - Intergenic
1103455131 12:121059556-121059578 CCAGCCCCAGGGAGACTGGAAGG - Intergenic
1103511341 12:121476729-121476751 CCAGGGAAAGGGAGGAGGGAGGG - Intronic
1104743010 12:131192845-131192867 CCAGGGATAGGGAGGGGGGAAGG - Intergenic
1104841122 12:131826462-131826484 TCAGAGGAAGGGAGGGTGGATGG - Intergenic
1106674282 13:31941383-31941405 CCTGCCAAAGAGAGGGAGGGAGG + Intergenic
1106790931 13:33154144-33154166 CCATCCACAGGGAGGGTGTCGGG + Intronic
1107605292 13:42049482-42049504 CCACTCAGAGGGTGGGTGGAAGG + Intronic
1107832025 13:44383022-44383044 CCAGACAAAGGGTGTGAGGAAGG + Intronic
1108482711 13:50890976-50890998 CCAGGCAAGGGAAGGCTGGAAGG - Intergenic
1109716166 13:66225359-66225381 CAAGGCAGAGAGAGGGTGGAGGG - Intergenic
1112955796 13:105056675-105056697 AGAGTCACAGGGAGGGTGGAGGG + Intergenic
1113708426 13:112448625-112448647 CCAACCACAGGGAGAATGGAAGG + Intergenic
1113772241 13:112917609-112917631 CCACCCAGAGGGAGGAAGGAAGG - Intronic
1114271308 14:21101983-21102005 CCACCACAAGGGAGGGTGGAAGG + Intronic
1114500215 14:23163017-23163039 TCAGCTAATGGGAGGGTGGGAGG - Intronic
1115128456 14:30024721-30024743 CCACCCAAGGGGAGGGAGGTGGG - Intronic
1117334382 14:54744396-54744418 CCAGCCACAGGGAGGCTGTGCGG - Intronic
1118269234 14:64326918-64326940 TCTCCCAAAGGGAGGGTAGAAGG - Intronic
1119190983 14:72681571-72681593 GCAGGCATAGGAAGGGTGGAGGG - Intronic
1119752339 14:77088508-77088530 CCAGCCCCAGGGAGTCTGGATGG - Intergenic
1121242574 14:92440905-92440927 CCAGGCAAAGGCAGGGAGGAGGG + Intronic
1121504659 14:94467727-94467749 CCTGGCAGATGGAGGGTGGATGG + Intronic
1121773086 14:96569411-96569433 CCAGTAAGAGGGAGTGTGGAGGG - Intergenic
1122324432 14:100874232-100874254 CCAGGCCAAGGGACGGAGGATGG - Intergenic
1122744026 14:103887553-103887575 CCATCCAGCTGGAGGGTGGATGG + Intergenic
1122804380 14:104249244-104249266 CCAGCCAAAGGGAGGTGGCCAGG + Intergenic
1122924740 14:104894414-104894436 CCAGGCAAAGGCAGGCTGGCTGG - Intronic
1124356155 15:28996374-28996396 CCATGCACAGGGAGGGAGGATGG - Intronic
1125254833 15:37751473-37751495 AGAGCAAAAGGGAGGGAGGAAGG + Intergenic
1125267819 15:37904036-37904058 ACAGCCAAAGCAAGGCTGGACGG + Intergenic
1125715161 15:41815502-41815524 ACAGCCAAATGAAGGCTGGAAGG - Intronic
1125892760 15:43278325-43278347 TCAGGCAAAGGAAGGGTGAATGG - Intronic
1126419674 15:48458024-48458046 CCAGCCAAGGGGCTGATGGAAGG - Intronic
1127902762 15:63353433-63353455 CCTGGCAAAGGGAGGCCGGATGG - Intronic
1128541378 15:68536863-68536885 CCAGCCAATAGGAAGGAGGAAGG - Intergenic
1128619118 15:69133825-69133847 GCAGCCAGAGTGAGGGTGGCAGG - Intergenic
1128879947 15:71234009-71234031 GCAGCCACAGCAAGGGTGGAAGG - Intronic
1129151938 15:73694665-73694687 CCAGCCAGTGGGAAGGGGGAGGG + Intronic
1129191051 15:73937791-73937813 CCACCCAAAGACTGGGTGGATGG - Intronic
1129249189 15:74299253-74299275 CCAGCAAGAGGGAGGGTAGAGGG - Intronic
1130145774 15:81272808-81272830 CCACACAGAGGGAGGCTGGATGG - Intronic
1130541308 15:84822494-84822516 ACAGCCGAAGGGAGTGTGGATGG + Intronic
1131225037 15:90617490-90617512 TCAGCCAAAGGTAGGTAGGATGG + Intronic
1132070945 15:98776109-98776131 ACTCCCGAAGGGAGGGTGGAAGG + Intronic
1132723443 16:1327979-1328001 CCAGAGACAGGCAGGGTGGATGG - Intergenic
1134201810 16:12205479-12205501 ACAGCAAGAGGGAGGGTGGTGGG - Intronic
1136069162 16:27777803-27777825 CCAGCCCTAAGGAGGATGGATGG + Intronic
1139349243 16:66325021-66325043 CCAGCCACAGCCAGGGAGGAGGG + Intergenic
1139602177 16:67993507-67993529 GGAGTAAAAGGGAGGGTGGAGGG - Exonic
1139665043 16:68449080-68449102 CCAGCAAAGGTGAGGGAGGACGG + Intergenic
1141181671 16:81757239-81757261 CCAGAAAATGGGTGGGTGGATGG - Intronic
1141399176 16:83732318-83732340 CCAGCCAAGGGGAGAGGTGAGGG + Intronic
1141806417 16:86344682-86344704 CCTGCCAAAGGGAAGGAGGCAGG - Intergenic
1142018482 16:87765473-87765495 CCCTTCAGAGGGAGGGTGGAGGG + Intronic
1142534009 17:601052-601074 CCACCAAAAGGGAGGCTGGCTGG - Intronic
1143077259 17:4354978-4355000 CCAGCTATAGGGAGGGAGGGAGG + Intronic
1143094080 17:4467517-4467539 CTAGCCTAGGGGAGGGTGAACGG - Intronic
1144632004 17:16878631-16878653 GCAGCCGAAGGGAGGGTGGCAGG + Intergenic
1144637933 17:16922950-16922972 GCAGTCAAAGAGAGGGTGGCAGG + Intergenic
1145013306 17:19381954-19381976 CCAGCCAAGGGGTCAGTGGAGGG - Exonic
1145209021 17:20999542-20999564 GCAGCCGAAGAGAGGGTGGCAGG - Intergenic
1146259741 17:31413567-31413589 TGAGCAAAAGGGAGGGAGGAGGG - Intronic
1146687665 17:34852416-34852438 CCAGCCAATGAAAGGGTGCAGGG + Intergenic
1146828795 17:36048156-36048178 CCTGCCAGATGGAGGGTGGTTGG - Intergenic
1147341704 17:39756323-39756345 CTGGCCCAAGGGATGGTGGAGGG - Intergenic
1147363674 17:39946617-39946639 CCGACCAAAGGGGTGGTGGAGGG - Intergenic
1147419265 17:40314130-40314152 CCAGCCAGAGGTAGGGAGGGAGG + Intronic
1147917411 17:43896942-43896964 CCTGCCCCAGGGAGTGTGGAAGG - Intronic
1148333869 17:46828610-46828632 ACAACAAAAGGGAGGGTGTAGGG + Intronic
1148564497 17:48625259-48625281 CCGGCCAAGGGGAAGGGGGAGGG - Intronic
1149422828 17:56527806-56527828 GTGGCCAAAGGGTGGGTGGAGGG - Intergenic
1149550359 17:57535088-57535110 ACAGCCAGCGGGAGGGAGGAAGG + Intronic
1149792957 17:59495119-59495141 CAAGCCACATGGAGAGTGGAAGG - Intergenic
1150247794 17:63689264-63689286 CTGGCCAAAGGGAAGGTGTATGG - Intronic
1150618554 17:66791139-66791161 CAAACAAAAGGGAGGGGGGAGGG - Intronic
1150971513 17:70033369-70033391 CCATCCCAATTGAGGGTGGAGGG - Intergenic
1151318424 17:73338056-73338078 CCAGCCACAGTGATGGTGCATGG + Exonic
1151350795 17:73530916-73530938 CCAGCCCTAGGGAGGCTTGAGGG + Intronic
1151393812 17:73805962-73805984 CCAGCCAAAGAGAAGGAGGTGGG + Intergenic
1152036257 17:77874926-77874948 CCAGGAGAAGGGAGGGTGCAGGG + Intergenic
1152847991 17:82614205-82614227 CCCGCCACAGGGAGTGAGGAGGG + Intronic
1152848004 17:82614241-82614263 CCCGCCACAGGGAGTGAGGAGGG + Intronic
1152848017 17:82614277-82614299 CCCGCCACAGGGAGTGAGGAGGG + Intronic
1153181721 18:2442652-2442674 CCAGACAGTGGGAGGGTGGGAGG - Intergenic
1153301360 18:3594766-3594788 ACAGCCAAGGGTAGGGTGGATGG + Intronic
1153871976 18:9330213-9330235 CCAGGCAAAGGTAAGGTGCAGGG - Intergenic
1155057092 18:22194442-22194464 CCTGCCGAAAGGAGGGAGGATGG + Intronic
1157470093 18:47982444-47982466 CCAGAGAGAGGGAGGGGGGATGG + Intergenic
1158412523 18:57220824-57220846 GGAGCAAAAGGGAGGGTGGTAGG - Intergenic
1158503394 18:58024195-58024217 TCAGCCAATTGGAGGATGGAGGG - Intergenic
1160514485 18:79470896-79470918 CCCGCCCCAGGGAGGGTGAAGGG - Intronic
1160528854 18:79552176-79552198 CCAGGCCCAGGGAGGCTGGAGGG - Intergenic
1160967003 19:1751040-1751062 TCAGCCGAAGGGAGGGGTGAGGG + Intergenic
1161456703 19:4373231-4373253 CCAGCCCAAGGGAAGATGGAGGG + Intronic
1161899742 19:7109585-7109607 TCAGTCTCAGGGAGGGTGGACGG - Intergenic
1162818136 19:13208237-13208259 ACAGCCACAGGGAGGAGGGAGGG + Intronic
1162881455 19:13662735-13662757 CCAGCCACACGGAAGGAGGAAGG - Intergenic
1163554663 19:17985121-17985143 GCAGGCAAAGGGAATGTGGAAGG + Intronic
1163571612 19:18085368-18085390 CCAGGGAAAGGGAAGGAGGATGG - Intronic
1163618172 19:18341639-18341661 CCAGATAAAGGAAGGCTGGAAGG - Intronic
1164112674 19:22184273-22184295 CTAGCCAAAGGAAGGGTTTAGGG + Intronic
1164772453 19:30820340-30820362 ACAGAGAAAGGGAGGGAGGAAGG - Intergenic
1165159708 19:33808764-33808786 CCAGGCCAAGGGAGGCTGGGTGG + Intronic
1165469859 19:35996934-35996956 CAGACCAAAGGGAGGATGGACGG + Intergenic
1166201208 19:41238945-41238967 CCTGACATAGGGAGGGAGGATGG + Intronic
1166882786 19:45939615-45939637 CCAAGCACAGGGAGGGAGGAAGG + Exonic
1167033228 19:46977456-46977478 CCAGCTGAAGAGAGGGAGGAAGG - Intronic
1167369417 19:49071899-49071921 CCAGCCGAAGACAGGGTGGGCGG - Intronic
1168063286 19:53906149-53906171 ACAGGCAAATGGAGGGAGGAAGG - Intronic
1168397867 19:56064243-56064265 ACAGCCAAAGGGAAGGTCAAAGG + Intergenic
925112208 2:1346270-1346292 CCAGCGCCAGGCAGGGTGGAGGG - Intronic
925112234 2:1346343-1346365 CCAGTCCTAGGGAGGGTAGAGGG + Intronic
926136834 2:10342498-10342520 CCAGCCTGGGGGAGGGTGGGAGG + Intronic
926249765 2:11147912-11147934 CCAGAACAAGGGAGGGTGGATGG + Intergenic
927065269 2:19464712-19464734 CCAGCCAAAGGGTTGGTGCCTGG + Intergenic
927206097 2:20611627-20611649 TCTACCAAAGGGAGGGTAGATGG - Intronic
927214771 2:20662063-20662085 CCAGACCCAGAGAGGGTGGATGG + Intergenic
927924974 2:27005707-27005729 ACATCCAAAGGGAGAGTGGCAGG + Intronic
928085527 2:28344180-28344202 CCAGCCAAATGGCTTGTGGAGGG + Intergenic
928374593 2:30764432-30764454 CCAGGCAAAGGGGAGGTGGGTGG - Intronic
928493484 2:31807491-31807513 CCTGCCAGGGGGTGGGTGGAGGG + Intergenic
928546467 2:32333479-32333501 CCAACCAAAGGGAGGGTTTAAGG + Intergenic
928934900 2:36665635-36665657 CCAGCCAATGGGAAGATGGAGGG - Intergenic
929193410 2:39161650-39161672 CCTGAGAAAAGGAGGGTGGATGG + Intergenic
929507539 2:42540017-42540039 CCAGCCAGAGAGAGGGAGGAAGG - Intronic
929856970 2:45645689-45645711 AGAGCAAAAGGGAGGGAGGACGG + Intergenic
929892384 2:45929103-45929125 CCTGCCAGAGGAGGGGTGGATGG - Intronic
932345928 2:70995023-70995045 GCAGCCAGAGGGAGGCGGGACGG + Exonic
932494615 2:72140226-72140248 CCAGGCAGCGGGAGGGTGGGCGG - Intronic
933898517 2:86833022-86833044 GCAGCAAGAGGAAGGGTGGAGGG - Intronic
935571137 2:104661135-104661157 CCTGCCTCTGGGAGGGTGGAGGG - Intergenic
936704799 2:115059099-115059121 CCAAACGAAGGGAGGGAGGAAGG + Intronic
938550906 2:132381533-132381555 CCAGGCAATGGGCGGGTGGGAGG + Intergenic
938658475 2:133461093-133461115 GCAGCCAAAGGGAGATGGGATGG + Intronic
938849658 2:135247843-135247865 CAAGCGAAAGGGAGTGTGGAGGG + Intronic
939738489 2:145879252-145879274 AAAGCCAAAGGGAGGATGGGAGG + Intergenic
941203626 2:162544853-162544875 CCAATGAAAGGGAGGGTAGAAGG - Intronic
941747667 2:169104087-169104109 ACAGCGAAAAGGAGGCTGGAAGG + Intergenic
942346314 2:175005736-175005758 CCAGCCACAGTGAGCCTGGAGGG - Intergenic
944486811 2:200215461-200215483 CAAGCCAAATAGAGGGAGGAAGG - Intergenic
945154380 2:206823280-206823302 GCAGCTAAAGGAAAGGTGGAAGG + Intergenic
946362491 2:219227882-219227904 ACAGCCATAGGGAGAGTTGATGG - Intronic
947573944 2:231257615-231257637 CCAGTCACAGGGAGGGTAGCAGG - Intronic
947958218 2:234213085-234213107 CCAGAGACAGGGAGGGTGTATGG + Intergenic
947980403 2:234403777-234403799 CCAGCACAAGGGAGGGAGAAAGG - Intergenic
948021517 2:234737451-234737473 GGAGCCAAAAGGAGGGTGGTAGG + Intergenic
948584276 2:239009324-239009346 CCAGCGAAACGGAGCGTGGGAGG - Intergenic
948599626 2:239100881-239100903 CCTTCCAGAGGGACGGTGGAAGG + Intronic
948612115 2:239176370-239176392 CCAGGCAGAGGGAGGGAGGCCGG - Intronic
1168912683 20:1462355-1462377 CAAGAAAAAGGGAGGGAGGAGGG - Intronic
1170071920 20:12378579-12378601 CCATCCAATGGGAGATTGGAGGG - Intergenic
1170569494 20:17624920-17624942 CTAGCCAAAGGGAGGAGGGAGGG + Intronic
1172151927 20:32796826-32796848 CCCCTCAAAGAGAGGGTGGAAGG - Exonic
1172178847 20:32988435-32988457 CCAGACAAAGGGAGGCTGTGAGG - Intronic
1172766217 20:37352477-37352499 CCAGGCTCAGGGAGGCTGGATGG - Intronic
1174039255 20:47687428-47687450 CCAGCAGAAGGGAAGGGGGATGG - Intronic
1174198500 20:48790428-48790450 CAAGGAAAAAGGAGGGTGGAGGG + Intronic
1175229977 20:57467572-57467594 CCACCCAAACGGTAGGTGGAGGG + Intergenic
1175234677 20:57501780-57501802 CCACCCAGAGGGAGGGAGGCAGG + Intronic
1175268112 20:57714804-57714826 CCAGTCAAAGGCAGTGAGGAGGG - Intergenic
1175390874 20:58626583-58626605 CAAGCCAAGGGGAGCGTGCATGG - Intergenic
1175649048 20:60701132-60701154 CAATAAAAAGGGAGGGTGGATGG - Intergenic
1175891258 20:62317026-62317048 GCAGCGGAAGGGAGGGTCGAAGG + Intronic
1176512571 21:7759765-7759787 CCTGACAAAGGGAGGATGGTAGG - Intronic
1178646684 21:34390289-34390311 CCTGACAAAGGGAGGATGGTAGG - Intronic
1179264631 21:39792372-39792394 CCTGCCATAGGGTGGGGGGAAGG + Intronic
1179314802 21:40233932-40233954 ACAGCCAAAGCGAGGCAGGAAGG - Intronic
1179488937 21:41727969-41727991 CCAGGCACAGTGAGGGTGGAGGG + Intergenic
1179882516 21:44299568-44299590 CCAGCAAAAGTGAGGGAGGAGGG + Intergenic
1180156731 21:45981743-45981765 CCAGCCAGAGTGAGAGCGGAGGG - Exonic
1180639980 22:17290673-17290695 ACAGCAACAGTGAGGGTGGAGGG - Intergenic
1181536313 22:23547985-23548007 CCAGCCACAGGGTGGTTGGTGGG - Intergenic
1182368134 22:29792346-29792368 CCAGACATAGGGAGGGGTGAGGG + Intronic
1182550045 22:31096002-31096024 CCAGGAAAAGGGAAGCTGGATGG - Intronic
1183091527 22:35525469-35525491 CCAGGCAGAGGGAGGGCGGGAGG + Intergenic
1183498881 22:38166257-38166279 CCAGCCAAAGGGAGGGTGGAAGG - Intronic
1183678045 22:39310758-39310780 CCAGCCTAAGGGATGGGGAAGGG + Intergenic
1185072413 22:48663724-48663746 CCAGGAAAAGGGAGGGTTCATGG - Intronic
1185158131 22:49206508-49206530 GCAGGCAGAGGGAGGGTGGCTGG - Intergenic
1185190470 22:49433130-49433152 CCAGACAGGGAGAGGGTGGATGG - Intronic
1185297747 22:50062523-50062545 ACAGCAGTAGGGAGGGTGGAGGG + Intronic
1185409959 22:50676727-50676749 GCAGCCACAGGGAGGCAGGAGGG - Intergenic
951464960 3:22991041-22991063 CCAGCCTATGGGAGTGTGGGAGG + Intergenic
953331203 3:42054262-42054284 CCAGCCAAAGGGGGTGCTGAAGG - Intronic
953902009 3:46848859-46848881 ACAGACCAAGGGAAGGTGGAGGG + Intergenic
954107181 3:48415682-48415704 ACAGCCACAGGGAGCGTGGCAGG + Exonic
954607973 3:51928691-51928713 CCATCCAATGGGAGGTTGGAGGG + Intergenic
954958453 3:54542719-54542741 CCACCCAGATGGAGGGTGGTGGG + Intronic
955950711 3:64239586-64239608 CCAGCCACAGGGACAGGGGAGGG + Intronic
956690720 3:71875616-71875638 CCTGCTAAGGGGAGGGAGGAGGG + Intergenic
958891621 3:99790229-99790251 CCAGCCAGAAGGAAGGAGGAAGG + Intronic
959501042 3:107106192-107106214 ACAGCCAAAAAGAGGGTCGAAGG - Intergenic
959665351 3:108914821-108914843 CCAGAGAAATGGAGAGTGGAGGG - Intronic
960115050 3:113885204-113885226 CCCGCCGAAGGGAGGGGGAACGG - Intronic
961506297 3:127372445-127372467 GCAGCCACACGGAGGGTGGAGGG + Intergenic
961573225 3:127815584-127815606 TGAGCCAAAGGGTGGGTGTAGGG - Intronic
961816876 3:129555680-129555702 CCAGGAGCAGGGAGGGTGGAGGG - Exonic
962776357 3:138664170-138664192 TCAGCCAAGGGGAGTGTGGGTGG + Intronic
966362156 3:179141853-179141875 GAAGCCTATGGGAGGGTGGAGGG + Intergenic
968015657 3:195330194-195330216 ACAGCCAATTCGAGGGTGGAAGG - Intronic
968809756 4:2794529-2794551 CCAGGCAAAGGGAGCCTGGCGGG - Intronic
968848612 4:3062402-3062424 CCAGGGGAAGGGAGGGTGCAGGG - Intergenic
969127792 4:4966504-4966526 CCAGACAATAGGAGGGAGGAAGG - Intergenic
969418457 4:7076061-7076083 TCAGTCACAGGGTGGGTGGAGGG - Intergenic
971934320 4:33128127-33128149 CCAGGGAAAGGGTGGGAGGAGGG - Intergenic
973087098 4:46078473-46078495 ACAGAGAAAGGGAGGGTGGCAGG + Intronic
973650696 4:52994457-52994479 CCTGTCAAATAGAGGGTGGACGG + Intronic
974439444 4:61898077-61898099 ACAGGTAAATGGAGGGTGGAGGG - Intronic
975160741 4:71121213-71121235 ACAGCCAAGGGGAGGGGGGAGGG - Intergenic
978955696 4:114609811-114609833 CCATCCAAAGGGAGACTGAAGGG + Intronic
981024976 4:140068883-140068905 CCAGACAAAGCGAGGGTAGTGGG - Intronic
981749148 4:148076759-148076781 CCAGCCTGACTGAGGGTGGATGG - Intergenic
981817496 4:148847635-148847657 CTAGCCAGAGGGAAGGTGGGTGG + Intergenic
983330715 4:166324379-166324401 CTAGCCAAAGGTAGGGAGGAGGG + Intergenic
984177091 4:176432512-176432534 ACAGCCTAAGAGAGGGTTGAAGG - Intergenic
984249056 4:177309942-177309964 CCGGCCACAGAGATGGTGGAAGG + Exonic
984432164 4:179663645-179663667 CCAGGCGACGGGAGGGTGGCTGG - Intergenic
984591536 4:181622799-181622821 CCAGAGAAAGGGAATGTGGAAGG - Intergenic
984863450 4:184260010-184260032 CCAGTCAAGGGGAGAGTGGGGGG + Intergenic
985125798 4:186693348-186693370 CCAGCCACAGGTAGGGAGGTAGG - Intronic
985943024 5:3153723-3153745 CCAGCCAAAGCGAGGAGTGAGGG + Intergenic
989003106 5:36782101-36782123 AAAACCAAAGAGAGGGTGGAGGG + Intergenic
989710354 5:44389544-44389566 CCAGGGAGAGGGAGGGTGAAAGG + Intronic
991277220 5:64863443-64863465 ACAGGGAAAGGGAGGGTGTAGGG - Intronic
992772445 5:80060871-80060893 CCAGCCCAAGGAAGGCTGAAAGG + Intronic
992894635 5:81235471-81235493 TCAGCCAGAGGGCAGGTGGAAGG - Intronic
993152153 5:84174559-84174581 CTAGGCAAATGGAGGATGGATGG + Intronic
994038113 5:95225817-95225839 CAAACAAAAGGGAGGGAGGAAGG - Intronic
995282885 5:110355439-110355461 GCATCCAAAGGGAGCCTGGATGG + Intronic
997606558 5:135179221-135179243 GCAGGCAAAGGGAGAGTGGAGGG + Intronic
998133078 5:139660862-139660884 CCAGCCAGTGGGTGGGTGGGTGG - Intronic
999208522 5:149867914-149867936 ACAGCAAAAGTGAGGGTGGCAGG - Intronic
999515384 5:152296979-152297001 CCAGGCAAAGGGAGACTAGATGG + Intergenic
999568949 5:152897040-152897062 CCAGCCAAAATGAGGCAGGAAGG + Intergenic
1000109530 5:158094627-158094649 CCAGCCTAGGGGAGGGGAGAGGG - Intergenic
1000157238 5:158563856-158563878 CCAGCCACAGGGAGCGTGAGGGG - Intergenic
1002042757 5:176526686-176526708 GCAGCCAAAGGCAGCGTGGGCGG + Exonic
1003080557 6:3017615-3017637 CCTGCCAAAGGGAAGGTGGTGGG + Intronic
1004124125 6:12855638-12855660 CCAGAAGAAGGGAGGGAGGAAGG + Intronic
1005948824 6:30616241-30616263 GCAGGCAAAGAGAGGGTGGAGGG - Intronic
1006271330 6:32969187-32969209 ACAGCCAATGGGAGCGTGGAGGG + Intronic
1006357603 6:33569392-33569414 CCAGGTAAAGGGAGGTTGTATGG + Intergenic
1006438617 6:34039934-34039956 CCAGGCTAAGGGAGGGGGCAGGG + Intronic
1006641136 6:35490391-35490413 CCAGCCGAAGGGAGGGACGGTGG - Intronic
1007076965 6:39074269-39074291 CCAGCCAAGGAAAGGGTGGACGG + Intronic
1007207752 6:40166260-40166282 CCAGCAAGGGGGAGGGTAGAGGG + Intergenic
1007265614 6:40593635-40593657 CCAGGCAAAGGCAAGGTGGCAGG + Intergenic
1007392210 6:41556048-41556070 CCAGTAAAAGGTAAGGTGGAGGG + Intronic
1007697918 6:43745173-43745195 CCAGCCGAAGGGGAGGTAGACGG + Intergenic
1007719041 6:43874576-43874598 CAAGCCCCAGGGAGGGTGGAGGG + Intergenic
1012101955 6:95101197-95101219 CCCTACAAAGGGAGGGGGGAGGG - Intergenic
1013722818 6:113051274-113051296 CCTGACAAAGAGAGGGTTGATGG + Intergenic
1016990806 6:149926316-149926338 CCAAACACAGTGAGGGTGGAGGG - Intergenic
1017007538 6:150038457-150038479 CCAAACACAGTGAGGGTGGAGGG - Intergenic
1017206924 6:151812856-151812878 CCAGCCAAAGCGAAAGTGTAAGG + Intronic
1018726466 6:166616650-166616672 CCTGGCAGAGGGAGGATGGATGG - Intronic
1018785151 6:167102524-167102546 CCACCCAAAGGGAGGGAGTGGGG + Intergenic
1019309463 7:353166-353188 CCTGCAAAAGGGTGGGTGAATGG - Intergenic
1019737176 7:2656347-2656369 CCAGAGACAGGGAGGGTGGAGGG - Intronic
1020086028 7:5311263-5311285 ACAGCCACAGGCAGGCTGGAAGG + Intronic
1020253380 7:6486852-6486874 CCAGACACAGGAAGGTTGGAAGG + Intergenic
1020255493 7:6500889-6500911 CCAGCCAAAGGCAGTCAGGAGGG - Intronic
1022163569 7:27736043-27736065 ACAGCCACAGGGAGGGAAGACGG + Intergenic
1022467962 7:30663960-30663982 CCAGCCACAGGGACTGTGCAGGG - Intronic
1022476699 7:30715768-30715790 CCAGCAACAGGACGGGTGGAGGG + Intronic
1023360910 7:39414433-39414455 CCAGGCAGAGGGAGAGTGGAGGG + Intronic
1023955523 7:44884358-44884380 CTAGCCAAGGGGATGGTGGTTGG + Exonic
1025663674 7:63571069-63571091 ACAGCCACAGGTAGGCTGGAAGG + Intergenic
1027108862 7:75421945-75421967 ACCGCCAAAGGTAGGCTGGATGG + Exonic
1027423394 7:78039156-78039178 CCAGTCAAAGAGAGAGAGGAAGG - Intronic
1028016349 7:85719008-85719030 TTAGCCAAGGAGAGGGTGGAAGG + Intergenic
1029947776 7:104551482-104551504 GCAGCCAAGGGAGGGGTGGAAGG - Intronic
1031982255 7:128135675-128135697 CGGGCCAAAAGGAGGATGGAGGG + Intergenic
1032182467 7:129692093-129692115 CCTGCCACCGGGAGGGTGGCAGG - Intronic
1032800494 7:135313801-135313823 CGAGCCAAAGGTAGACTGGAGGG + Intergenic
1033471613 7:141654980-141655002 CCACCCACAGGTAGGGAGGAAGG + Exonic
1034329316 7:150269147-150269169 CCTGCCAGAGCGAGAGTGGAGGG + Intronic
1034668738 7:152840713-152840735 CCTGCCAGAGCGAGAGTGGAGGG - Intronic
1034992595 7:155557665-155557687 CCGGCCTAAGGGAGGGCGGCCGG + Intergenic
1035272222 7:157727203-157727225 GCAGCCAAAGGGTGGATGCAAGG + Intronic
1035619064 8:1024161-1024183 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1035619098 8:1024271-1024293 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1035619118 8:1024326-1024348 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1035619138 8:1024381-1024403 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1035619158 8:1024436-1024458 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1035957685 8:4100377-4100399 CTAGACACAGGGAAGGTGGAAGG - Intronic
1036401393 8:8411964-8411986 CCAGCAAAAGGGGAGGTGGAGGG + Intergenic
1036474491 8:9080798-9080820 TCAGCTAAATGGGGGGTGGAGGG + Intronic
1037754256 8:21701029-21701051 CAAGCCAAAGGCAGGGGCGAGGG + Intronic
1038013540 8:23494098-23494120 CCAGCAGCAGGGAGGGTGGGTGG - Intergenic
1038336164 8:26647370-26647392 CCAGGGTTAGGGAGGGTGGAGGG - Intronic
1038596376 8:28890246-28890268 CCTCCCAAAGGGAAGGCGGATGG + Intergenic
1038895117 8:31774116-31774138 CCAGCAAAGGGGAGAGTGGCAGG - Intronic
1039469952 8:37807175-37807197 CCAGCCCAGGGAAGGGTGGCAGG + Intronic
1039838232 8:41274903-41274925 CCAGCTGAATGGAGGGTGAAGGG - Intronic
1039847722 8:41337553-41337575 CAGGCCAAAGGGAGGGTAGGAGG - Intergenic
1043254892 8:78122726-78122748 CTAGCCTAAGGGAAGGTGGTAGG - Intergenic
1045426786 8:102075008-102075030 CCAGGCAAAAGGAAGGAGGAAGG + Intronic
1045506268 8:102780960-102780982 ACAGCCTCAGGGAGGGTGGGAGG + Intergenic
1046446301 8:114324938-114324960 CCTGCCAGAGGGTGGGGGGAAGG + Intergenic
1047208155 8:122819911-122819933 CCAGCCAAGGCGAGGGTGTGGGG - Intronic
1047698117 8:127423391-127423413 CCAGGGAAGTGGAGGGTGGAAGG + Intergenic
1047710387 8:127545908-127545930 CCAGCCAAAGAGTTGGAGGAGGG + Intergenic
1051554527 9:18367804-18367826 CCAGGCAACGGATGGGTGGATGG + Intergenic
1052468057 9:28855251-28855273 CAATGCAAAGGAAGGGTGGAAGG + Intergenic
1053407552 9:37890579-37890601 CCAGCTACTGGGAAGGTGGAGGG + Intronic
1056575897 9:87856065-87856087 CCATCTGAAGGGAGGCTGGAAGG + Intergenic
1057236538 9:93366076-93366098 GCAGCCATGGGGAGGCTGGAGGG + Intergenic
1057249497 9:93488844-93488866 TCAGCAAAAGGGAGGGTCCATGG - Intronic
1057280058 9:93702528-93702550 CCAGCCAAGCGGTGGGTGGCTGG + Intergenic
1057903884 9:98969630-98969652 CCAGCCATAGGGAGGGAGTCAGG + Intronic
1058961166 9:109994104-109994126 GCAGCTAAGGGGAGGGAGGACGG + Intronic
1059443643 9:114324948-114324970 CCAGCCCAGGGGTGGGTGAATGG - Intronic
1059444843 9:114331725-114331747 CCAGCCCAGGGGTGGGTGAATGG - Intronic
1060826663 9:126691801-126691823 CCAGCCGAAGGGAGGGGGCTGGG + Intronic
1061423842 9:130486997-130487019 CCAGCCAACTGGAGGGGGAATGG - Intronic
1061542008 9:131282709-131282731 CCGGCCAGAGGGGGAGTGGAGGG - Intergenic
1061901403 9:133674043-133674065 CCTGCCAAAGAGAGGGAGGCTGG + Intronic
1061913454 9:133737265-133737287 CCATCCCAAGGGAGGGAGCAGGG + Intronic
1062131348 9:134895294-134895316 GCAGCCACATGGTGGGTGGAGGG + Intergenic
1062137413 9:134936982-134937004 CCAGCCTCATGGAGGGTGGCAGG + Intergenic
1186338255 X:8615600-8615622 CCAGACAAAGGGATGGAGGCTGG - Intronic
1187378977 X:18783130-18783152 GAAGGCAGAGGGAGGGTGGAGGG + Intronic
1188163136 X:26827101-26827123 CCAGCAGAACTGAGGGTGGAGGG - Intergenic
1190116756 X:47630356-47630378 CGAGGTTAAGGGAGGGTGGAAGG - Intergenic
1192998084 X:76533621-76533643 CCAGCCAAAGGAAGTGATGAGGG - Intergenic
1193150438 X:78118886-78118908 TCAGCCAAATTGAGGGTGGGAGG - Intronic
1195318780 X:103704333-103704355 CAAACCAAAGGGAAGATGGAGGG + Intergenic
1196737086 X:118989483-118989505 CCAGCTAAAGTGAAGGGGGATGG + Exonic
1197089602 X:122521151-122521173 CCAGGCAGAGGGATGCTGGAGGG - Intergenic
1198543577 X:137667967-137667989 CCAGCCAAAGGGAATGTGAAAGG - Intergenic
1200115455 X:153767931-153767953 CCATCCACAGAGAGGGGGGATGG - Intronic
1200234705 X:154462664-154462686 CCAGGCATAGGGAGGCTTGAGGG - Intronic
1200989903 Y:9337404-9337426 CCAGTCAATGGGAGGGCGGTGGG - Intergenic
1200992572 Y:9357737-9357759 CCAGTCAATGGGAGGGCGGTGGG - Intergenic
1200995225 Y:9378016-9378038 CCAGTCAATGGGAGGGCGGTGGG - Intronic
1200997889 Y:9398361-9398383 CCAGTCAATGGGAGGGCGGTGGG - Intergenic
1201003060 Y:9487207-9487229 CCAGTCAATGGGAGGGCGGTGGG - Intronic
1201005719 Y:9507490-9507512 CCAGTCAATGGGAGGGCGGTGGG - Intergenic
1201008379 Y:9527820-9527842 CCAGTCAATGGGAGGGCGGTGGG - Intergenic