ID: 1183499582

View in Genome Browser
Species Human (GRCh38)
Location 22:38170474-38170496
Sequence GACTCAGGAGCAGCAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183499579_1183499582 -2 Left 1183499579 22:38170453-38170475 CCTGCAGAAGATGCCATTCGAGA 0: 1
1: 0
2: 0
3: 6
4: 134
Right 1183499582 22:38170474-38170496 GACTCAGGAGCAGCAGTGTCTGG No data
1183499575_1183499582 25 Left 1183499575 22:38170426-38170448 CCTTCTGCAGGGGCAGGTGGGGG 0: 1
1: 0
2: 5
3: 62
4: 493
Right 1183499582 22:38170474-38170496 GACTCAGGAGCAGCAGTGTCTGG No data
1183499578_1183499582 -1 Left 1183499578 22:38170452-38170474 CCCTGCAGAAGATGCCATTCGAG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1183499582 22:38170474-38170496 GACTCAGGAGCAGCAGTGTCTGG No data
1183499577_1183499582 0 Left 1183499577 22:38170451-38170473 CCCCTGCAGAAGATGCCATTCGA 0: 1
1: 0
2: 1
3: 5
4: 129
Right 1183499582 22:38170474-38170496 GACTCAGGAGCAGCAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183499582 Original CRISPR GACTCAGGAGCAGCAGTGTC TGG Intronic
No off target data available for this crispr