ID: 1183503773

View in Genome Browser
Species Human (GRCh38)
Location 22:38197058-38197080
Sequence TTTGGGGACCCCTGCTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 837
Summary {0: 1, 1: 5, 2: 64, 3: 206, 4: 561}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183503763_1183503773 29 Left 1183503763 22:38197006-38197028 CCGCTGGTTCCTAACAGGCCACG 0: 2
1: 1
2: 2
3: 3
4: 97
Right 1183503773 22:38197058-38197080 TTTGGGGACCCCTGCTGTAGAGG 0: 1
1: 5
2: 64
3: 206
4: 561
1183503762_1183503773 30 Left 1183503762 22:38197005-38197027 CCCGCTGGTTCCTAACAGGCCAC 0: 2
1: 10
2: 22
3: 45
4: 148
Right 1183503773 22:38197058-38197080 TTTGGGGACCCCTGCTGTAGAGG 0: 1
1: 5
2: 64
3: 206
4: 561
1183503771_1183503773 -10 Left 1183503771 22:38197045-38197067 CCTCAGCCTGCGATTTGGGGACC No data
Right 1183503773 22:38197058-38197080 TTTGGGGACCCCTGCTGTAGAGG 0: 1
1: 5
2: 64
3: 206
4: 561
1183503765_1183503773 20 Left 1183503765 22:38197015-38197037 CCTAACAGGCCACGGACAAACAG 0: 1
1: 0
2: 4
3: 48
4: 319
Right 1183503773 22:38197058-38197080 TTTGGGGACCCCTGCTGTAGAGG 0: 1
1: 5
2: 64
3: 206
4: 561
1183503767_1183503773 11 Left 1183503767 22:38197024-38197046 CCACGGACAAACAGTACTGGTCC 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1183503773 22:38197058-38197080 TTTGGGGACCCCTGCTGTAGAGG 0: 1
1: 5
2: 64
3: 206
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183503773 Original CRISPR TTTGGGGACCCCTGCTGTAG AGG Intronic
900196114 1:1376389-1376411 TCTGGGGACCTCAGTTGTAGAGG - Intergenic
901467700 1:9433248-9433270 GTTTGGGACCCCTGCTGTAATGG + Intergenic
901579018 1:10225164-10225186 GTTGAGGACCCCTCTTGTAGAGG + Intronic
901581478 1:10247765-10247787 GTTGGGGACCACTGCTGTAGAGG - Intronic
901924526 1:12557558-12557580 GTTGGGGACCACTGCCTTAGGGG + Intergenic
902104242 1:14020307-14020329 TTTGGGGACCCCTGCTCTATAGG + Intergenic
902365247 1:15968912-15968934 GTTGGGAACCCCTGGTATAGTGG - Intronic
903043445 1:20549306-20549328 GTTGGGGACCGCTGCTCTATAGG + Intergenic
903565066 1:24259054-24259076 TTTTGGGTCCACTGCTGTATTGG - Intergenic
903619993 1:24691091-24691113 GTTGGGGACTGCTGCTCTAGAGG + Intergenic
904353110 1:29921819-29921841 TTTGGGGGCCCCTGCACTAAAGG + Intergenic
905082930 1:35340836-35340858 TTTGGGTACCCCTGCTATAAAGG + Intronic
905123483 1:35700864-35700886 GTTGGGGACCCCTGTTGTAAAGG - Intergenic
905784570 1:40743998-40744020 GTTGGGGACCCCTGCTCTAGTGG - Intronic
906761239 1:48381213-48381235 GTTGGGGACTCCTGCTATACAGG + Intronic
906825593 1:48976184-48976206 TTTGGGAACCCCCTCTGCAGTGG - Intronic
907241667 1:53084416-53084438 TGTGGGGAGCCCTGCTGGAGGGG - Intronic
907340112 1:53729148-53729170 TTTGGATACCCCTGCTGTCAGGG + Intronic
907341480 1:53738951-53738973 TTTGGGGGCCCCTGATGGAAGGG - Intergenic
907481157 1:54746385-54746407 GTTGGGGACCGCTGCTCTATAGG + Intergenic
907828005 1:58037350-58037372 GTTGGGGACCCCTGCCGTAAGGG - Intronic
908250320 1:62260632-62260654 TTTGGAGACAGCTGCTTTAGGGG - Intronic
908328656 1:63048792-63048814 GTTGGGGACCCCTGCTCTATAGG + Intergenic
908664358 1:66473700-66473722 GTTGGGGACCACTGCGTTAGAGG - Intergenic
909020073 1:70420626-70420648 GTTGGGGACCCCTGCTTTAAAGG + Intronic
909330690 1:74406422-74406444 ATTGGGCACCCCTGCTCTAGAGG + Intronic
909447786 1:75766906-75766928 GTTGGGGACCCCTGCCCTATAGG - Intronic
910322857 1:85968298-85968320 GTTGGGGACCCCTGCTATATTGG + Intronic
910542850 1:88380719-88380741 TTTGGGGACCACTGGTCTAGTGG - Intergenic
911150660 1:94594463-94594485 GTTGGGGACCACTGCCTTAGAGG + Intergenic
912062081 1:105686419-105686441 TTTGGGGAGCTCAGATGTAGGGG - Intergenic
912063947 1:105712223-105712245 GTTGGGGACCCCTGGTTTAGAGG - Intergenic
912869248 1:113288894-113288916 TTTGCAGATCCCTGCTCTAGTGG - Intergenic
913094144 1:115500378-115500400 GTTGGGGACCCCTGGATTAGTGG + Intergenic
913670602 1:121094441-121094463 GTTGGGGACCACTGGTATAGAGG + Intronic
914022368 1:143881880-143881902 GTTGGGGACCACTGGTATAGAGG + Intergenic
914335769 1:146713923-146713945 GTTGAGAACCCCTGCTGTAAAGG - Intergenic
914660851 1:149789821-149789843 GTTGGGGACCACTGGTATAGAGG + Intronic
914767344 1:150650434-150650456 GTTGGGGACACCTGCTATACTGG - Intronic
914960719 1:152204106-152204128 GTTGGGGACCCCTGCTGTAAGGG + Intergenic
915912417 1:159923237-159923259 TTTGGGGTCCCCAGCTCTGGGGG - Intronic
916406011 1:164498879-164498901 CTTGGGTGCCCCTGCTCTAGAGG + Intergenic
916479535 1:165202461-165202483 TTTGGGGCCCCTTGTTTTAGAGG - Exonic
917348128 1:174049929-174049951 GTTGGGGACCCCTGGTCTAGTGG - Intergenic
919969775 1:202567637-202567659 GCTGGGGATCCCTGCTATAGGGG + Intronic
920332645 1:205221504-205221526 TTTGAGAACCACTGATGTAGGGG - Intergenic
920960954 1:210663674-210663696 TTTGGGAACTACTGTTGTAGGGG - Intronic
920997005 1:211002963-211002985 TTGGCTGACCCCTGGTGTAGTGG - Intronic
921031885 1:211341225-211341247 TTTGGGGAACCCTGCAGGAGTGG + Intronic
921488214 1:215741036-215741058 GTTAGGAACCCCTGCTTTAGAGG + Intronic
921589865 1:216990915-216990937 GTTGGGGACCCCTGCTTTATAGG - Intronic
921731820 1:218587234-218587256 TGTTGGGACCCCTGCCTTAGGGG + Intergenic
921856905 1:219996388-219996410 TTTGAGAACTCCTGGTGTAGAGG - Intronic
922029268 1:221782198-221782220 TTTGGGGACACCTTCTCTGGTGG + Intergenic
922085016 1:222338186-222338208 GTTGGGGACCCCTGCTCTAGAGG + Intergenic
922607899 1:226902365-226902387 GTTGGGGACCCCTGATTTAGAGG + Intronic
922865307 1:228855743-228855765 GTTGGGGACCCCTGATCTACAGG - Intergenic
923116747 1:230947453-230947475 ATTGGACACCCCTGCTCTAGAGG - Intronic
923191250 1:231622884-231622906 GTTGGGACCCCCTTCTGTAGTGG - Intronic
923491160 1:234485441-234485463 GTTAGGGACCCCTGGTGTAAGGG - Intergenic
923534629 1:234839700-234839722 TTTGGGGACCCCTGAGATAGGGG - Intergenic
924506855 1:244694190-244694212 TTTGCTAATCCCTGCTGTAGAGG - Intronic
1064178459 10:13095691-13095713 TTTGGGGACCCCTGCTTTATTGG + Intronic
1064449913 10:15432371-15432393 GTTGGGGACCGCTGCTGCAGAGG + Intergenic
1064720180 10:18220922-18220944 TTTGGGGACCACTAATGTAGAGG + Intronic
1065408830 10:25398884-25398906 GTTGGGGACCCCTGCTTTACTGG - Intronic
1065484944 10:26228515-26228537 GTTGGGGACCCCTGTTATAAAGG - Intronic
1066503575 10:36019136-36019158 GTTTGGGACCCCTGTTGTAGAGG - Intergenic
1067092070 10:43272276-43272298 TGGGGGGACTCCTGCTGTAGAGG + Intergenic
1067199626 10:44156037-44156059 CCTGGGGACCCCTGCTCTACTGG + Intergenic
1067265172 10:44735537-44735559 GCTGGGGACCCCAACTGTAGTGG + Intergenic
1067721908 10:48733752-48733774 ATGGAGAACCCCTGCTGTAGGGG + Intronic
1068025016 10:51631903-51631925 ATAGAGGACCCCTGCTGTAAAGG + Intronic
1068602462 10:58970087-58970109 ACTGGGGACCGCTGCTCTAGAGG - Intergenic
1069120173 10:64560068-64560090 TTTGAGGACCACTGCTTTGGAGG - Intergenic
1070842685 10:79498546-79498568 TGTGGGGACCCCTGCTGTAAAGG - Intergenic
1071262503 10:83933530-83933552 TTTGCTGACCCCTGCTATACAGG - Intergenic
1071829354 10:89356323-89356345 ATTGGGGACACCTGCTTTAAAGG - Intronic
1072256931 10:93629934-93629956 ATTGGGGACCCCTGATCTAAGGG + Intronic
1072424519 10:95318741-95318763 GTTGGGGACCACTGCTTTAAAGG - Intronic
1072812997 10:98478058-98478080 GTTGGGGACCACTGCCCTAGAGG + Intronic
1073659926 10:105463641-105463663 GTTGGGGACCACTGGTGTAGAGG - Intergenic
1074220866 10:111436484-111436506 CTGGGGGACCCCTGATTTAGGGG + Intergenic
1074294316 10:112169676-112169698 GTTTGGGACCACTGCTGTAGAGG - Intronic
1074320357 10:112396300-112396322 TTTGCCAACCCCTGCTGCAGAGG - Intronic
1074744060 10:116513753-116513775 GTTGGGGACCCCTGCCATAAAGG + Intergenic
1075007005 10:118838385-118838407 TTTGTTGATCCCTGCTTTAGGGG + Intergenic
1075236466 10:120735434-120735456 GTTGGGGACCCCTGATCTATAGG - Intergenic
1075734625 10:124656333-124656355 TCCAGGGAGCCCTGCTGTAGTGG + Intronic
1075917625 10:126182868-126182890 GTTTGGGACCCCTGTTCTAGTGG - Intronic
1076057391 10:127386827-127386849 GTTGGGGACCGCTGCTGTAGTGG + Intronic
1076450428 10:130553547-130553569 GTTGGGGACCTCTGCTCTAGGGG - Intergenic
1076977322 11:184165-184187 TTTGGTGTCCCCTGGTGGAGAGG - Intronic
1077559008 11:3245398-3245420 TTTGGGGACCCCTATTTTAAAGG - Intergenic
1077946351 11:6904330-6904352 ACTGGGGACCCCTGCGTTAGAGG + Intergenic
1078114335 11:8430389-8430411 ATTGGAAACCCCTGCTTTAGGGG - Intronic
1078380549 11:10836134-10836156 GTTGGGGACCGCTGCTCTAAAGG + Intronic
1078396587 11:10987123-10987145 GTTGGGGACCCCTGCTCTACAGG - Intergenic
1078396640 11:10987457-10987479 GTTGGGGACTGCTGCTGTAGAGG + Intergenic
1079569926 11:21930348-21930370 GTTGGGGGCCCCTGCTGTAGTGG - Intergenic
1079972743 11:27056626-27056648 TTTGGGGATCCCAGGTTTAGAGG + Intronic
1080190325 11:29537675-29537697 ATTGGATACCCCTGCTTTAGAGG + Intergenic
1080884495 11:36353862-36353884 GTTGGGGACCCCTGCTCCAGAGG + Intronic
1081816884 11:45950409-45950431 CTTGGACACCCCTGCTGTAGAGG - Intronic
1082841472 11:57693461-57693483 GTTGGGGACCCCTGCTTTAGTGG + Intronic
1083149685 11:60784023-60784045 GTTGGGGACCCCTGTTGTGGGGG - Intergenic
1083203441 11:61133433-61133455 TTTGGTGGACCCTGCTGTGGTGG - Intronic
1083273620 11:61584877-61584899 TTTGGGCCCCCCTTCTGTAGGGG - Intergenic
1083551888 11:63596345-63596367 GTTGGGGACCGCTGCTGTAGAGG - Intronic
1084794586 11:71496596-71496618 GTTGGTGACCCCTGCTCTAGGGG + Intronic
1084956832 11:72696084-72696106 GTTGGGGACCACTGTTGTAGAGG - Intronic
1084967956 11:72754107-72754129 GTTGGGGACCTCTGCTCTAAGGG - Intronic
1085241900 11:75063780-75063802 TTTGAGAACCCCTGGTGTAGAGG + Intergenic
1085465667 11:76721746-76721768 TCTGGGGACCCGTACTGTGGGGG + Intergenic
1085654066 11:78296248-78296270 GCTGGGGACCCCTGCTCTAGGGG + Intronic
1087283213 11:96235431-96235453 TTTGCTGACCCCTGATCTAGAGG + Intronic
1087714053 11:101586657-101586679 GTTGGGGACCACTGTTCTAGAGG - Intronic
1088327254 11:108613661-108613683 GTTGGGAACCCCTGCTTTAAAGG - Intergenic
1088373516 11:109116624-109116646 ATTGGACACCCCTGATGTAGAGG - Intergenic
1088776776 11:113092874-113092896 TTTGGGAACCACTGCTGTGAAGG - Intronic
1089215448 11:116832013-116832035 GTTGGGGACCCCTGGGCTAGGGG + Intronic
1089344839 11:117784586-117784608 TGGGGAAACCCCTGCTGTAGAGG - Intronic
1089707395 11:120289568-120289590 ATTTGGGACTGCTGCTGTAGGGG - Intronic
1090091735 11:123703993-123704015 TTTGGACACCCCTGTTCTAGGGG - Intergenic
1090691611 11:129188592-129188614 GTTGGGAACCCCTGAGGTAGAGG + Intronic
1090785349 11:130043418-130043440 TTTGGGAAACTCTGCTCTAGGGG + Intergenic
1091212244 11:133872012-133872034 GTTGGGGACCACTGCTGTAGAGG + Intergenic
1091400084 12:176155-176177 CTTGGGCACCCCTGCTGGAAGGG - Exonic
1091574504 12:1720760-1720782 GTTGGGGACCCCTGCTGTATAGG + Intronic
1092094886 12:5833529-5833551 ATTGGGGACCCCTGTTCTAAAGG - Intronic
1092194894 12:6543256-6543278 TTTGGGGACTTCTGCATTAGGGG - Intronic
1092590234 12:9946553-9946575 GTTGGGGACTGCTGCTCTAGGGG + Intergenic
1093165785 12:15803519-15803541 GTTGGGGACCTCTGGTATAGGGG - Intronic
1093168214 12:15829553-15829575 CTTGGGGACCCCTGATATAGGGG + Intronic
1093331152 12:17841769-17841791 GTTGGGGACCCCTGCTGTAAAGG + Intergenic
1093832235 12:23776560-23776582 GTTGGGGACCACTGCTCTAAGGG - Intronic
1094167458 12:27457100-27457122 GTTGGGGACCACTGGTCTAGAGG + Intergenic
1095145941 12:38726132-38726154 GTTGGGGACCCCTGGTCTACAGG + Intronic
1095393961 12:41741977-41741999 GTTGGGGACCACTGCACTAGAGG - Intergenic
1095523474 12:43096220-43096242 TCTGGAGACCCCTCCTGTGGGGG + Intergenic
1095656192 12:44672178-44672200 GTTGGGGACCCCTGTTCTATGGG - Intronic
1096431242 12:51545048-51545070 GCTGGGGACCCCTGCTGTAGAGG - Intergenic
1097646479 12:62240700-62240722 GTTGGGAACCCCTGCTTTATTGG - Intronic
1097729035 12:63106769-63106791 GTTGGGGACCCCTGTTGTAAGGG + Intergenic
1097748287 12:63324073-63324095 TTTGGGAACCACTGTTATAGAGG - Intergenic
1099222276 12:79929328-79929350 TTTGTGAACCCCCGCTCTAGAGG + Intronic
1099270079 12:80497534-80497556 ATTGGGGACCCCTGTTATAGAGG + Intronic
1099320124 12:81136456-81136478 TTTGCAGACCCCTGATTTAGAGG + Intronic
1099348898 12:81539625-81539647 TTTAAGAACCACTGCTGTAGAGG + Intronic
1100364182 12:93904205-93904227 TTTGAGAACCACTGCTGCAGGGG - Intergenic
1100401639 12:94235589-94235611 TTTGCCGACCTCTGCTCTAGAGG - Intronic
1100416876 12:94387177-94387199 TTTGGGGACCCTTGCTTTAGAGG - Intronic
1100547838 12:95620241-95620263 GCTGGGGACCCCTGCTTTACAGG + Intergenic
1101649384 12:106660981-106661003 GTTGGGGACTGCTGCAGTAGAGG + Intronic
1101955966 12:109212756-109212778 TTTGGGGACCCTTTCTTTAGGGG + Intronic
1102172657 12:110853796-110853818 TTTGGGGACCCCTGGTGGGCAGG + Intronic
1102329161 12:112014163-112014185 GTTGGGGACCCCTGCTTTACAGG - Intronic
1102391102 12:112549324-112549346 GTTGGGGACCCCTGTCTTAGAGG + Intergenic
1102827600 12:115962481-115962503 GTTGGGGACCCCTGCTCTAGGGG + Intronic
1102988579 12:117298453-117298475 TTTGGGGACCCCTGTATTATGGG + Intronic
1103542203 12:121673893-121673915 TTGGGGGACTCCTGCTGCGGGGG + Intergenic
1104432941 12:128731611-128731633 TTTGGGGATCCCTTTTGTACAGG + Intergenic
1105200685 13:18172264-18172286 GTTGGGGACCCCTGCTATAGAGG + Intergenic
1105500890 13:20970780-20970802 GTTGGGGACCCCTGCTTTAATGG + Intergenic
1105707345 13:22976624-22976646 TGTGGGGGCCCCTGCTTTGGAGG + Intergenic
1106195915 13:27493722-27493744 TTTGGGGGGCCCTGCTCTAAAGG - Intergenic
1106279896 13:28257423-28257445 ATTGAGGACCCCTGTTTTAGTGG - Intronic
1106975337 13:35204638-35204660 TTTGGGGACCACTGGAGTAGAGG + Intronic
1107340327 13:39398636-39398658 GATGGGGACCCCTGTTTTAGAGG - Intronic
1107603165 13:42033622-42033644 ATTGGGGACCGCTGCCCTAGCGG + Intergenic
1108174637 13:47779548-47779570 TTTGGGGACCACTGCTTTAGAGG - Intergenic
1108314518 13:49224307-49224329 TTTGGGGAGCACTGATGTAGGGG + Intergenic
1108427591 13:50319425-50319447 GTTGGGGATCACTGTTGTAGAGG + Intronic
1108534231 13:51356970-51356992 TTTGCTGACCCCTGCTTTAGAGG - Intronic
1108608165 13:52061056-52061078 GTTGGGGACCACTGCTTTAAGGG - Intronic
1108704534 13:52973360-52973382 TCTGGGGACCCTTGCTGAATTGG + Intergenic
1109176664 13:59166306-59166328 GTTGGGGACCCCTGCCCTAAAGG - Intergenic
1109654197 13:65368048-65368070 CTTGGGGACCTCTGCATTAGTGG + Intergenic
1110247455 13:73342595-73342617 ATTGGGAACCCCTGCCATAGAGG - Intergenic
1110247509 13:73342929-73342951 GTTGGGGAACGCTGCTCTAGAGG + Intergenic
1110274430 13:73627872-73627894 GTTGGGGACTGCTGCTTTAGAGG - Intergenic
1110743586 13:79026499-79026521 TTTAGGGACCCCTGCTATAATGG + Intergenic
1111454618 13:88464927-88464949 GTTGGGGACCCCTGCTATAAAGG - Intergenic
1111813500 13:93121025-93121047 TTTTGGAACCTCTGCTGTAAGGG - Intergenic
1111924393 13:94447188-94447210 GTTGGGGACCGGTGGTGTAGAGG - Intronic
1112298704 13:98211170-98211192 TCTGGGGACCCCTCCTTTAGAGG - Intronic
1112514993 13:100045597-100045619 GTTGGGGACCTCTGCTATAAAGG + Intergenic
1112767701 13:102763308-102763330 GTTGGGGACCCCTGTCTTAGGGG - Intergenic
1112902689 13:104378289-104378311 CTTGGGGACCCCTGGTTTAATGG - Intergenic
1113126261 13:106982756-106982778 GTTGAGGACCCCTGTTTTAGAGG - Intergenic
1113360069 13:109622632-109622654 GTTGGGGACCCCTGTTGTAAAGG - Intergenic
1113757447 13:112823003-112823025 CTCAGGGACCCCTGCTCTAGAGG + Intronic
1114233337 14:20803095-20803117 TTTGGGCACCAGTGCTGTAGTGG - Exonic
1114818231 14:25985523-25985545 GTTGGGGGCCACTGCTGTAAAGG - Intergenic
1115035668 14:28853662-28853684 TTTGGGGACCACTGATCTACTGG + Intergenic
1115787565 14:36843187-36843209 TTTGGGGACCCCTGAGTGAGGGG + Intronic
1115911010 14:38256110-38256132 GTTGGGGAAGCCAGCTGTAGAGG - Exonic
1115955745 14:38777284-38777306 GTTGGGGACCACTGATCTAGGGG - Intergenic
1116099195 14:40410534-40410556 TTAGGGGCCCCATGCTTTAGAGG - Intergenic
1116111522 14:40591492-40591514 GTTGGGGACCCCTGTTTTAAGGG - Intergenic
1116167141 14:41349290-41349312 TTTGGGGATGCCAGCTGCAGCGG + Intergenic
1116388289 14:44359619-44359641 ATTGGGGACCCCTGCCTTAAAGG + Intergenic
1116400890 14:44505631-44505653 TATGGAGACCCCTGCAGAAGAGG - Exonic
1116574544 14:46556250-46556272 GTTGGGGACCCCTGCTCTTAAGG + Intergenic
1116823944 14:49652905-49652927 GTTGGGGACCACTGTGGTAGAGG + Intronic
1116933892 14:50717587-50717609 TTTGGGGGCCACTGCTATAAAGG - Intergenic
1116982461 14:51186151-51186173 GTTGGGGACCCCTGCATTATAGG - Intergenic
1116982528 14:51186678-51186700 GTTGGGGACCACTGCTGTGATGG + Intergenic
1117394752 14:55298307-55298329 ATTGGACACCCCTGGTGTAGTGG + Intronic
1117404825 14:55391986-55392008 GTTGGGGACCACTGCTTTAGGGG - Intronic
1117559179 14:56918203-56918225 TTTGGGGACCCCTGATCTAGAGG + Intergenic
1118762398 14:68888582-68888604 GGTGGGGACCCCTGGTGTAGGGG - Intronic
1118887840 14:69881113-69881135 TTTGGGAATGCCTGCTGTCGAGG - Intronic
1119194208 14:72705046-72705068 GTTGGGGACCCCTGGCTTAGAGG - Intronic
1119576682 14:75729730-75729752 TTTGGGCACCCTCTCTGTAGAGG + Intronic
1120017097 14:79486478-79486500 CTTGGAGACCACTGCTGTGGTGG + Intronic
1120985607 14:90331964-90331986 TCTGAGGACCCCTGCCGTCGCGG + Exonic
1121099229 14:91238620-91238642 TTTGGGGACACGAGCTGCAGTGG - Intronic
1122086391 14:99309612-99309634 GTTGGGGACCACTGCTTTACAGG - Intergenic
1122190217 14:100036302-100036324 GTTGGGGACCGCTGCTCTATGGG + Intronic
1122372410 14:101235902-101235924 TTTGAGGATCCCCTCTGTAGGGG - Intergenic
1122884435 14:104704396-104704418 GTTGGGGACCCTTGTTCTAGTGG - Intronic
1123208378 14:106735877-106735899 GTTGGGGACCACTGGTGTAGAGG - Intergenic
1123481681 15:20638336-20638358 GTTGGGGACCACTGGTGTAGAGG - Intergenic
1123636332 15:22362029-22362051 GTTGGGGACCACTGGTGTAGAGG + Intergenic
1123965543 15:25453363-25453385 GTTGGGGACCCCTGCTTTACAGG - Intergenic
1123965606 15:25453857-25453879 TTTAGGGACTGCTGCTGTAAAGG + Intergenic
1124386266 15:29210356-29210378 CTTGGGGACCCCTGATCTAGGGG - Intronic
1125756032 15:42065602-42065624 TTTGGTGACCTCTGCTGCAGAGG - Intergenic
1125993376 15:44132329-44132351 TTGGGGGACCTCTGATGTAATGG + Intronic
1126344392 15:47677187-47677209 GTTGGGGACCCCTGTTGTAAAGG + Intronic
1126354497 15:47780915-47780937 TTTTGAGACCCCTGCTGCACTGG + Intergenic
1126489868 15:49225278-49225300 ATTGGGGAACCCTGCTCTACAGG - Intronic
1126489922 15:49225610-49225632 GTTGGGGACTGCTGCTGTAGAGG + Intronic
1126608164 15:50502064-50502086 TTTGCTGACCTCTGCTGTAGAGG + Exonic
1126721163 15:51581377-51581399 GTTGGAGACCGCTGCTCTAGAGG + Intronic
1127063600 15:55213981-55214003 GTTGGGGACCACTGATTTAGAGG + Intronic
1127166280 15:56246787-56246809 TTTGAGGAACACTGATGTAGTGG + Intronic
1127254960 15:57281972-57281994 GTTGGGGACCACTGCTTTAGAGG + Intronic
1127477384 15:59347399-59347421 GTTGGGGACTGCTGCTCTAGAGG + Intronic
1127565846 15:60187350-60187372 TTTGGGGACTGCTGCTATAAGGG + Intergenic
1127901105 15:63341592-63341614 GTTGGGGACCACTGATCTAGAGG + Intronic
1128042421 15:64586711-64586733 GTTGGGGACCACTGCTTTATAGG + Intronic
1128086299 15:64888928-64888950 GTTGGGGATCACTGCTCTAGGGG - Intronic
1128086353 15:64889203-64889225 TTTGGGAACCCCTGCCCTAGAGG + Intronic
1128383305 15:67129109-67129131 GTTGGGGACGCCTGGTGTAGAGG - Intronic
1129007327 15:72384832-72384854 GCTGGGGACCCCTGATGTAGAGG - Intergenic
1129813229 15:78528104-78528126 TTTGGGGACTCCTGTACTAGAGG - Intronic
1129886101 15:79038153-79038175 ATTGGGGACCCCTGATATATAGG + Intronic
1131030094 15:89179216-89179238 AGTTGGGACCCCTGCTGTAAGGG - Intronic
1131999163 15:98162465-98162487 TTTGGGGAGCCCAGCCCTAGGGG - Intergenic
1132130777 15:99276349-99276371 GTTGGGGACCGCTGCTCTAAGGG + Intronic
1132257396 15:100388034-100388056 GTTGGGGACCCCTATTCTAGGGG - Intergenic
1132379057 15:101353462-101353484 GATGGGGACCCCTGCTCTTGTGG + Intronic
1132532741 16:461347-461369 GTTGGGGACCCCTGCTGTAAAGG + Intronic
1132741697 16:1416827-1416849 TTTGGGGATCTTTGCTGTAAAGG + Intergenic
1133091872 16:3411099-3411121 TTTGAGCACCCCTGGTGTATGGG - Intronic
1133120001 16:3600347-3600369 GTTGGGGACCCCTGCACTAGAGG + Intronic
1133441325 16:5823477-5823499 TTTGGGGACCCCAGCCATAGAGG - Intergenic
1133621003 16:7526264-7526286 TTTGGGGACTGCTGCCCTAGAGG + Intronic
1133660294 16:7909899-7909921 GTTGGGGACTGCTGCTGTAGAGG - Intergenic
1133660350 16:7910377-7910399 CTTGGGGATCCCTGCTGTAAAGG + Intergenic
1133909280 16:10050266-10050288 TTTGGGGATCCCTACTCCAGAGG - Intronic
1134243118 16:12520322-12520344 TTTGGGGAAGCCTGGTGTAGAGG + Intronic
1134787252 16:16955853-16955875 GTTGGGGACCCCTGCTGTATCGG - Intergenic
1134787316 16:16956369-16956391 GGTGGGGACCCCTGCCATAGAGG + Intergenic
1135056901 16:19239388-19239410 TTTGAGGAAACGTGCTGTAGTGG + Intronic
1135191387 16:20357670-20357692 ATTGGGGACTGCTGCTGTAATGG - Intergenic
1135241239 16:20808217-20808239 GTTGGGGACCGCTGCAATAGGGG + Intronic
1135464249 16:22671611-22671633 TTTGCAGACCCCTGCCCTAGAGG - Intergenic
1135930347 16:26731016-26731038 GTTGGGGACCACTGCCTTAGAGG - Intergenic
1137791110 16:51175574-51175596 TTTTATGACCCCTGCTGTACTGG - Intergenic
1137836597 16:51598155-51598177 GTTGGGGACCACTGAGGTAGAGG - Intergenic
1138109577 16:54312821-54312843 GTTGGGGACCCCTGCTGTATGGG + Intergenic
1138156540 16:54710254-54710276 TTTGTGGACCCCTGATGTCAAGG + Intergenic
1138334641 16:56243337-56243359 GTTGGGGACTGCTGCTTTAGAGG + Intronic
1138831259 16:60377646-60377668 TTTTGAGACACCTGCTTTAGAGG - Intergenic
1139997855 16:70997305-70997327 GTTGAGAACCCCTGCTGTAAAGG + Intronic
1141231039 16:82167886-82167908 GTTGGGGACCCATGCTATATAGG + Intronic
1141400315 16:83741775-83741797 GTTGGGGACCCCTGATGTAGGGG - Intronic
1141546006 16:84769702-84769724 TTTGGCCACCCATGCTGTTGGGG + Intronic
1142116851 16:88361338-88361360 GTTGGGGACCCCTGCCCTAGAGG + Intergenic
1142442930 16:90112517-90112539 TTTGGTGTCCCCTGGTGGAGAGG + Intergenic
1142464773 17:128875-128897 TTTGGTGTCCCCTGGTGGAGAGG - Intergenic
1142809820 17:2390336-2390358 TTTGGGGTCCCCCGCCCTAGGGG - Intronic
1143602000 17:7953149-7953171 GTTGGGGACCACTGCTCTAGGGG - Intergenic
1143908355 17:10227441-10227463 GTTGGGGACCCCTGCAGTAGAGG + Intergenic
1144104034 17:11970186-11970208 TTTGCTGATCCCTGCTGTAGAGG + Intergenic
1144390045 17:14784850-14784872 TTTGGGGAGCCCAGATCTAGGGG + Intergenic
1144814533 17:18024834-18024856 TTTGAGAACCACTGCTTTAGGGG - Intronic
1144940647 17:18937596-18937618 GTTGGGGACCCCTGATCCAGGGG + Intergenic
1146255152 17:31387943-31387965 GTTGGGGACCACTGATGTACAGG + Intergenic
1146496933 17:33330956-33330978 GTTGGGGACCCCTGGTCTAAGGG - Intronic
1147154040 17:38534213-38534235 TTTGGAGACCGCAGCTGCAGAGG - Intronic
1147617844 17:41840755-41840777 TTTGCAGACCCCTGCTCTAGAGG + Intronic
1147685659 17:42285572-42285594 TTTGGGGAACCAGGCTGTGGAGG - Intergenic
1148622976 17:49048633-49048655 TTTGGGGACTCCTGTTGTAGAGG - Intronic
1148979748 17:51562304-51562326 GTTGGGGACTGCTGTTGTAGGGG - Intergenic
1149256661 17:54835327-54835349 TTTGCTGACCCCCGTTGTAGGGG - Intergenic
1149420325 17:56504186-56504208 CTTGGGAAACACTGCTGTAGTGG - Intronic
1149774259 17:59344885-59344907 GTTGGGGACCACTGCTCTAGAGG - Intronic
1150417704 17:65000891-65000913 GTTGGGGACCCCTGTCCTAGGGG - Intergenic
1150482733 17:65523029-65523051 GCTGGGGACCCCTGGTTTAGGGG + Intergenic
1151263668 17:72937009-72937031 GTTGGGGACCCTTGCGGTAGAGG + Intronic
1151401962 17:73861559-73861581 TTTGCAGACCCCTGCTTTAATGG - Intergenic
1151578329 17:74963780-74963802 TTTGAGGACCCCGACTGGAGGGG - Exonic
1152014567 17:77741936-77741958 GTTGGGGACTGCTGCTTTAGAGG - Intergenic
1152911914 17:83010010-83010032 TGTGGGGGCCCCTGGTGTGGGGG + Intronic
1152945294 17:83194617-83194639 GTTGGGGACCACTGCTCTGGTGG - Intergenic
1152945349 17:83194905-83194927 CCTGGGGACCCCTGCTCCAGAGG + Intergenic
1153021747 18:635475-635497 GTTGGGGACCCCTGCTATAAAGG + Intronic
1153701487 18:7698934-7698956 GTTGGGGACCCCTGATTTAAAGG - Intronic
1154078564 18:11230572-11230594 TTTGGGGACTGCTGCTTTAAAGG + Intergenic
1154373186 18:13785158-13785180 TTTGCAGACTCCTGCTATAGAGG + Intergenic
1155762576 18:29586344-29586366 GTTGGGGACCCCTGCACTAGAGG - Intergenic
1156009662 18:32481734-32481756 GTTGGGGACCCATGGTTTAGAGG + Intergenic
1156432876 18:37094298-37094320 GTTGGGGACCCCTGCCTTAGAGG + Intronic
1156823304 18:41399078-41399100 ATCGGGGACCCCTGCTTTAAAGG - Intergenic
1156948883 18:42869100-42869122 TTTGGGGACTGCTGATTTAGAGG - Intronic
1156997239 18:43482753-43482775 TTAGGGGCCCCCTACTGTGGTGG + Intergenic
1157227872 18:45884169-45884191 CTTGGGGATCCCTGTTGTATAGG - Intronic
1157389381 18:47288517-47288539 TTTGGGGACTCCTGTTCTTGGGG + Intergenic
1157423139 18:47562788-47562810 GTTGGGGACCCCTGCTGTAAAGG - Intergenic
1157449887 18:47777957-47777979 GTTGGGGACCGCTGGTGTACAGG - Intergenic
1157472594 18:48001392-48001414 GTTGGGGACCACTGCCTTAGGGG + Intergenic
1157540146 18:48495853-48495875 GTTGGGGTCCCCTGCTCTAGGGG - Intergenic
1157648157 18:49299100-49299122 TTTGGGAAACACTGCTTTAGGGG - Intronic
1157795728 18:50573250-50573272 GTTGGGGACCCCTGGTCTAGAGG - Intronic
1158042858 18:53117660-53117682 TTTGCTGACCTCTGCTGTAGAGG - Intronic
1158142186 18:54267772-54267794 ACTGGGGACCCCTGCTTTAAAGG - Intergenic
1158522082 18:58179982-58180004 GTTGGGGACCGTTGGTGTAGAGG + Intronic
1158684391 18:59600097-59600119 GTTGGGGACCCCTGATTTAAAGG - Intronic
1158896812 18:61921952-61921974 GTTGGGGACCCCTGCTCTAGAGG - Intergenic
1158910497 18:62056678-62056700 GTTGGAGACCCCAGCTTTAGTGG - Intronic
1159604963 18:70465811-70465833 CTTGGGGACCCCTGATATAGGGG - Intergenic
1160192511 18:76725752-76725774 GTTGGGGACCACTGCTTTAGAGG - Intergenic
1160271280 18:77386590-77386612 GTTGGGGACCCCTGCTTTAAAGG - Intergenic
1160974366 19:1785389-1785411 CCTGGGGACCCCTGCTTTGGGGG - Intronic
1160975759 19:1791697-1791719 TTTGAAGACCCATGCTGCAGGGG + Intronic
1161837897 19:6660139-6660161 TTGGGGAGCCCCTGCTGTGGGGG + Intergenic
1161870184 19:6863878-6863900 TTTGGGGAGCCGTGGTGTGGGGG + Intergenic
1161988870 19:7672718-7672740 GCTGGGGACCCCTGTTCTAGTGG + Intergenic
1162175354 19:8826167-8826189 GTTGGGGACCACTGCTCTAGAGG - Intronic
1162175431 19:8826692-8826714 GCTGGGGACTCCTGCTCTAGAGG + Intronic
1162265185 19:9567454-9567476 GTTGGGGACCTCTGCTCTAGAGG - Intronic
1162288796 19:9762663-9762685 ATTGGACACCCCTGGTGTAGAGG - Intronic
1162790371 19:13059650-13059672 TTTGGGGAACCCTACTGGAGTGG + Intronic
1162866254 19:13549624-13549646 TTTGGTGATCCCTGATCTAGAGG - Intronic
1162881961 19:13666477-13666499 ATTGGGAACCCCTGGTGTACGGG + Intergenic
1163223480 19:15938263-15938285 GTTGGGGACCACTGCTGTAAAGG - Intergenic
1163384108 19:16988730-16988752 GTTGGGGACCCCTGCTCTAAGGG - Intronic
1164450167 19:28354995-28355017 GTTGGGGACCCTTGTTCTAGAGG - Intergenic
1164494552 19:28748093-28748115 ATTGGGGACCCCTGGCCTAGAGG - Intergenic
1164599815 19:29553158-29553180 TATGGTGACCCCTGTTGTGGGGG - Intronic
1164808930 19:31140832-31140854 TGTGGGGACCTCTTCTGGAGGGG + Intergenic
1165235822 19:34420836-34420858 GTTGGGGACCTCTGCCTTAGAGG - Intronic
1165821809 19:38681485-38681507 TTTGGGGACCCCAGGAGAAGTGG - Intronic
1166967247 19:46536532-46536554 TTGGGGTACCCCTGCGGGAGGGG - Intronic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
924975228 2:167332-167354 TTTGGGGGCCCCTGCGGAACTGG - Intergenic
925462292 2:4074002-4074024 GTTGGGGACCCCTGCTGTAAAGG - Intergenic
925825261 2:7842014-7842036 CTTGGGGACCCCTGCCCTAATGG + Intergenic
925964197 2:9048107-9048129 GTTGGGGACCACTGCCATAGAGG + Intergenic
926562192 2:14430108-14430130 GTTGGGGACCCCTGTTTTACAGG - Intergenic
926995442 2:18730253-18730275 TTTGAGGACCCCTGCTTTACAGG - Intergenic
927259502 2:21072747-21072769 CTTGGGGACCCCTGATCTATAGG + Intergenic
927339584 2:21966921-21966943 TTTGGGTACCCTTGCTATATTGG + Intergenic
928040571 2:27872184-27872206 GTTGGGGACCCCTGCTCTACAGG + Intronic
928259960 2:29757684-29757706 TTTGCTGACCTCTGCTCTAGTGG - Intronic
928658086 2:33473805-33473827 ATTAGGGACCACTGGTGTAGAGG - Intronic
928660347 2:33495527-33495549 GTTGGGGACCCCTGGTTTACAGG + Intronic
929058174 2:37896860-37896882 GTTGGGGACTGCTGCTGTAGAGG - Intergenic
929070266 2:38021917-38021939 TTTAGGGACCCCTGCTATAGAGG + Intronic
929264101 2:39899370-39899392 ATTGGGGACCCCTGCTTTAAAGG - Intergenic
929264153 2:39899697-39899719 GTTGGGGACCATTGCTCTAGGGG + Intergenic
929861255 2:45679740-45679762 TATGTGGGGCCCTGCTGTAGTGG + Intronic
930510144 2:52334618-52334640 GTTGGGGACCCCTGCCATATAGG - Intergenic
931377244 2:61718491-61718513 GTTGGGGATCCCTGCTACAGAGG - Intergenic
931509938 2:62980441-62980463 TTTGAGGACCCCTGCCTAAGAGG + Intronic
931550987 2:63446161-63446183 ATTGGGGACCCCTGGTTTAGAGG - Intronic
931650676 2:64466011-64466033 GTTGGGGACCCCTGGTCTAAAGG + Intergenic
931774784 2:65531190-65531212 GTTGGGGATCCCTGCTTTACGGG + Intergenic
932414032 2:71563158-71563180 TTTGAGAACCCCTGGTATAGTGG + Intronic
932599603 2:73114327-73114349 GTTGGGGACCCCTGCTATAGAGG - Intronic
933222118 2:79702468-79702490 TGTGCTGACTCCTGCTGTAGAGG + Intronic
933674068 2:85037756-85037778 GTTGGGGAACCCTGGTCTAGAGG - Intronic
934625815 2:95849955-95849977 GTTGGGGACCCCTGCTATAGAGG + Intronic
934807760 2:97251363-97251385 GTTGGGGACCCCTGCTATAGAGG - Intronic
934829750 2:97505824-97505846 GTTGGGGACCCCTGCTATAGAGG + Exonic
935108695 2:100072113-100072135 GTTGGGGACCCCTGATTTAGAGG - Intronic
935111672 2:100099738-100099760 TTTAGGAAACCCTGCTGTACAGG - Intronic
935260843 2:101354708-101354730 TTTGAGAACTACTGCTGTAGGGG - Intronic
935633768 2:105234065-105234087 GTGGGGGACCACTGCTTTAGAGG - Intergenic
936123294 2:109765427-109765449 TTTAGGAAACCCTGCTGTACAGG + Intergenic
936221390 2:110606035-110606057 TTTAGGAAACCCTGCTGTACAGG - Intergenic
936228944 2:110682506-110682528 ATTGGGGACCCCTGTGCTAGGGG + Intergenic
936473339 2:112818166-112818188 TTTGCTGACCCCTTCTGTAAAGG - Intergenic
937122290 2:119449163-119449185 TTTGAGAACCACTGCTGTAAAGG - Intronic
937358442 2:121212824-121212846 TTCGGGAGCCCCTGATGTAGCGG - Intergenic
937437218 2:121890420-121890442 TTTGGGGACCACTGGTTTACTGG - Intergenic
937910414 2:127073028-127073050 CATGGGGACCCCTGCTGTGGGGG - Intronic
938608907 2:132925727-132925749 GTTGGGGACCCCTGTTTTGGGGG + Intronic
938924215 2:136024416-136024438 CTTGGGGACCCCAGCTGAGGAGG + Intergenic
939236109 2:139495973-139495995 GTTAGGGATCCCTGTTGTAGAGG - Intergenic
939370386 2:141291962-141291984 GTTGGGGACCCCTGGTATAGGGG - Intronic
940329705 2:152461058-152461080 GTTGGGGGCTGCTGCTGTAGAGG + Intronic
940711325 2:157165847-157165869 TATGGGGACACCAGCTGCAGTGG - Intergenic
940853223 2:158707610-158707632 CTTGGGGACCCCTGATTTAGAGG + Intergenic
941327189 2:164131147-164131169 GTTGGGGACTCCTGCTCTACAGG - Intergenic
941959370 2:171238719-171238741 GTTGGGGAACCCTGCTGTAAAGG - Intergenic
942420454 2:175801611-175801633 GTTGGGGACCCCTGCTTTAAAGG + Intergenic
942430567 2:175906872-175906894 GTTGGGGACCACTGATGTAGAGG - Intergenic
942479459 2:176368432-176368454 GTTGGGGACCCCTGGTCTAATGG - Intergenic
942502633 2:176607558-176607580 TGTTGGGACCCCTGTTTTAGAGG + Intergenic
942549857 2:177104068-177104090 GTTAGGGACCCCTGCTTTATGGG + Intergenic
942565026 2:177257632-177257654 GGTGGGGACCCCTGCCCTAGGGG - Intronic
942674035 2:178407615-178407637 ATTGGACACCCCTGCTGTAGAGG + Intergenic
943156657 2:184187807-184187829 TTTGGGGACCACTGGGCTAGAGG + Intergenic
943244647 2:185431277-185431299 TTCGGGGACTCCTGCTCTAAGGG - Intergenic
943576189 2:189633621-189633643 GTTGGGGACCCCTACTTTATAGG - Intergenic
943657749 2:190527637-190527659 GTTGGGGACCTTTGCTCTAGAGG - Intronic
943905784 2:193499955-193499977 GTTGGGGACCCCTGGTCTAGAGG + Intergenic
944296000 2:198063029-198063051 TGTGGGGACCACTGATGTAGTGG + Intronic
944878076 2:203983301-203983323 TTTGCCGACCCCTGGTTTAGAGG + Intergenic
945565018 2:211387008-211387030 TTTGATGACTCCTGCTGTAATGG - Exonic
946373132 2:219292699-219292721 ATTGGGGACCCCTGCTTTAGAGG - Intronic
946500756 2:220244953-220244975 GTTGGTGACCCCTGGTCTAGAGG + Intergenic
947201721 2:227620273-227620295 TTTGGGGACACCTGGTATAAGGG - Intronic
947208233 2:227682166-227682188 TTTGGGGACCACTGCTCTAGAGG - Intergenic
947395317 2:229681012-229681034 TTTGGAGACCCCATCTGTTGTGG - Intronic
948612582 2:239179267-239179289 GGTGGGGACCCCTGTCGTAGAGG - Intronic
948752984 2:240143244-240143266 TTTGAGAACCATTGCTGTAGGGG - Intronic
948957541 2:241305495-241305517 GTTGAGGAGCCCTGCTGTAAAGG - Intronic
1168747371 20:254963-254985 GTTGGGGACCCCTGGCCTAGAGG + Intergenic
1168961979 20:1876253-1876275 TTTGAGGACCACAGCTTTAGAGG + Intergenic
1169254648 20:4087532-4087554 GCTGGAGACCCCTGCTGCAGAGG + Intergenic
1170634779 20:18094669-18094691 TTTGAGGACCACTGATTTAGAGG - Intergenic
1170668101 20:18404221-18404243 ATTGGATACCCCTGCTGTAAAGG + Intronic
1170670222 20:18426050-18426072 GTTGGGGACCCCTGGTCTACCGG - Intronic
1171985113 20:31654758-31654780 TTTCTGGACCTCTACTGTAGTGG + Intergenic
1172280444 20:33704000-33704022 GTTGGGGACTGCTGCTCTAGGGG - Exonic
1172382416 20:34506394-34506416 GTTGGGGACCCCTGCTTTAATGG - Intronic
1172461375 20:35121545-35121567 TTGGGGAATCCCTGCTCTAGAGG + Intronic
1172626662 20:36351253-36351275 GTTGGGGACCCCTCTTGTAGGGG - Intronic
1173069363 20:39746957-39746979 TATGGGGACCCCTGCCTTAGTGG - Intergenic
1173647277 20:44641304-44641326 ATTGGGAACCACTGCCGTAGAGG + Intronic
1173891673 20:46517223-46517245 TCTGGGGACCACTGCTCTATGGG - Intergenic
1174253905 20:49239710-49239732 GTTGGGGACCACTGTTGTAAAGG + Intronic
1174290277 20:49503502-49503524 GTTGTGGACCCCTGCTCTAATGG + Intergenic
1174455870 20:50648442-50648464 GTTGGGGACCGCTGCTTTAGAGG - Intronic
1174635522 20:51996211-51996233 ATTGGGGACTGCTGCTCTAGGGG - Intergenic
1174886290 20:54339087-54339109 GTTGGGGACCACTGCTCTAAAGG - Intergenic
1175255825 20:57646634-57646656 TTTGGTGACCCCTGGTCTAGAGG + Intergenic
1175673879 20:60930768-60930790 TTTGGGAACCCCTGCTGTGTGGG - Intergenic
1177538734 21:22463893-22463915 TTTGGGGACCCCTGTATTAATGG + Intergenic
1178415876 21:32404739-32404761 GGTGGGGACCGCTGCTCTAGTGG - Intergenic
1181480642 22:23196927-23196949 GTTGGGGACCCCTGCCCTTGGGG + Intronic
1181988598 22:26819809-26819831 GTTGGGGACCCCTGGAGTAGAGG - Intergenic
1182302644 22:29346322-29346344 GCTGGGAACCGCTGCTGTAGGGG - Intronic
1182745202 22:32600479-32600501 GTGGGGGACCCCTGCTCCAGAGG + Intronic
1183503773 22:38197058-38197080 TTTGGGGACCCCTGCTGTAGAGG + Intronic
1183571396 22:38656204-38656226 TTTGGGGGCACCGGCTGTCGGGG - Exonic
1183621585 22:38976280-38976302 TTTGAGGACTGCTGCTCTAGAGG + Intronic
1184154695 22:42659620-42659642 TTTGGGGACCCCTGTTTCATAGG - Intergenic
949207142 3:1453918-1453940 GTTGGGGACCACTGGTTTAGAGG - Intergenic
949564249 3:5230372-5230394 GTTGGGGACCCCTGATCTAGTGG - Intergenic
949575326 3:5333160-5333182 TTTGCCGACCTCTGCTTTAGAGG + Intergenic
950343832 3:12273768-12273790 TTTGAGAACCACTGCTGTAATGG - Intergenic
951050627 3:18089376-18089398 GTTGGGGACCGCTGTTGTAGAGG - Intronic
951483401 3:23185700-23185722 TTTGGGGTCTTCTGATGTAGTGG - Intergenic
951707067 3:25554078-25554100 TTTGTAGACCCCTGCTCCAGAGG - Intronic
951786442 3:26424830-26424852 TTTGTGAACCACTGCTTTAGGGG + Intergenic
952158314 3:30667919-30667941 TTTGCTGACCCCTGTTCTAGAGG - Intronic
952279760 3:31911500-31911522 ATTGGACACCCCTGTTGTAGAGG - Intronic
952365571 3:32671832-32671854 GTTGGGGAACCCTGATATAGGGG + Intergenic
952427282 3:33188446-33188468 TTTGAGAACCACTGATGTAGAGG - Intronic
953227406 3:41033385-41033407 GTTGGGGACCGCTGCTCTATGGG - Intergenic
953768574 3:45762059-45762081 TTTGGGCAGCGCTGCTCTAGTGG - Intronic
953938653 3:47070138-47070160 GTTGGGGACCCACTCTGTAGCGG + Intronic
954320847 3:49831126-49831148 CATGGGCACCCCTGTTGTAGAGG - Intronic
955693376 3:61611921-61611943 TTTGTTAACCCCTGCTGTAAGGG + Intronic
955981301 3:64530175-64530197 TTTGAGAACCACTGCTTTAGTGG + Intronic
956104360 3:65801799-65801821 TTTGGGGACCCCTGCTTTAGGGG - Intronic
956328011 3:68074359-68074381 ATTGGGAACCCCTGCCTTAGAGG + Intronic
957459077 3:80494243-80494265 GTTGGGGACCCCTGCTTTAGAGG - Intergenic
957459131 3:80494566-80494588 TTTGGGGACCACTGCTCTAAAGG + Intergenic
957503647 3:81091302-81091324 ATTAGGGACCCCTGTGGTAGAGG + Intergenic
957613814 3:82503542-82503564 GTTTGGGACCCCTGCTTTAAAGG + Intergenic
958643477 3:96839144-96839166 GCTGGGGACCTCTGCTGTAGGGG - Intronic
958726620 3:97913335-97913357 TTTGCTGACCCCTGGTATAGTGG - Intronic
958884364 3:99709190-99709212 TTTGGGGAACACTGATATAGTGG - Intronic
959380179 3:105632072-105632094 TTTTGGGAACCCTGCAGTGGTGG + Intergenic
959644077 3:108677921-108677943 GTTGGGGACCTCTGATCTAGTGG - Intronic
960096215 3:113692187-113692209 CTTGGGGACCCCTGCCTTAGAGG + Intronic
960537546 3:118830115-118830137 TTTGGGGATCCCTGCTATAAAGG - Intergenic
961195041 3:124994340-124994362 GTTGGGGACCCCTGCCCCAGAGG + Intronic
961320506 3:126070208-126070230 GTTGGGGACCCCTGCTCTAAAGG - Intronic
961488726 3:127235973-127235995 GTTGGGGACCCCTGCATTAAGGG - Intergenic
961519533 3:127458892-127458914 CCTGGAGACCCCTGCTCTAGCGG - Intergenic
961582700 3:127895561-127895583 TTTGGGAAGCCCTGCAGGAGGGG + Intergenic
962332189 3:134488007-134488029 TTTGGGGGCCCCTGGTTTAGAGG - Intronic
963361013 3:144271826-144271848 TTTGGGGAGCAGGGCTGTAGGGG + Intergenic
963808386 3:149749415-149749437 TTTGGAAACCACTGTTGTAGTGG - Intronic
964081224 3:152760424-152760446 TTTGCAGTCCCCTGTTGTAGAGG - Intergenic
965725319 3:171710038-171710060 GTTGGGGACCGCTGCTGTACGGG - Intronic
965725426 3:171710653-171710675 GTTGGCGACCCCTGCTCTAGAGG + Intronic
965853709 3:173063024-173063046 ATTGGGGACCCCTGTCTTAGAGG + Intronic
966163451 3:176991491-176991513 TTTGGGGACCCCTGCTCTAGAGG + Intergenic
967009937 3:185423293-185423315 GTTGGGGACTGCTGCTGTATAGG + Intronic
967863181 3:194168844-194168866 TTTAGGGTCGCCTGGTGTAGAGG + Intergenic
968363202 3:198163477-198163499 TTTGGTGTCCCCTGGTGGAGAGG + Intergenic
968450942 4:675656-675678 GTTGGGGACCCCTGCCCTATAGG - Intronic
969039092 4:4280555-4280577 TTTGCTGACCCCTGCTTCAGAGG + Intronic
969076445 4:4582581-4582603 ATTGGGGACCGCTGCTCTACGGG - Intergenic
969289863 4:6231576-6231598 TTTGCTGACCCCTGCTTTGGAGG - Intergenic
969306205 4:6327597-6327619 TTTGGGGTTCCCTGGTGCAGTGG - Intronic
969503317 4:7568158-7568180 TTTTGGAACCTCTGGTGTAGTGG - Intronic
969699168 4:8756917-8756939 GTTGGGGACCCCTGCTTCAGTGG - Intergenic
970430462 4:15984464-15984486 GTTGGGGACCCCTGTCTTAGAGG - Intronic
971755258 4:30699385-30699407 GTTGGGGACCCCTGGTTTAGAGG + Intergenic
972362548 4:38341238-38341260 GTTGGGGACCACTGCTCTAGAGG + Intergenic
972368669 4:38399950-38399972 GTTGGGGACCCCTGCTCTTGAGG + Intergenic
974003781 4:56535845-56535867 GTTGGGGATCCCTGCCTTAGAGG - Intronic
974009161 4:56591966-56591988 GTTGGGGATCCCTGCTATAAAGG - Intronic
974356884 4:60824247-60824269 TTTGGGGACTGCTGCTCCAGAGG + Intergenic
974760461 4:66267052-66267074 TTTTGGGACCTCTGCTCTTGAGG - Intergenic
975477870 4:74843869-74843891 GTTGGGGAACCCTGCTCTATGGG - Intergenic
976399019 4:84586678-84586700 GTTGGGGACCCCTGGCTTAGAGG + Intronic
976413326 4:84742535-84742557 GTTGGGGACCCCTGGCTTAGAGG - Intronic
977173330 4:93789806-93789828 ATTGGGGACTCCTGCTCTAGAGG - Intergenic
977229401 4:94434052-94434074 GTTGGGCACCCCTGTTTTAGAGG - Intergenic
977359306 4:95982561-95982583 TTTGGGAACCACTGATGTAAAGG + Intergenic
977910159 4:102524967-102524989 TTTGGGGACGCCTGCACTAGAGG + Intronic
978300500 4:107264696-107264718 TTTGCTGACACCTGCTATAGAGG + Intronic
978316164 4:107439801-107439823 GTTGGGGACCCCTGATCTATTGG + Intergenic
978367941 4:108002154-108002176 GTTGGGGACCCCTGCTCTGGAGG - Intronic
978637309 4:110824666-110824688 GTTGGGGACCCCTGTTCTAGAGG + Intergenic
979228842 4:118323115-118323137 TTTGCAGACCCCTGCTCTAGAGG + Intronic
979478216 4:121183496-121183518 GTTGGGGACCCCTGGTATAAAGG - Intronic
979566304 4:122157667-122157689 GTTGGGGACCCCTGATCTAGGGG + Intronic
979852535 4:125591598-125591620 TTTGGGGACTCCTGCTGTATAGG + Intergenic
979952139 4:126906592-126906614 GCTGGGGACCCCTGGTGTAGAGG - Intergenic
980974572 4:139598548-139598570 GTTGCAGACCCCTGCTGTAGAGG - Intronic
981103887 4:140858822-140858844 TTTGGGGATCCCTGGTCTAGTGG + Intergenic
981152573 4:141396198-141396220 GCTGGGGACCCCTGCTTTAAGGG + Intergenic
981591299 4:146365812-146365834 CTTGGGGACCCCTGCTGAAGAGG - Intronic
981609492 4:146578085-146578107 GTTGGGGGCCCCTGCTTTAGAGG + Intergenic
981691559 4:147514868-147514890 TTTGAGGATCACTGCTCTAGAGG - Intronic
981919903 4:150076359-150076381 ATTGGACACCCCTGCTCTAGAGG + Intergenic
981968044 4:150630351-150630373 TTTGGGCATCGCTGCTGTAAGGG - Intronic
982164740 4:152604390-152604412 GTTTGGGACCCCTGCTCTAAAGG - Intergenic
982278526 4:153660986-153661008 GTTGGGGACTCCTGCTCTAAAGG - Intergenic
983420114 4:167506562-167506584 TTTGGAGACCACTGCAATAGTGG + Intergenic
983420480 4:167509163-167509185 TTTGGGGACCTCTGCCTTAGAGG + Intergenic
983578734 4:169286584-169286606 TTTGGGGACTACTGATCTAGAGG - Intergenic
983652663 4:170048984-170049006 GTTGGGCAACCCTGCTCTAGGGG + Intergenic
983703191 4:170623663-170623685 GTTGGGAACTCCTGCTCTAGGGG + Intergenic
984311679 4:178068428-178068450 CTTGGGGACCCCTGTTCTAGGGG + Intergenic
984944052 4:184957463-184957485 GTTGGAGACCCCTGCTATAAAGG + Intergenic
985344178 4:188985517-188985539 GCTGGGGACCCCTGATTTAGAGG + Intergenic
986536312 5:8791443-8791465 TTTTGGGACACCTGCTTTTGGGG - Intergenic
986835017 5:11627622-11627644 GTTGGGGACCACTGCTGTAAGGG - Intronic
987023821 5:13902702-13902724 TTTGCTGACCCCTGCCCTAGAGG + Intronic
987814453 5:22882374-22882396 GGTTGGGACCACTGCTGTAGTGG - Intergenic
988452462 5:31357063-31357085 TTTGGGGACCACTGTTCTCGAGG - Intergenic
989163620 5:38414082-38414104 GTTGGGGACCCCTGATATAAAGG + Intronic
989552331 5:42750561-42750583 GTTGGGAACCCCTGCTCTAGAGG - Intergenic
989730382 5:44641383-44641405 TTTGGGGAGCCCTGACCTAGGGG - Intergenic
989736052 5:44708108-44708130 TCTGGGGACCACTACTATAGAGG + Intergenic
990002386 5:50909773-50909795 GTTGGGGACTCCTGCTATATAGG - Intergenic
990493205 5:56321688-56321710 GCTGGGGACCCCTGCATTAGGGG + Intergenic
990595039 5:57304103-57304125 TTTGGGAAGCCCTGCTCTGGAGG + Intergenic
990612172 5:57468579-57468601 TTTGGGGACCCCTGCCGTAAGGG + Intergenic
990748580 5:58986393-58986415 ATCGGGGACCCCTGCTTTAAAGG - Intronic
990762603 5:59146868-59146890 GTTGGGGATCCCTGCTATATGGG - Intronic
991036861 5:62135968-62135990 GTTGGGGACCCCTGTTTTAGAGG + Intergenic
991172653 5:63646551-63646573 GTTGGGGACCACTGTTTTAGTGG - Intergenic
991272639 5:64803172-64803194 TTTGAGGACCAGTGCTTTAGGGG + Intronic
991286486 5:64982780-64982802 GTTGGGGACCCCTGGTGTAAAGG - Intronic
991530216 5:67606437-67606459 TCTGGCCACCCCTGCTGTAAAGG - Intergenic
992115100 5:73532140-73532162 GTTGGGGACCACTGATTTAGAGG - Intergenic
992116687 5:73545145-73545167 GCTGGGAACCCCTGCTCTAGCGG - Intergenic
992211406 5:74483546-74483568 GTTGGGGACCCCTGCTATATAGG - Intergenic
992285176 5:75227713-75227735 ATTGGGGACCTCTGCAGTAAAGG - Intronic
992375095 5:76181146-76181168 TTTATGGACTCCTGCTTTAGAGG - Intronic
992613506 5:78528225-78528247 GTTGGGGACCCCTGCGATAAAGG - Intronic
992652725 5:78876723-78876745 TTGGGGGACCTCTGCTCTAAGGG - Intronic
993140327 5:84025200-84025222 GTTGGGGACCCCTGGACTAGAGG - Intronic
993425994 5:87764950-87764972 GTTGGGGATCGCTGCTCTAGAGG - Intergenic
993828986 5:92729575-92729597 TTTGGGGACTGCTGCTCTAGTGG + Intergenic
993913100 5:93708386-93708408 GTTGGGGACTGCTGATGTAGGGG - Intronic
994819905 5:104635987-104636009 TTTGGAGAGCCCAGCTGTAGTGG - Intergenic
995173760 5:109149385-109149407 GTTGGGGACCCCTGGTCTAAGGG - Intronic
995911752 5:117196233-117196255 GTTGGGGACCACTGCTCTATAGG - Intergenic
997052903 5:130403364-130403386 GCTGGGGACCACTGCTCTAGAGG + Intergenic
997098128 5:130937136-130937158 GTTGGGGACCCCTGTATTAGAGG - Intergenic
997221984 5:132176825-132176847 TCTGGGGACCACTGCCCTAGGGG + Intergenic
997689401 5:135815473-135815495 GTTGGGGACCCCTGCTATAAAGG + Intergenic
997693840 5:135845953-135845975 GTTGGGGACCCCTGGTCTAGAGG - Intronic
998202052 5:140132769-140132791 TTTGAGAACCACTGCTTTAGAGG - Intergenic
999229727 5:150054507-150054529 TTTGGGGACCTCTGCTGGGTAGG - Intronic
999459609 5:151746558-151746580 TTTGCCGATCCCTGCTCTAGAGG - Intronic
1000011837 5:157240485-157240507 GTTGGGGACTGCTGCTCTAGAGG + Intronic
1000030173 5:157394658-157394680 TTTGGGAACCACTGCTGTAAGGG + Intronic
1000224848 5:159250495-159250517 GTTGGGGACCCCTGCTTTAAAGG + Intergenic
1000603985 5:163308330-163308352 GTTGGGGACCCCTGTAATAGAGG + Intergenic
1001006045 5:168051252-168051274 TTTGCTGACCCCTGATATAGAGG - Intronic
1001164255 5:169349206-169349228 GTAGGGGACCCCTGCCATAGAGG - Intergenic
1001225442 5:169940866-169940888 GTTGGGGACCCCAGATCTAGTGG + Intronic
1001245472 5:170102752-170102774 TTTGGCGTCTCCTGCTTTAGCGG - Intergenic
1001349286 5:170941918-170941940 TTTGGGGACCCCTGTTCTAGAGG - Intronic
1001756014 5:174170709-174170731 GTTGGGGACCACTGCTCTAAAGG - Intronic
1002813687 6:659303-659325 TTTGGGAAACACTGCTCTAGAGG - Intronic
1003007234 6:2393145-2393167 GTTGGGGACCCCTGCATCAGGGG + Intergenic
1003231930 6:4262134-4262156 GTTGGGGACCCCTGGTTTAGAGG - Intergenic
1004127744 6:12889970-12889992 GTTGGGGACCCCTGTGTTAGTGG - Intronic
1004311960 6:14553824-14553846 GTTGGGGACCCCTGCTCTAGAGG + Intergenic
1004476604 6:15979260-15979282 CTTGGGGATCACTGCTCTAGAGG - Intergenic
1004632727 6:17437250-17437272 GTTGGGGACCACTGGTCTAGTGG + Intronic
1004834372 6:19514910-19514932 GTTGGGGACCCCTGTCTTAGGGG - Intergenic
1004893801 6:20127373-20127395 GTTGGGAATCCCTGCTATAGGGG - Intronic
1004933789 6:20487942-20487964 TTTGCTGACCCCTGCTCTAGAGG + Intronic
1005821477 6:29603141-29603163 TTGGGAGACCCCTGCTGGACAGG + Exonic
1006712224 6:36083900-36083922 TCTGGCGACCCCTGTTGGAGGGG - Intronic
1008126960 6:47679400-47679422 TTTGCTGACCCTTGCTTTAGAGG - Intronic
1008239678 6:49094219-49094241 TTTGCTGACTCCTGCTCTAGAGG - Intergenic
1009439674 6:63662215-63662237 GTTGGGGGCCACTGCTGTAGAGG + Intronic
1009881557 6:69572705-69572727 TCTGGGGAGGCCTGCTATAGGGG + Intergenic
1009920916 6:70060368-70060390 GTTGGGGACCCCTGCTGTAGAGG - Intronic
1010805762 6:80234215-80234237 GTTGGGGACCCCTGGTATAATGG + Intronic
1011013680 6:82730863-82730885 CTTGGAGGCCACTGCTGTAGAGG - Intergenic
1011035820 6:82973717-82973739 GTTGGGGACCTCTGCTGTACAGG - Intronic
1011170510 6:84499555-84499577 TTTGCTGACCCCTGCTCTAAAGG - Intergenic
1011216342 6:85009761-85009783 GTTGTGGACCCCTGCCATAGAGG + Intergenic
1011292787 6:85793816-85793838 GTTGGTGACCACTGCTGTACAGG + Intergenic
1011752589 6:90468329-90468351 GTTGGGGACCCCTGTCGTACAGG - Intergenic
1012395446 6:98790992-98791014 GTTGGGGACTCCTACTCTAGAGG + Intergenic
1012554051 6:100490648-100490670 GTTGGGGACTGCTGTTGTAGGGG + Intergenic
1012753197 6:103189796-103189818 ATTGGGGACCCCTGATGTAAAGG - Intergenic
1012973452 6:105755396-105755418 GTTGGGGACTGCTGCTTTAGTGG + Intergenic
1013036264 6:106386875-106386897 ATTTGGGACCCCTGCTCTAGAGG + Intergenic
1013740713 6:113280588-113280610 GTTGGGGACCCCTGGTCTAGAGG + Intergenic
1014495744 6:122119888-122119910 TTTTGTAACCCCTGCTTTAGAGG + Intergenic
1014673048 6:124330690-124330712 GTTGGGGACCTCTACTGTAAGGG - Intronic
1014720515 6:124911950-124911972 GTTGGGGACCCCTGCTCTAGAGG + Intergenic
1015953683 6:138578904-138578926 GCTGGGGACCACTGCTGTAAGGG - Intronic
1016462813 6:144296116-144296138 GTTGGGGAGCCCTGTTCTAGTGG - Intronic
1016471964 6:144384190-144384212 CTTGGGGACCCCTGGTTTAATGG - Intronic
1016518067 6:144918856-144918878 GTTGGGGACCACTGGTCTAGTGG + Intergenic
1016773218 6:147875535-147875557 GCTGGGGACCCCTGTTCTAGGGG - Intergenic
1017737128 6:157375536-157375558 TTTGGGGATCCCTGCTCTAGGGG - Intergenic
1017737203 6:157376062-157376084 GTTGGGGACCACTGCCCTAGAGG + Intergenic
1018019483 6:159746187-159746209 ATTGGATACCCCTGCTCTAGAGG + Intronic
1018512490 6:164540460-164540482 GTTGGGGACCCCTGCTCTAGAGG - Intergenic
1018512558 6:164540975-164540997 TTTGGGGACCACTGCTCTAGAGG + Intergenic
1018811454 6:167301111-167301133 TTTGCTGGCCCCTGCTCTAGAGG + Intronic
1019252478 7:25234-25256 TTTGGTGTCCCCTGGTGGAGAGG - Intergenic
1019881231 7:3863074-3863096 GGTGGGGACCCCTGCCTTAGAGG + Intronic
1021498934 7:21307906-21307928 GTTGGGGACCTCTGCTGTAGGGG + Intergenic
1021652573 7:22846272-22846294 TTTGGGTACCACTGCTCTAGGGG - Intergenic
1021877642 7:25063565-25063587 TTTGGGGACCGCTGCTTTAGAGG + Intergenic
1022708577 7:32830589-32830611 CTTGGAGACCCCTGCTCTAGAGG - Intergenic
1022708633 7:32830924-32830946 GTTGGGGACTGCTGCTCTAGAGG + Intergenic
1022731352 7:33029378-33029400 TTTAGGGACCACTGCTGTTTTGG + Intronic
1022914600 7:34934888-34934910 CTTGGAGACCCCTGCTCTAGAGG + Intronic
1023381514 7:39612951-39612973 GTTGGGGACGACTGCTCTAGGGG - Intergenic
1023742612 7:43294099-43294121 TTTGGGGACCGCTGCTGCAGGGG + Intronic
1023770790 7:43554811-43554833 TTCGGGGAAACCTGCTGAAGAGG + Intronic
1024015169 7:45307225-45307247 GTTGGGGACCACTGCTCTAAAGG - Intergenic
1024626595 7:51213203-51213225 GTTGGGGACCGCTGCTGTAGAGG - Intronic
1024659910 7:51483601-51483623 GTTGGGAACCCCTGCACTAGGGG - Intergenic
1024758718 7:52568236-52568258 TTTGGGGACCCCTGGTGTAGAGG + Intergenic
1025025837 7:55515389-55515411 CCTGGGGACCTCTGCTGCAGGGG - Intronic
1025108149 7:56190305-56190327 GTTGGGGACCCCTGCTCTTATGG + Intergenic
1025656499 7:63524529-63524551 GTTGAGGACCCCTGCCCTAGGGG - Intergenic
1026209995 7:68295579-68295601 GTTGGGGACCCCTGTGTTAGAGG + Intergenic
1026310089 7:69175797-69175819 GTTGGGGACCCCTGCTCTAATGG - Intergenic
1026516049 7:71073316-71073338 GCTAGGGACCCCTGCTGTAAAGG + Intergenic
1026553751 7:71388883-71388905 GTTGGGGACCCCTGCTCTAGAGG - Intronic
1026624422 7:71979671-71979693 GTTGGGGACCCCTGCTCTATGGG + Intronic
1027482656 7:78718320-78718342 GTTGAGGACCCCTGGTCTAGAGG - Intronic
1027621718 7:80495232-80495254 TTTGGGTACATATGCTGTAGTGG + Intronic
1027655862 7:80930210-80930232 GCTGGGGACCCCTGCTTTGGAGG - Intergenic
1027787791 7:82602133-82602155 GTTGGGGACCCCTGTTCTACAGG - Intergenic
1028570260 7:92278952-92278974 GTTGGGGACCACTGCTCTAGGGG - Intronic
1028570309 7:92279271-92279293 TTTGGGGACCCCTGCCCTAAAGG + Intronic
1029531039 7:101125555-101125577 GTTGGGTACCTCTGCTGTAGAGG - Intergenic
1029958442 7:104664516-104664538 TTTGCTGACCCCTGCCATAGGGG - Intronic
1030323231 7:108192091-108192113 TTTGGGGACCCGTGCTCTAGAGG - Intronic
1030323295 7:108192541-108192563 GTTGGGGACCACTGCTCTAGAGG + Intronic
1030626344 7:111849732-111849754 TCTGGGGACCCCTGCTCCAGTGG - Intronic
1031094626 7:117403740-117403762 GTTGGGGACCCCTGCTATAGTGG - Intronic
1031167304 7:118244543-118244565 TTAGGAGACTCCTGCTGAAGTGG + Intergenic
1031521022 7:122766033-122766055 TTTGGGAACCCCTTCTGGTGAGG + Intronic
1032058620 7:128704835-128704857 GCTGGGGACCCCTGCTTTAGTGG + Intergenic
1032188133 7:129745322-129745344 ACTGGGGACCCCTGCTCTGGAGG - Intronic
1032587853 7:133164074-133164096 TTTGGGGACCCCTGTTTAATGGG + Intergenic
1032625191 7:133584292-133584314 CTTGGGGACCCCTGCAGGTGAGG + Intronic
1032645268 7:133816936-133816958 TAGGGGGACCCCTGATGTAAAGG + Intronic
1032792898 7:135255456-135255478 GTTGGGGACCCCTGCCCTAGAGG - Intronic
1033390065 7:140918524-140918546 GTTGGGGGCCCCTGGTATAGAGG + Intronic
1033471416 7:141653059-141653081 TTTGGGAAGCACTGCTGGAGTGG - Exonic
1034106958 7:148498397-148498419 ATTGGGAACCCCTGGTGTAGGGG - Intergenic
1034204915 7:149306994-149307016 TTTGCTGATTCCTGCTGTAGAGG + Intergenic
1034253708 7:149713503-149713525 GTTGGGGACCCCTGATTTAGGGG + Intergenic
1034521347 7:151622902-151622924 TATGGGGACCGCTGCATTAGAGG - Intronic
1034521356 7:151622938-151622960 GTTGGGGACCACTGCATTAGAGG - Intronic
1034521455 7:151623577-151623599 GTTGGGGACCCCTGCTCTAGTGG + Intronic
1034595754 7:152189868-152189890 GTTGGGGACCCCTGCCTTAATGG - Intronic
1034869655 7:154672971-154672993 TTTGCTGACCCCTGTTTTAGGGG + Intronic
1034954674 7:155327106-155327128 CTTGGGGGCCCCTGCTGTCTTGG - Intergenic
1034987393 7:155524843-155524865 GTTGGGGACCGCTGCTCTAAGGG + Intronic
1035227794 7:157443155-157443177 GTTGGGGACCCCTGCTGTTGGGG + Intergenic
1035229493 7:157455666-157455688 TTTGGGGAGGACTGCTGTTGTGG + Intergenic
1035353960 7:158265984-158266006 GTTGGGGACCCCTGGTCTGGAGG + Intronic
1035720010 8:1784759-1784781 TATGGGGACACCTGCTGAGGGGG + Exonic
1035741789 8:1933921-1933943 TGTGGAGACTCATGCTGTAGAGG + Exonic
1037207744 8:16343811-16343833 TTTGGGGACTGCTGCTCTAAAGG + Intronic
1037241846 8:16786239-16786261 GCTGGGGACCCCTGCTTTAGGGG - Intergenic
1037845514 8:22278620-22278642 GTTGGGAACCCCTGCCTTAGAGG - Intronic
1038432720 8:27512991-27513013 CTTGGGGACCCTTGCTGTCCTGG + Intronic
1039375499 8:37028712-37028734 ATTGGGGACCCTTGCTCTATGGG - Intergenic
1039375545 8:37029022-37029044 TTTGGGGACCACTGTCATAGAGG + Intergenic
1039597372 8:38802571-38802593 GTTGGGGACCACTGCTGTAAAGG + Intronic
1041321857 8:56621795-56621817 GTTGGGGACCCCTGTGTTAGAGG + Intergenic
1041867046 8:62585718-62585740 ATTGGGAACCCCTGCTTTAGGGG + Intronic
1042273118 8:66975932-66975954 GTTGGGGACCCCTGCACTATAGG - Intronic
1042347396 8:67741420-67741442 TTTTGGGACCCCTGCTGTGTGGG - Intronic
1042648029 8:71008996-71009018 TTTGAGAACCACTGCTATAGGGG + Intergenic
1042910879 8:73824864-73824886 GTTGGGGACCCCTGGCCTAGAGG + Intronic
1043204659 8:77421978-77422000 TTTGGGGACCCCTGCTTTGAAGG + Intergenic
1043522776 8:81064132-81064154 GTTGGGGACCACTGCTTTAGAGG - Intronic
1043783139 8:84362408-84362430 GTTGAGGACCCCTGCTCTAGAGG - Intronic
1043783184 8:84362743-84362765 TTTGGAGACCACTGCTCTGGAGG + Intronic
1043843138 8:85132775-85132797 TTTGGTAACCCCTGCTATAGAGG + Intronic
1044067131 8:87712790-87712812 GTTGGGGACCCCTGATGTGGAGG - Intergenic
1044365135 8:91336250-91336272 ATTGAGGACCCCTGCTTCAGAGG - Intronic
1044995658 8:97835832-97835854 CTTGGGGACCCCTGATCTACAGG - Intronic
1045086107 8:98687533-98687555 TTGGGGGACCCCTGTTCTAAAGG + Intronic
1045295264 8:100867140-100867162 TTTTAGAACCACTGCTGTAGTGG - Intergenic
1045643855 8:104281297-104281319 GTTGGGGACCCCTGTTCTAGTGG + Intergenic
1045750290 8:105476195-105476217 GTTGGGGACCCCTGTTCCAGTGG - Intronic
1045750349 8:105476522-105476544 GTTGGGGACCCCTGCTCTAGAGG + Intronic
1045848374 8:106663578-106663600 GCTGGGGACCCCTGCCTTAGAGG - Intronic
1045876926 8:106992530-106992552 GTTGGAGACCCCTGCTCTAAAGG - Intergenic
1045876951 8:106992735-106992757 GTTGGGGACCACTGCTTTAGAGG + Intergenic
1045932446 8:107642951-107642973 CCTGGGAACCCCTGCTATAGTGG + Intergenic
1046370095 8:113293421-113293443 TTTGAGGATCCCTGCTTTGGTGG + Intronic
1046757631 8:117988499-117988521 TTTGAGAACCACTGCTGTAAAGG + Intronic
1047055603 8:121161249-121161271 GTTGGGAAGCCCTGCTGCAGAGG - Intergenic
1047512579 8:125526906-125526928 TTTGAGAACCACTGCTATAGTGG - Intergenic
1047941664 8:129832454-129832476 GTTGGGGACCACTGCTCTATAGG - Intergenic
1047971926 8:130091993-130092015 TTTGGGGGCCCATGAGGTAGTGG + Exonic
1048599069 8:135899745-135899767 GTTGGGGACCCCTTCTCTAGAGG - Intergenic
1049329266 8:142041399-142041421 GTTGGGGACAGCTGCTCTAGGGG - Intergenic
1050074189 9:1846800-1846822 GCTGGGGACCACTGCTGTAGAGG - Intergenic
1050074246 9:1847133-1847155 GTTGGGGACCCCAGCTCTAGAGG + Intergenic
1050164139 9:2746773-2746795 TCTGGGGACCTCTGGTTTAGAGG - Intronic
1050431612 9:5568221-5568243 GTTGGGGACCCCTGCCTTAGAGG - Intronic
1050673373 9:8023762-8023784 TTTGGGGACCTCTGATGTTGTGG + Intergenic
1050831329 9:10017930-10017952 TCTGGGGACCCCTGCTGTTCTGG - Intronic
1050888211 9:10791260-10791282 TTTGGGGAGCCCAGAAGTAGGGG + Intergenic
1051000958 9:12281004-12281026 TTTGGGGACCCCTACTTTAGTGG + Intergenic
1051751017 9:20340992-20341014 TATGCGGTCCCCTTCTGTAGAGG - Intergenic
1051967102 9:22842870-22842892 GTTGGGGACTGCTGCTATAGAGG - Intergenic
1052038033 9:23705554-23705576 GTTGGGGACCACTGCTCTAGGGG - Intronic
1052176639 9:25471419-25471441 GTTGTGGACCCTTGCTGGAGAGG + Intergenic
1052309103 9:27045058-27045080 ATTGGGGACCCCTGGTCTATAGG - Intronic
1052613762 9:30811877-30811899 TCTGGGGACCCCTGTAGTAGAGG - Intergenic
1054737579 9:68770813-68770835 GTTGGGGACCGCTGCTGTAGTGG + Intronic
1055307409 9:74944046-74944068 GTTCGGGACCCCTGCTATAAAGG - Intergenic
1055433650 9:76270573-76270595 CCTGGGGACCCCTTCTGTGGGGG + Intronic
1055664118 9:78536116-78536138 TTTGGAAACCCCTGCTTTATGGG - Intergenic
1055699794 9:78931216-78931238 TTTGGGGACCGCTGCCTTAGAGG - Intergenic
1055784290 9:79855713-79855735 GTTGGGGACCTCTGCTATAGAGG - Intergenic
1056275094 9:84986576-84986598 GTTGGGGATCCCTGCTCTAGAGG + Intronic
1056476366 9:86955253-86955275 TTTGTGGAGCCCTGGTGTAGCGG - Intergenic
1057062818 9:92020540-92020562 GTTGGGGACCGCTGCGCTAGAGG + Intergenic
1057341565 9:94206719-94206741 TTTAGGGACCACTGCTCTGGAGG + Intergenic
1057460189 9:95254069-95254091 CTTGGGGAACCCTGCTTTAGAGG + Intronic
1057572311 9:96213963-96213985 GTTGGGGACCACTGCTCTAAAGG + Intergenic
1058000136 9:99856521-99856543 ATTGGGGACCCCTGATATATAGG + Intronic
1059004142 9:110383511-110383533 TCTGGTGACCCCTGTTGTGGGGG + Intronic
1059241296 9:112808199-112808221 TTTGAGGACCTCTGCAGAAGTGG - Intronic
1059347990 9:113645312-113645334 GTTAGGGACCCCTGCTATAGAGG - Intergenic
1059499220 9:114736976-114736998 GTTGGGGACCACTGATCTAGTGG - Intergenic
1060198043 9:121635844-121635866 TTTGTGGGACCCTGCTGCAGAGG + Intronic
1060344716 9:122806092-122806114 GTTGGGGACCACTGCTATAGAGG + Intronic
1061321240 9:129831124-129831146 GTTGGGGACCACTGATTTAGAGG - Intronic
1062217336 9:135396320-135396342 TTTGGGGACCCCTGTGTTAGGGG - Intergenic
1062747889 9:138227137-138227159 TTTGGTGTCCCCTGGTGGAGAGG + Intergenic
1203583668 Un_KI270746v1:41675-41697 GTTGGGGACCCCTGCTATAGAGG - Intergenic
1185851213 X:3490522-3490544 GTTGGGGACCCCTGTTTTATTGG - Intergenic
1186079863 X:5919465-5919487 CTTGGGGACCCCTGCTGTAGAGG - Intronic
1186190908 X:7066683-7066705 ATTGGGGACTCCTGTTTTAGAGG + Intronic
1186287563 X:8062307-8062329 GTTGGGGACCTCTGGTATAGAGG - Intergenic
1186545443 X:10444378-10444400 TTTGCTGACCCCTACTGTAGTGG - Intergenic
1186921876 X:14291343-14291365 TTTGATGACCCCTGCTCTAGGGG + Intergenic
1186996668 X:15131124-15131146 GTTGGGGACCCCTGGTCTAGAGG - Intergenic
1187460656 X:19484100-19484122 GTTGGGGACCCCTGCTCTAAAGG - Intronic
1187556611 X:20358036-20358058 GTTGAGGACCCCTGGTGCAGTGG + Intergenic
1187651031 X:21406336-21406358 GTTGGGGACTACTGATGTAGAGG + Intronic
1187729337 X:22236756-22236778 TTTGCTAACCCCTGCTCTAGAGG + Intronic
1188644212 X:32544115-32544137 TTTGGTGACCCCTGGACTAGTGG + Intronic
1190261000 X:48796806-48796828 GTTGGGAACCCCTGCTGTAGAGG - Intergenic
1190261058 X:48797138-48797160 GTTGGGGACCGCTGCTCTACAGG + Intergenic
1190737678 X:53266612-53266634 TTTGGAGACCTCTCCAGTAGTGG + Intronic
1191129190 X:56990027-56990049 ATTGGGGACCACTGCCCTAGAGG + Intronic
1191849176 X:65572928-65572950 TTTGATGACCCCTGCACTAGAGG - Intergenic
1191911870 X:66160304-66160326 TTTGAGGACCACTGCTGTAAGGG - Intergenic
1192156262 X:68748884-68748906 GTTGGGGACCCCTGCATTAAAGG - Intergenic
1193417505 X:81241695-81241717 TTTGGGGACCCCAGACTTAGGGG + Intronic
1194649071 X:96493217-96493239 TTTGGGGACTGCTGTTATAGAGG + Intergenic
1194678287 X:96819148-96819170 GTTGGGGACCCTTGTTGTAGAGG + Intronic
1195124258 X:101790015-101790037 GTTGGAGACCCCTGCTGTAGAGG - Intergenic
1195169915 X:102257336-102257358 TTTGCAGACCCTTGCTCTAGTGG + Intergenic
1195188942 X:102429764-102429786 TTTGCAGACCCTTGCTCTAGTGG - Intronic
1195195210 X:102490537-102490559 TTTGGGAACCTCTGCTTCAGAGG - Intergenic
1195412862 X:104587520-104587542 TTTGGGAAACACTGCTATAGAGG + Intronic
1195527043 X:105902912-105902934 TTTGGGGACCACTGTTGTAGTGG + Intronic
1195761234 X:108248697-108248719 GTTGGGAACCCCTGCTATAGAGG - Intronic
1196402321 X:115329541-115329563 GTTGGGGACCCCTGCCCTATGGG + Intergenic
1197808797 X:130422886-130422908 GTTGGGGACCCCTGCTCTGGGGG - Intergenic
1197999920 X:132422946-132422968 TTTGAGAACCCCTGCTCTAAGGG + Intronic
1198419624 X:136457433-136457455 TTTGCCAACCCCTGATGTAGAGG + Intergenic
1198574418 X:137994305-137994327 TTTGCTGACCCCTGCTCTAATGG - Intergenic
1198617692 X:138477588-138477610 GTTGGGAACCCCTGCTATACGGG + Intergenic
1198718257 X:139586006-139586028 TTTGGGAACCCCTGCTATAAAGG - Intronic
1199440092 X:147857981-147858003 GTTGGGGACAACTGCTGTATAGG - Intergenic
1199739972 X:150726016-150726038 GTTGGGGATCCCTGCACTAGAGG - Intronic
1199886180 X:152024227-152024249 TTTGGGGACCCCTGGATTAGGGG - Intergenic
1199981627 X:152923861-152923883 GTTGGGGACCCCTGATCTAGGGG + Intronic
1201398626 Y:13577732-13577754 TTTGAGGACCCCTGCAGTAGTGG - Intergenic
1201514573 Y:14805161-14805183 ATTGGGGATCCCTGCTGTAGAGG + Intronic
1201677942 Y:16608537-16608559 GTTGGGGACGCCTGCTCTAATGG + Intergenic
1201944005 Y:19491039-19491061 ATTGAGGACCCCTGCCATAGAGG + Intergenic
1201944105 Y:19492917-19492939 ATTGGGGACCCTTGCCATAGAGG - Intergenic