ID: 1183503959

View in Genome Browser
Species Human (GRCh38)
Location 22:38198640-38198662
Sequence CTGAGCTCCCACTTTTAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 55, 4: 284}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183503953_1183503959 18 Left 1183503953 22:38198599-38198621 CCAAAGTGCTGAGAATACAGGTG 0: 32
1: 5190
2: 84100
3: 220125
4: 258666
Right 1183503959 22:38198640-38198662 CTGAGCTCCCACTTTTAAATAGG 0: 1
1: 0
2: 1
3: 55
4: 284
1183503954_1183503959 -9 Left 1183503954 22:38198626-38198648 CCACCATGCCCAGCCTGAGCTCC 0: 1
1: 5
2: 106
3: 701
4: 4196
Right 1183503959 22:38198640-38198662 CTGAGCTCCCACTTTTAAATAGG 0: 1
1: 0
2: 1
3: 55
4: 284
1183503950_1183503959 28 Left 1183503950 22:38198589-38198611 CCTCGGTCTCCCAAAGTGCTGAG 0: 200
1: 8954
2: 143152
3: 281970
4: 204925
Right 1183503959 22:38198640-38198662 CTGAGCTCCCACTTTTAAATAGG 0: 1
1: 0
2: 1
3: 55
4: 284
1183503952_1183503959 19 Left 1183503952 22:38198598-38198620 CCCAAAGTGCTGAGAATACAGGT 0: 28
1: 5523
2: 94633
3: 319581
4: 241358
Right 1183503959 22:38198640-38198662 CTGAGCTCCCACTTTTAAATAGG 0: 1
1: 0
2: 1
3: 55
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183503959 Original CRISPR CTGAGCTCCCACTTTTAAAT AGG Intronic
905538136 1:38739760-38739782 ATGTTCTCCCACTTATAAATGGG - Intergenic
905835733 1:41119116-41119138 CTGAGCCCACACTTTAAAACTGG + Intronic
907339653 1:53725815-53725837 CTCAGTTCCCCCTTTTAAAATGG - Intronic
907781647 1:57572411-57572433 CAGAGCCCACACTCTTAAATTGG - Intronic
908142322 1:61199018-61199040 CTCACCTCCCATTTTGAAATAGG + Intronic
909406068 1:75290795-75290817 CTGAAGTCCCACTCTTTAATAGG - Intronic
909412497 1:75371743-75371765 ATAATCTCACACTTTTAAATAGG - Intronic
909716175 1:78709729-78709751 CTGTTTGCCCACTTTTAAATTGG - Intergenic
911900473 1:103497084-103497106 TTTAGCTCCCACCTATAAATGGG - Intergenic
911946220 1:104112823-104112845 CTTAGCTCCCACTTGTAAGTGGG + Intergenic
913010858 1:114682249-114682271 CTTATCTCCCAATTTTGAATAGG - Intronic
913038613 1:115000760-115000782 CTTAGCTCCCACTTATTAGTGGG + Intergenic
917144535 1:171874887-171874909 TTTAGCTCCCACTTATAAGTGGG + Intronic
918442862 1:184585687-184585709 TTTAGCTCCCACTTATAATTGGG + Intronic
918746752 1:188211109-188211131 CTTAGCTCACACTTATAAATGGG - Intergenic
919087729 1:192941206-192941228 TTTAGCTCCCACTTTTAAGTGGG + Intergenic
919142241 1:193587196-193587218 TTTAGCTCCCACTCTTAAGTGGG - Intergenic
920300336 1:204984774-204984796 CTGAGCTCACCCTTTTGAAGAGG - Intronic
920611136 1:207438903-207438925 CTTAGATCCCACTTATAAGTAGG - Intergenic
921242578 1:213200893-213200915 TTTAGCTCCCACTTGTAAGTAGG - Intronic
921774155 1:219078103-219078125 TTCAGCTCCCACTTATAAGTGGG - Intergenic
921841714 1:219835698-219835720 CTGAACACTCATTTTTAAATTGG + Intronic
922027821 1:221768257-221768279 TTTAGCTCCCACTTGTAAGTGGG + Intergenic
922069788 1:222180622-222180644 TTTAGCTCCCACTTATAAGTGGG - Intergenic
923382179 1:233432106-233432128 CTGTGTTCTCACTTATAAATGGG - Intergenic
923905165 1:238376378-238376400 TTGAGCTCCCACTTCCAACTTGG - Intergenic
924135552 1:240962663-240962685 CTGAGCTCCCAAGATTAGATTGG - Intronic
924177148 1:241402870-241402892 CTGAACTCACACTTTTTAAAGGG - Intergenic
924285130 1:242477927-242477949 CTGAGCTCCCTCTGTTACATGGG + Intronic
924680848 1:246231217-246231239 CTGACATGCCACTTTCAAATAGG + Intronic
924804519 1:247351832-247351854 CTGAACTCCCATTTCCAAATGGG + Intergenic
1063762718 10:9098587-9098609 CTGAGCTTTCATCTTTAAATTGG + Intergenic
1064867746 10:19900822-19900844 CTTAGCTCCCACTTATGAGTGGG + Intronic
1065019729 10:21494594-21494616 CTAGGCGGCCACTTTTAAATTGG - Exonic
1068167707 10:53352974-53352996 TTCAGCTCCCACTTATAAATGGG - Intergenic
1068406168 10:56592285-56592307 CTTAGCTCCCACTTATGAGTGGG + Intergenic
1069047529 10:63759060-63759082 CTGAGCTCCCAATATAAATTAGG - Intergenic
1069158720 10:65063261-65063283 TTTAGCTCCCACTTATAAATGGG + Intergenic
1071156947 10:82700968-82700990 CAAATCTCCCATTTTTAAATAGG - Intronic
1071950787 10:90700826-90700848 CTGAGCTGCCCATTATAAATTGG - Intergenic
1077708156 11:4508586-4508608 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1079959667 11:26907504-26907526 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1080260614 11:30345966-30345988 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1080338282 11:31225295-31225317 CTTAGCTCCCACTTATAAGTGGG - Intronic
1080794186 11:35548081-35548103 TTCAGCTCCCACTTATAAGTGGG + Intergenic
1081569016 11:44278242-44278264 CTGAACTCCTAGTTTTAACTGGG + Intronic
1082766883 11:57176177-57176199 CTTAGCTCCCACTTATAAGTGGG + Intergenic
1083511489 11:63213112-63213134 CTGACCTGCCACTTGTAACTGGG - Intronic
1083511880 11:63216648-63216670 TTTAGCTCCCACTTATAAATGGG - Intronic
1085887840 11:80541562-80541584 CTTAGCTCCCACATATAAGTAGG - Intergenic
1086086621 11:82961908-82961930 CTTAGCTCCCACTTATAAGTGGG + Intronic
1086120549 11:83300794-83300816 CTGAGCTCCTACTTGACAATTGG + Intergenic
1086272900 11:85089351-85089373 TTTAGCTCCCACTTATAAGTGGG + Intronic
1087178134 11:95114321-95114343 CTGATTGCCCATTTTTAAATTGG + Intronic
1087360396 11:97151344-97151366 TTTAGCTCCCACTTGTAAGTGGG + Intergenic
1088878307 11:113953954-113953976 TTTAGCTCCCACATATAAATGGG + Intergenic
1089129327 11:116199644-116199666 CTGAGGTCTCACTTTTAGAATGG - Intergenic
1089615984 11:119695053-119695075 CTGAGCACCCACTGTCTAATGGG + Intronic
1090597170 11:128332709-128332731 TTTAGCTCCCACTTATAAATGGG - Intergenic
1091849941 12:3687415-3687437 TTTAGCTCCCACTTATAAGTAGG + Intronic
1092189728 12:6510372-6510394 TTGAGCTACCTCTTTTTAATAGG + Intronic
1093266580 12:17010800-17010822 CTTAGCTCCCTCTTCTAAGTGGG + Intergenic
1093642321 12:21541924-21541946 TTTAGCTCCCACTTATAAGTGGG + Intronic
1093977982 12:25443970-25443992 CTTAGCTCCCACTTATATGTGGG + Intronic
1094098003 12:26729723-26729745 TTTAGCTCCCACTTATAAGTGGG + Intronic
1094098004 12:26729730-26729752 TTTAGCTCCCACTTATAAGTGGG - Intronic
1095542515 12:43327322-43327344 CTTAGCTCCCACTTGTAAGTGGG + Intergenic
1096569143 12:52509926-52509948 TTCAGCTCCCACTTATAAGTGGG + Intergenic
1098081615 12:66791886-66791908 CTTAGCTCCCACTCAAAAATGGG + Intronic
1098303060 12:69074113-69074135 CTTAGCTCCCACTTATAGGTGGG - Intergenic
1098399742 12:70061847-70061869 TTTAGCTCCCACTTGTAACTGGG - Intergenic
1098521327 12:71437998-71438020 CTTAGCTCCCACTTATATGTGGG - Intronic
1101018071 12:100522773-100522795 CTTAGGTCCCACTTGTAAGTGGG + Intronic
1102726278 12:115068072-115068094 CTTAGCTCCCACTTCTAAGTGGG + Intergenic
1103504878 12:121435641-121435663 CTTAGCCCCCACTTTTGAGTGGG - Intronic
1104243767 12:127017260-127017282 CTGAGCTTCCACTTTTGGAAAGG - Intergenic
1107230975 13:38110137-38110159 TTTAGCTCCCACTTGTAAGTGGG - Intergenic
1107233257 13:38137068-38137090 TTTAGCTCCCACTTATAAGTTGG + Intergenic
1109148422 13:58812662-58812684 TTTAGCTCCCACTTGTAAGTAGG + Intergenic
1109678726 13:65717298-65717320 CTTAGCTCCTACTTATAAGTGGG + Intergenic
1110345838 13:74446792-74446814 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1111017570 13:82401519-82401541 CTTTGCTCACACTTTTTAATGGG - Intergenic
1111664845 13:91254186-91254208 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112235043 13:97628345-97628367 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1112875318 13:104030816-104030838 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1113332802 13:109346977-109346999 CTTAGCTCCCACTTATGAGTGGG - Intergenic
1114148319 14:20005140-20005162 TTCAGCTCCCACTTATAAGTGGG + Intergenic
1114333629 14:21663820-21663842 TTCAGCTCCCACTTATAAATGGG + Intergenic
1115319836 14:32068011-32068033 CTGATTTCCCAATTTTAAAATGG + Intergenic
1115915912 14:38313745-38313767 CTTAGCCCCCATTTTTAAATGGG + Intergenic
1116143416 14:41031480-41031502 TTTAGCTCCCACTTTTAAGCGGG + Intergenic
1116460854 14:45171543-45171565 CTTAGCTCTTACTTCTAAATGGG + Intronic
1116826762 14:49680372-49680394 CTAAGCTCCCAGTTTTAATAAGG + Intronic
1117680864 14:58201187-58201209 CTGGGGTCCAATTTTTAAATAGG - Intronic
1117839006 14:59838168-59838190 GTTAGCTCCCACTTATAAGTGGG + Intronic
1118455736 14:65944500-65944522 CTGAACTCCCCCTTTTATAATGG + Intergenic
1121398785 14:93653244-93653266 CTGAGCTGACACTTGTAAAAAGG - Intronic
1124549700 15:30668107-30668129 CTTAGCTCCCACTTATAACTGGG + Intronic
1125225543 15:37391069-37391091 CTTAGCTCCCACTTATAAGTGGG + Intergenic
1126624528 15:50673487-50673509 CTCAGCTCCCACTTATGAGTGGG + Intronic
1127038182 15:54943043-54943065 TTTAGCTCCCACTTGTAAGTGGG - Intergenic
1127187755 15:56497327-56497349 CTGAGCCGCCATTTTTAATTTGG + Intergenic
1127357901 15:58218544-58218566 TTTAGCTCCCACTTATAAATGGG + Intronic
1128396182 15:67228902-67228924 TTTAGCTCCCACTTATAAGTGGG - Intronic
1128414425 15:67431408-67431430 TTTAGCTCCCACTTATAAGTGGG - Intronic
1128762658 15:70228001-70228023 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1129482367 15:75837855-75837877 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1130716220 15:86337630-86337652 TTCAGCTCCCACTTATAAGTCGG - Intronic
1133663978 16:7947161-7947183 CTTAGCTCCCACTTATAAGTGGG - Intergenic
1135846669 16:25925143-25925165 CTGAGCTCCTACTTCTACATGGG + Intronic
1137003834 16:35254358-35254380 TTGAGCTACCACTTATAAGTGGG - Intergenic
1137902732 16:52286778-52286800 CTTAGCTCCCACTTATAAGTGGG - Intergenic
1138258855 16:55598556-55598578 TTTAGCTCCCACTTATAAATGGG - Intergenic
1138452318 16:57100831-57100853 CTGAGCTCCCACACTTAAGAAGG + Intronic
1138835728 16:60432245-60432267 CTGAGCTCAAACTATTAAATGGG + Intergenic
1140592153 16:76366350-76366372 TTTAGCTCCCACTTATAAGTAGG + Intronic
1140609819 16:76584485-76584507 CTTAGCTCCCACTTATAAGTTGG + Intronic
1141700093 16:85638519-85638541 CTGAGCTTCCACTTTTTCTTGGG + Intronic
1143056587 17:4167212-4167234 GTGAGCTACCCCTTTTAAAAAGG - Exonic
1143648074 17:8245073-8245095 TTTAGCTCCCACTTATAAGTGGG - Intronic
1145870881 17:28272038-28272060 CTTCACTCCAACTTTTAAATGGG + Intergenic
1149065473 17:52474261-52474283 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1150928384 17:69558140-69558162 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1151936115 17:77262467-77262489 ATTACCTCCAACTTTTAAATAGG - Intergenic
1153065940 18:1045403-1045425 CTTAGCTGCCACTTATGAATGGG - Intergenic
1153141838 18:1981418-1981440 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1153153817 18:2126675-2126697 TTTAGCTCCCACTCTTAAGTAGG + Intergenic
1153842475 18:9019191-9019213 TTTAGCTCCCACTTATACATGGG + Intergenic
1155001805 18:21694985-21695007 CAGAACTCCCAATTTTAATTGGG + Intronic
1158028116 18:52928178-52928200 TTTAGCTTCCACTTATAAATAGG - Intronic
1158190171 18:54818654-54818676 CTGACCTCCCACTTTTACAGTGG + Intronic
1158215308 18:55094842-55094864 CTGACCACTGACTTTTAAATAGG - Intergenic
1159372119 18:67541636-67541658 CTGAGCTCCCATTTGTCAGTGGG + Intergenic
1160483205 18:79261876-79261898 CTAAGCTCCCACTTTATAATAGG + Intronic
1163172592 19:15542771-15542793 TTCAGCTCCCACTTATAAGTGGG + Intronic
925557986 2:5153319-5153341 ATCACCTCCCACTTTTGAATAGG + Intergenic
928428760 2:31200691-31200713 CTCGGCATCCACTTTTAAATAGG + Intronic
928769673 2:34691787-34691809 TTTAGCTCCCACTTATAAGTGGG + Intergenic
929015664 2:37491888-37491910 TTTAGCTCCTACTTATAAATGGG + Intergenic
930367538 2:50459529-50459551 TTTAGCTCCCACTTACAAATGGG + Intronic
930404146 2:50932511-50932533 CTTAGTTCCCACTTGTAAGTGGG - Intronic
930448307 2:51501871-51501893 TTAAGCTCCCACTTATAAGTGGG + Intergenic
930886315 2:56331150-56331172 CTTAGCTCCCACTTCTAAGTGGG - Intronic
931789349 2:65650084-65650106 CTGAGTTCCCTCTTTTAGAGTGG + Intergenic
932170497 2:69551159-69551181 CTGTGTTCTCACTTATAAATGGG + Intronic
933011192 2:77065830-77065852 CTGAGATGCCATTTTTATATTGG + Intronic
933630391 2:84649813-84649835 TTCAGCTCCCACTTATAAGTGGG - Intronic
934021347 2:87956929-87956951 CTGAGCACCCAGTCTTAAACTGG + Intergenic
935151835 2:100444185-100444207 TTTAGCTCCCACTTATAAGTGGG - Intergenic
935416184 2:102821735-102821757 CTCAGCCTCCATTTTTAAATAGG - Intronic
935661799 2:105472984-105473006 TTGAACTCCCAATTTTAAAATGG + Intergenic
936382711 2:112001101-112001123 CAGAGCTTCCGCTTTTCAATGGG - Intronic
936720248 2:115242798-115242820 CTTAGCTCCCACTTATAACTGGG + Intronic
936786907 2:116104302-116104324 CCCAGCTCCCACTTTTAATGAGG + Intergenic
937425048 2:121791749-121791771 CTGAACTCCCACTACAAAATGGG - Intergenic
940642647 2:156362595-156362617 CTGAGCTGCTACTTTTAAATGGG - Intergenic
942353469 2:175080576-175080598 CTGAGCTGCTACTTTAAAAATGG - Intronic
943943967 2:194034823-194034845 CTTAATTCCCACTTTTAAGTGGG - Intergenic
945435931 2:209817536-209817558 GTCAGCTCCCAATTTTAAATTGG - Intronic
946581708 2:221135266-221135288 CTGAGTACCCACTTTGATATTGG - Intergenic
946737611 2:222770153-222770175 CTTAACTCCCACTTGTAAGTGGG - Intergenic
946933209 2:224692322-224692344 CTTAGCTCCCACTTATAAGTGGG - Intergenic
1169150967 20:3289043-3289065 CTTAGATTCCAATTTTAAATTGG - Intronic
1170763436 20:19271760-19271782 CTTAGCTCCCACTTATGAGTGGG - Intronic
1171139764 20:22730458-22730480 CTGAGCTCCCACATCTTCATTGG - Intergenic
1173745348 20:45432506-45432528 CTGAACTTCCCCTTTTAAAACGG + Intergenic
1175697683 20:61114828-61114850 CTGATTTCCCACTTTCAAATCGG + Intergenic
1182347817 22:29679126-29679148 CTGAGTTCTCACTTATAAAATGG - Intronic
1183503959 22:38198640-38198662 CTGAGCTCCCACTTTTAAATAGG + Intronic
950840269 3:15961674-15961696 CTTAGCTCCTACTTATAAGTAGG + Intergenic
952167429 3:30766031-30766053 CTGACCTTCTAATTTTAAATTGG + Intronic
952217754 3:31294792-31294814 CTGAGCTCTCCCTTTAAAACTGG + Intergenic
953310614 3:41874631-41874653 CTTAGCTCCCGCTTATAATTGGG - Intronic
953524472 3:43677264-43677286 GTGAGCTCCCACTTATGAGTGGG - Intronic
953812017 3:46120911-46120933 CTCAGCTCCCACATTCAAACAGG - Intergenic
955538008 3:59944744-59944766 ATTAGCTCCCACTTATAAGTGGG + Intronic
957505867 3:81119802-81119824 CTTAGCTCCCACTTATAAGCAGG - Intergenic
959249294 3:103920841-103920863 CTTAGCTCCTACTTATAAGTGGG - Intergenic
959678538 3:109065938-109065960 TGTAGCTCCCACTTATAAATGGG - Intronic
960777044 3:121268329-121268351 CTCAGCTCCCACTTATGAGTGGG - Intronic
960874135 3:122280016-122280038 TTCAGCTCCCACTTATAAGTGGG + Intronic
961417204 3:126767814-126767836 TTTAGCTCCCACTTGTAAGTGGG + Intronic
962497495 3:135956559-135956581 TTCAGCTCCCACTTATAAGTGGG + Intergenic
964052149 3:152407903-152407925 TTCAGCTCCCACTTATAAGTGGG - Intronic
964434516 3:156637417-156637439 CCCAGCTCTCGCTTTTAAATAGG - Intergenic
965462152 3:168979153-168979175 TTCAGCTCCCATTTATAAATGGG + Intergenic
965711020 3:171556489-171556511 CTGAGCACTCACTTTTCAAGAGG - Intergenic
965845573 3:172957463-172957485 CTCAGCTTCCTGTTTTAAATAGG + Intronic
967246820 3:187495802-187495824 CTTAACTCCCACTTATAAGTGGG - Intergenic
969475036 4:7417566-7417588 CTGTTCTCCCACCTTTAAAACGG + Intronic
970113738 4:12669459-12669481 TTCAGCTCCCACTTATAAGTGGG - Intergenic
970605694 4:17679949-17679971 CTTAGCCCCCACTTATAAGTGGG - Intronic
970749684 4:19342621-19342643 CTCATCTCCCACTCTTCAATAGG + Intergenic
972523803 4:39887948-39887970 CTGTTTTCCCACTTTTAAATTGG - Intronic
973529828 4:51825133-51825155 TTTAGCTCCCACTTCTAAGTGGG + Intergenic
973829490 4:54743898-54743920 TGGAACTCCCACTTTTAAAGGGG - Intergenic
974220809 4:58968646-58968668 TTTAGCTCCCACTTATAAGTGGG - Intergenic
974309987 4:60192835-60192857 TTTAGCTCCCACTTATAAATGGG - Intergenic
974961545 4:68708200-68708222 TTTAGATCTCACTTTTAAATAGG + Intergenic
975052179 4:69879510-69879532 ATTAGCTCCCACTTATAAATGGG + Intergenic
975072600 4:70160263-70160285 CTGTGTTCTCACTTATAAATGGG - Intronic
975891979 4:79040619-79040641 TTTAGCTCCCACTTATAAGTGGG - Intergenic
976487128 4:85620998-85621020 TTTAGCTCCCACTTGTAAGTGGG + Intronic
976871009 4:89793658-89793680 TTCAGCTCCTACTTTTAAACAGG - Intronic
978294337 4:107186185-107186207 CTTAGCTCCCACTTATAAGTGGG - Intronic
979105419 4:116680929-116680951 CTTAGCTCCCACTTGTGAGTGGG - Intergenic
979190263 4:117848534-117848556 CTATGCTCTCACTTATAAATGGG + Intergenic
979285815 4:118923317-118923339 TTTAGCTCCCACTTATAAGTGGG - Intronic
979509687 4:121538118-121538140 CTTAGCTCTCACTTATAAGTGGG + Intergenic
979586226 4:122421264-122421286 TTGACATACCACTTTTAAATGGG - Exonic
979873696 4:125859756-125859778 CTTAGCTCCCACTTATAAGTGGG + Intergenic
980265043 4:130504092-130504114 GTGAGATCCCACTATCAAATAGG - Intergenic
980412006 4:132432502-132432524 CTGAGCTCCCATGTTAAAACAGG - Intergenic
980580675 4:134746211-134746233 CTTAGCTCCCACTTATAAAGTGG - Intergenic
980713256 4:136598053-136598075 TTTAGCTCCCACTTATAAGTGGG - Intergenic
981512343 4:145571640-145571662 CTTTGCCCCCACTTTTTAATGGG - Intergenic
981735565 4:147946525-147946547 CAAAGCTTCCATTTTTAAATGGG - Intronic
981815963 4:148830657-148830679 CTTTTCTCCCACTTGTAAATTGG - Intergenic
982510221 4:156273531-156273553 CTGACCTCCCCTTTTTCAATTGG + Intergenic
983554723 4:169049846-169049868 GTGAGCCACCACTTTTAAAACGG - Intergenic
983577642 4:169275681-169275703 CTGAGTTCCCCCTGTAAAATAGG + Intergenic
984457766 4:179992665-179992687 TTTAGCTCCCACTTTCAAGTGGG - Intergenic
985317032 4:188669100-188669122 CTGATTTCCCACTCTTAAGTGGG + Intergenic
985436649 4:189936878-189936900 TTTAGCTCCCACTTATAAGTGGG + Intergenic
986521581 5:8624504-8624526 TTTAGCTCCCACTTATACATGGG + Intergenic
987767130 5:22247353-22247375 CTGAGCTACCACATTTACATGGG + Intronic
988313446 5:29592882-29592904 CTTAGCTCCTACTTGTAAGTAGG - Intergenic
989283383 5:39670486-39670508 CTACGTTCCCACTTATAAATGGG - Intergenic
989558869 5:42828294-42828316 TTTAGCTCCCACTTATAAGTGGG + Intronic
991499419 5:67262005-67262027 CAGAGCCCACACTTTCAAATAGG - Intergenic
991657263 5:68916397-68916419 TTTAGCTCCCACTTATAAGTGGG + Intergenic
992212303 5:74492854-74492876 CTGAGCAACCACCTATAAATCGG + Intergenic
992598252 5:78368022-78368044 CTGGGCTCCCAATTTTCAATGGG - Intronic
992757004 5:79916872-79916894 TTCAGCTCCCACTTATAAGTGGG - Intergenic
994012427 5:94921131-94921153 CTAAGTTCCCACCTTTAAGTGGG + Intronic
994117695 5:96079262-96079284 CTGAGCTCCCACTTACCAAATGG + Intergenic
994966333 5:106677145-106677167 GTTAGCTCCCAGTTATAAATGGG + Intergenic
995073325 5:107950294-107950316 CTGAGATCCCTTTGTTAAATAGG - Intronic
997661563 5:135593076-135593098 CTGAGCCCTCACTATTAAACAGG - Intergenic
997757432 5:136412427-136412449 CTAAGCTCCCTCTGATAAATTGG - Intergenic
1000590917 5:163156474-163156496 ATTAGCTCCCACTTATAAATGGG + Intergenic
1001376466 5:171264168-171264190 CTTAGCTCCCACTTATCAATGGG - Intronic
1003734570 6:8864247-8864269 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1005252747 6:23966149-23966171 GTCATTTCCCACTTTTAAATGGG + Intergenic
1005657499 6:27956566-27956588 CTTAGTTCCCACTTATGAATGGG - Intergenic
1007571548 6:42894880-42894902 CTCAGTTCCCAAATTTAAATGGG + Intergenic
1008208567 6:48692870-48692892 TTTAGCTCCCACTTGTAAGTGGG - Intergenic
1009279512 6:61729251-61729273 TTTAGCTCCCACTTATAAGTGGG - Intronic
1009595894 6:65736020-65736042 TTTAGCTCCCACTTAGAAATAGG - Intergenic
1009779462 6:68251077-68251099 CTTAGCTCCAACTTATAAGTGGG + Intergenic
1010315830 6:74449088-74449110 CTTAGCTCCCGCTTATAAGTGGG + Intergenic
1013149752 6:107432992-107433014 CTTAGCTCCCACATATAAGTGGG + Intronic
1013259587 6:108428167-108428189 CTTAGCTCCCACTTGTAAGTGGG + Intronic
1013871251 6:114763955-114763977 TTTAGCTCCCACTTATAACTGGG + Intergenic
1013954204 6:115821512-115821534 CCTAGCTCCCACTTAGAAATGGG - Intergenic
1014626817 6:123736611-123736633 CTTAGCTTCCACTTGTAAATGGG - Intergenic
1016238135 6:141892878-141892900 TTTAGCTCCTACTTATAAATAGG - Intergenic
1016991366 6:149931606-149931628 TTTAGCTCCCACTTATAAACGGG - Intergenic
1017357829 6:153530560-153530582 TTTAGCTCCCACTTGTAAGTGGG + Intergenic
1017369176 6:153684404-153684426 TTTAGCTCCCACTTATAAATGGG - Intergenic
1020128895 7:5548729-5548751 CTCAGCTCCTACTTGCAAATAGG + Intronic
1021032738 7:15758942-15758964 CTGCGATACCACTTTTAAAAAGG + Intergenic
1021738509 7:23662277-23662299 CTGTGCTCCCAGTTTCTAATAGG - Intergenic
1022331717 7:29385549-29385571 AGGAGGTCCCACTTTTAAGTAGG + Intronic
1022991411 7:35711952-35711974 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1023115666 7:36859665-36859687 CTCATTTCCCTCTTTTAAATGGG + Intronic
1024340677 7:48255526-48255548 TTTAGTTCCCACTTATAAATGGG + Intronic
1024365804 7:48519031-48519053 CTCAGCTCCCACTTATAAGTGGG + Intronic
1024733767 7:52280823-52280845 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1026304281 7:69126526-69126548 TTCAGCTCCCACTTGTAAGTGGG - Intergenic
1026617270 7:71916593-71916615 TTCAGCTCCCACTTATAAGTGGG - Intronic
1028414225 7:90562843-90562865 TTCAGCTCCCACTTATAAGTGGG - Intronic
1032415246 7:131730488-131730510 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1034744936 7:153515654-153515676 TTCAGCTCTCACTTCTAAATGGG - Intergenic
1036942675 8:13066801-13066823 CTTAGCTCCCACTTATGAGTGGG - Intergenic
1037001294 8:13722599-13722621 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1037374688 8:18214905-18214927 TTTAGCTCCCACTTATAAGTAGG + Intronic
1038323686 8:26553445-26553467 CTTAGCTCCCACTTATAAGTGGG + Intronic
1038709154 8:29925062-29925084 CTTAGCTCCCTCTTATAAGTGGG + Intergenic
1039014946 8:33136876-33136898 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1039442639 8:37605635-37605657 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1040023467 8:42761145-42761167 CTGGGCTTCCTCTTTCAAATGGG + Intronic
1040943933 8:52861981-52862003 TTTAGCTCCCACTTATAAGTAGG + Intergenic
1041003021 8:53470247-53470269 TTGAGCTCCCTCTTTTTGATAGG + Intergenic
1041471122 8:58210054-58210076 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1043414102 8:80030629-80030651 TTGGGCTTCCACTTCTAAATAGG - Intronic
1043691632 8:83160534-83160556 CTTAGCTCCCACTTATGAGTGGG + Intergenic
1043804347 8:84652545-84652567 CTTAGATCCCATTTTTAAAATGG + Intronic
1043869549 8:85416884-85416906 CTTAGCCCCCACTCATAAATGGG - Intronic
1044055061 8:87558451-87558473 TTTAGCTCCCACTTTTAAGTGGG + Intronic
1044516659 8:93146728-93146750 TTTAGCTCCCACTTATAAGTGGG + Intronic
1046071122 8:109255006-109255028 TTGAGTTTCCTCTTTTAAATGGG - Intronic
1046333173 8:112748558-112748580 TTTAGCTCCCACTTATAAGTGGG + Intronic
1046648492 8:116811237-116811259 GTGAACTCCCAATTTTAATTTGG - Intronic
1046975465 8:120271147-120271169 TTTAGCTCCCACTTATAAGTGGG - Intronic
1048147008 8:131854969-131854991 CTATGCTCTGACTTTTAAATAGG - Intergenic
1050762817 9:9094443-9094465 CTTAGCTCCCACTTATAAGTGGG - Intronic
1051290921 9:15545068-15545090 CTCAGCTCCCACTTATGAGTGGG - Intergenic
1052107428 9:24536554-24536576 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1052669217 9:31534164-31534186 TTTAGCTCCCACTTATAAATGGG + Intergenic
1052793085 9:32895714-32895736 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1054974425 9:71125413-71125435 TTTAGCTCCCACTTATAAATGGG + Intronic
1055373433 9:75624566-75624588 CCCAGCTCCCACTTTTCACTGGG - Intergenic
1056671313 9:88629763-88629785 CTTAGCTCCCACTTATAAGCAGG + Intergenic
1059036572 9:110760484-110760506 TTTAGCTCCCACTTATAAGTGGG - Intronic
1059698141 9:116748299-116748321 CTCAGCTGCCACTTTTAACCAGG - Intronic
1059756020 9:117294056-117294078 CTGAAATCCCACTATTAAAGAGG + Intronic
1059886252 9:118748117-118748139 CTAAGTTGCCACTTATAAATGGG - Intergenic
1185908428 X:3959656-3959678 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1185965372 X:4594256-4594278 CTGAGCTCCCAATCTCAAAAAGG - Intergenic
1186232633 X:7472515-7472537 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1186745404 X:12562966-12562988 CTGAGCTCCAAGTTTTCACTGGG - Intronic
1187994067 X:24906450-24906472 CTTAGCTCCCCCTTATAAGTGGG - Intronic
1188273564 X:28173720-28173742 CTTAGCTGCCACTTATAAGTGGG + Intergenic
1188619890 X:32207282-32207304 CTGAACTCCCACTTTTATAAGGG - Intronic
1189681424 X:43520274-43520296 CTGAGCTTCCTCATTTAATTAGG - Intergenic
1189709286 X:43793103-43793125 CTTAGCTCTCACTTATAAGTGGG - Intronic
1191088117 X:56590893-56590915 TTCAGCTCCCATTTATAAATGGG + Intergenic
1192097077 X:68223471-68223493 CTTAGCTCCCACTAATAAATGGG - Intronic
1192508202 X:71703654-71703676 TTTAGCTCCCACTTGTAAGTGGG + Intergenic
1192512473 X:71731243-71731265 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1192514224 X:71750266-71750288 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1192518494 X:71777899-71777921 TTTAGCTCCCACTTGTAAGTGGG - Intergenic
1192658618 X:73019613-73019635 CTGAGCTCCATCTTTAACATTGG + Intergenic
1193188100 X:78537566-78537588 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1193427842 X:81361564-81361586 TTTAGCTCCCACTTGTAAGTGGG - Intergenic
1193773228 X:85612726-85612748 TTTAGCTCCCACTTATAAATGGG + Intergenic
1194456088 X:94105483-94105505 TTCAGCTCCCACTTATAAGTGGG + Intergenic
1194922772 X:99787609-99787631 CTGTGTTCCCACCTTTAAGTTGG - Intergenic
1195382298 X:104282369-104282391 TTGAGCTCACATTTTTGAATCGG + Intergenic
1196052318 X:111318718-111318740 TTTAGCTCCCACTTATAAGTGGG - Intronic
1196941280 X:120778617-120778639 TTCAGCTCCCACTTATAAATGGG - Intergenic
1197176145 X:123487605-123487627 CTCTGTTTCCACTTTTAAATGGG - Intronic
1197496965 X:127196145-127196167 CTTAGCTCCAACTTATAAGTGGG - Intergenic
1197549027 X:127864986-127865008 CTCAGCTCCCACTTCTAAGTGGG - Intergenic
1198831037 X:140750840-140750862 CTCAGCTCCCACTTATTAGTGGG + Intergenic
1199109110 X:143909389-143909411 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1199123179 X:144082192-144082214 CTGAGCACCCAGTCTTAAACTGG - Intergenic
1201276455 Y:12303226-12303248 CTGAGTTCCCTTTTTTAAAATGG - Intergenic
1201527945 Y:14957651-14957673 CTGAGCTCCATTTATTAAATAGG - Intergenic