ID: 1183504739

View in Genome Browser
Species Human (GRCh38)
Location 22:38202717-38202739
Sequence GGCCCCAGGGAGCGCGCGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 257}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183504739_1183504749 19 Left 1183504739 22:38202717-38202739 CCGCGCGCGCGCTCCCTGGGGCC 0: 1
1: 0
2: 2
3: 19
4: 257
Right 1183504749 22:38202759-38202781 CCTCGGAGAGGGCGTGCCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 127
1183504739_1183504743 2 Left 1183504739 22:38202717-38202739 CCGCGCGCGCGCTCCCTGGGGCC 0: 1
1: 0
2: 2
3: 19
4: 257
Right 1183504743 22:38202742-38202764 TACACCAGCAGTGTGTACCTCGG 0: 1
1: 0
2: 2
3: 7
4: 118
1183504739_1183504746 8 Left 1183504739 22:38202717-38202739 CCGCGCGCGCGCTCCCTGGGGCC 0: 1
1: 0
2: 2
3: 19
4: 257
Right 1183504746 22:38202748-38202770 AGCAGTGTGTACCTCGGAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 120
1183504739_1183504747 18 Left 1183504739 22:38202717-38202739 CCGCGCGCGCGCTCCCTGGGGCC 0: 1
1: 0
2: 2
3: 19
4: 257
Right 1183504747 22:38202758-38202780 ACCTCGGAGAGGGCGTGCCCTGG 0: 1
1: 0
2: 1
3: 11
4: 127
1183504739_1183504745 7 Left 1183504739 22:38202717-38202739 CCGCGCGCGCGCTCCCTGGGGCC 0: 1
1: 0
2: 2
3: 19
4: 257
Right 1183504745 22:38202747-38202769 CAGCAGTGTGTACCTCGGAGAGG 0: 1
1: 0
2: 1
3: 9
4: 83
1183504739_1183504750 23 Left 1183504739 22:38202717-38202739 CCGCGCGCGCGCTCCCTGGGGCC 0: 1
1: 0
2: 2
3: 19
4: 257
Right 1183504750 22:38202763-38202785 GGAGAGGGCGTGCCCTGGGCCGG 0: 1
1: 1
2: 5
3: 62
4: 474
1183504739_1183504751 30 Left 1183504739 22:38202717-38202739 CCGCGCGCGCGCTCCCTGGGGCC 0: 1
1: 0
2: 2
3: 19
4: 257
Right 1183504751 22:38202770-38202792 GCGTGCCCTGGGCCGGCCACCGG 0: 1
1: 0
2: 1
3: 22
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183504739 Original CRISPR GGCCCCAGGGAGCGCGCGCG CGG (reversed) Intronic