ID: 1183506444

View in Genome Browser
Species Human (GRCh38)
Location 22:38211756-38211778
Sequence GTGCAGAAATGGAAAGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 360}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183506444_1183506449 0 Left 1183506444 22:38211756-38211778 CCATGTGCTTTCCATTTCTGCAC 0: 1
1: 0
2: 5
3: 44
4: 360
Right 1183506449 22:38211779-38211801 CTTGTCCCTGGGAGACACCCCGG 0: 1
1: 1
2: 1
3: 23
4: 221
1183506444_1183506455 22 Left 1183506444 22:38211756-38211778 CCATGTGCTTTCCATTTCTGCAC 0: 1
1: 0
2: 5
3: 44
4: 360
Right 1183506455 22:38211801-38211823 GTCCTGCCAGAATGTGTCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183506444 Original CRISPR GTGCAGAAATGGAAAGCACA TGG (reversed) Intronic
900008574 1:84474-84496 ATACAGAAAAGGAAAGCACAGGG + Intergenic
900036807 1:418485-418507 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
900058433 1:654224-654246 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
901188007 1:7387426-7387448 GGACAGAAATGGAAAACAGATGG - Intronic
902954764 1:19917980-19918002 CTGCAGAAACAGAAAACACAGGG - Intergenic
903306936 1:22419421-22419443 GTGGAGAAATGGAAATTGCATGG - Intergenic
903790847 1:25891892-25891914 GTGCTGAAATGCCCAGCACAGGG - Intronic
906075049 1:43045998-43046020 CTGCAGGAATGGAGAGTACAAGG - Intergenic
907252853 1:53154313-53154335 GAGTAGAAATGGAAAGAAAATGG + Intergenic
907767575 1:57425219-57425241 GTGCAGAAAAGGAAAGCAAGAGG + Intronic
908049658 1:60215053-60215075 GAGCAGAAATGAAAAGCCTAAGG + Intergenic
909430584 1:75583211-75583233 ATTCAGAAATGGAAAGGGCAAGG - Intronic
910226589 1:84942314-84942336 GTGTAGAATGGGAAAGAACATGG + Intronic
910268248 1:85364248-85364270 GTACAGAATTGGAAGGCAGAAGG - Intronic
910541544 1:88363941-88363963 GTAGAGAAAAGGGAAGCACATGG + Intergenic
911437091 1:97875042-97875064 ATGCAGAAATGAAAATCAAATGG + Intronic
911660276 1:100493743-100493765 ATAAAGAAATGCAAAGCACAAGG - Intronic
912565456 1:110584403-110584425 CTGTAGAACTGGAAAGAACATGG + Intergenic
913235548 1:116778365-116778387 GGGCAGAGAAGGAAAGGACAGGG - Intergenic
914437702 1:147674370-147674392 GGGCAGAAATGGAATGCAAGTGG + Intergenic
915063235 1:153203888-153203910 GTGCAGAAATGCCTAGCTCAGGG + Intronic
915537347 1:156544978-156545000 GGGCAGAGATGGTGAGCACACGG - Intronic
915548120 1:156614937-156614959 GTGAAATAATGGAAAGCACAAGG - Intergenic
916014291 1:160735247-160735269 GTGCAGAAATCCACAGCACATGG - Intergenic
916168144 1:161981445-161981467 GAGCAGAAACGGAAGGCAGAGGG - Intergenic
916473072 1:165142579-165142601 TTGCATTAATAGAAAGCACATGG + Intergenic
917392833 1:174557855-174557877 ATGCGGCCATGGAAAGCACATGG + Intronic
919770701 1:201156482-201156504 GTGCAGAAATGGTAACCACTTGG - Intronic
920254948 1:204648436-204648458 GGGAAGCAGTGGAAAGCACATGG - Intronic
922170450 1:223150141-223150163 GTGGAGAAAGGGAAAGCAGAAGG - Intergenic
923291317 1:232548906-232548928 GTACAGAAGTGGAAAGGCCAAGG + Intronic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
924040857 1:239982377-239982399 CTCCAGGAATGGAAACCACATGG - Intergenic
924620402 1:245655187-245655209 ATGGAGAAATGAAAAGCTCAGGG - Intronic
924940810 1:248811589-248811611 GAGCAGAAAGGGAAAGCAAAGGG + Exonic
1064776004 10:18778009-18778031 TTCTAGAAATGGAAAGCTCATGG - Intergenic
1065348835 10:24776680-24776702 GGGAAGAAATGTAAAGCACTAGG - Intergenic
1065903523 10:30228628-30228650 GTGCAGAAATGGAGGGCAAATGG - Intergenic
1066190956 10:33055744-33055766 GTTCAGAAATGGAAAGTTCCAGG + Intergenic
1067189906 10:44060427-44060449 CTGCAGAAAAGGAAATCTCAGGG + Intergenic
1067424865 10:46200133-46200155 GTGTAGAAAAGGAAAGGAAAAGG - Intergenic
1067445923 10:46345708-46345730 GTGAAGTAATGGGAAGCATATGG - Intergenic
1067512604 10:46908366-46908388 GAGCAGAATTGGCCAGCACAGGG - Intergenic
1067591458 10:47515036-47515058 GTGAAGTAATGGGAAGCATATGG + Intronic
1067638576 10:48023131-48023153 GTGAAGTAATGGGAAGCATATGG + Intergenic
1067649640 10:48143456-48143478 GAGCAGAATTGGCCAGCACAGGG + Intergenic
1068456281 10:57257905-57257927 ATGCAGAAATGTGAAGCTCAGGG - Intergenic
1070367147 10:75748556-75748578 TTGTAGAAATGAGAAGCACAGGG - Intronic
1070665311 10:78338430-78338452 ATGCAGAAATGGAGTCCACAAGG - Intergenic
1070848457 10:79543075-79543097 GTGAAACAATGGAAAGCACATGG + Intergenic
1070861350 10:79666351-79666373 GTGTAGAAAAGGAAAGGAAAAGG - Intergenic
1070925327 10:80217095-80217117 CTGAAACAATGGAAAGCACATGG - Intergenic
1071782732 10:88864480-88864502 GTGTAGAAATTAAAAGCACATGG + Intergenic
1073333865 10:102689975-102689997 GAGCAGAGATGGAAAAGACAGGG + Intronic
1073885907 10:108039461-108039483 GTCCAGAAATTGCAAGCACAAGG + Intergenic
1074087787 10:110221820-110221842 GGGGAGAAAGGGAAAGGACATGG - Intronic
1074232527 10:111551880-111551902 GTGAAGAAACTGAAAGCAAAAGG - Intergenic
1075584865 10:123650363-123650385 GTGAAGGAATGGGCAGCACATGG + Intergenic
1075821486 10:125316669-125316691 GTGGAAAAATAGAAAGCACCTGG - Intergenic
1076772694 10:132675221-132675243 CTGCAGAAATGGTAACCGCAGGG + Intronic
1079169153 11:18075583-18075605 GTTCAGAAAGGGCAATCACATGG + Intronic
1079176106 11:18142568-18142590 GTGCTAAAATGGGAAGAACATGG + Intronic
1079660849 11:23035193-23035215 GTGCTGAAATGGACAGGAGACGG + Intergenic
1080310611 11:30887616-30887638 GTGCAGAATTGGCAACCACAGGG - Intronic
1080450935 11:32378379-32378401 GTGCAGGAATTAAAAGGACAGGG - Intergenic
1083318825 11:61832841-61832863 GTGCAGCACGGGCAAGCACAGGG - Intronic
1084895767 11:72266709-72266731 GTTCAGGAATGCAAAGCACCAGG - Intergenic
1084955666 11:72690026-72690048 CTGCAGGCATGGAAAACACAAGG + Intronic
1086410205 11:86537600-86537622 CTGCAGAAATGCAGAGCTCAAGG + Intronic
1087015616 11:93551845-93551867 GTGCAGAGATGGAAAGAAAATGG + Intergenic
1087368268 11:97248839-97248861 CTGCAGAAAGGGAACCCACAAGG - Intergenic
1087876004 11:103358412-103358434 AGGCAGAAATGGGGAGCACATGG - Intronic
1088672433 11:112155731-112155753 GGGCAGAAAGGAAAAGCAAATGG - Intronic
1088826246 11:113496681-113496703 TTGCAGAAATAGACTGCACATGG + Intergenic
1088841901 11:113634507-113634529 GTGCAGAAAGGGAAGGAGCAGGG - Intergenic
1089138744 11:116269938-116269960 GTCCAGAAATGGATAAAACAGGG + Intergenic
1089514637 11:119024793-119024815 GCGCAGAAATGGAAAGTGAAAGG + Exonic
1090889010 11:130906314-130906336 GTGCAGAAATGATAATCCCAGGG - Intronic
1091034347 11:132219733-132219755 GTGCACCAATGGAAAGCTCCTGG + Intronic
1091511040 12:1126315-1126337 GAGCAGATATGAAAAGAACAGGG + Intronic
1092058528 12:5526668-5526690 GTCCAAAAATACAAAGCACAAGG - Intergenic
1092784695 12:12016672-12016694 CTGCAGACATGGGAACCACACGG + Intergenic
1093709649 12:22315483-22315505 GTGGGGAAATGGAAAGCAAGAGG - Intronic
1093744384 12:22722917-22722939 GAGCAAAAATGGAAAACAGAGGG + Intergenic
1094153783 12:27315651-27315673 ATGGAAAAATGGAAATCACAAGG - Intronic
1095710675 12:45284806-45284828 GCGCATAAAAGGAAAGGACAAGG + Intronic
1095714576 12:45328823-45328845 GTGCAAATATGGAAAAAACATGG - Intronic
1096193443 12:49634317-49634339 GTCCAGAACTGGAGGGCACAGGG - Exonic
1097072016 12:56361999-56362021 GTGCAGAAATTGGCAGGACAAGG + Exonic
1097915511 12:65016902-65016924 CTGAAGAAATGGAAAAAACATGG + Intergenic
1098877289 12:75879291-75879313 GTGCTGAAAAGTAACGCACATGG - Intergenic
1100767757 12:97886600-97886622 CTGCAGAAATGGTAAGCATATGG + Intergenic
1100864924 12:98847254-98847276 GGGCAGAAATGGAAAGGTGATGG - Intronic
1100909688 12:99345022-99345044 TTTCAGAATTGGAAAGGACATGG - Intronic
1103217259 12:119211599-119211621 GGGGAGATATGGAAAGCACCTGG - Intronic
1103340046 12:120216335-120216357 GTGCAGGAATGGGAAGGGCAGGG + Intronic
1104387249 12:128361711-128361733 GCCCAGGAATTGAAAGCACATGG - Intronic
1104683549 12:130768948-130768970 TTACAGAAATGGAAATCACATGG - Intergenic
1106482971 13:30150444-30150466 GAGAAGAAAGGGAAAGCAAAAGG + Intergenic
1106706086 13:32281329-32281351 GTGGACAAATGGAAAGAATATGG - Intronic
1107665877 13:42689900-42689922 GTGCAGATGTGGAATACACAGGG + Intergenic
1108352991 13:49604256-49604278 TTGCAGAAGGGGAAAGAACAAGG + Intergenic
1109229047 13:59733809-59733831 ATGCTGAATTGGAAAGAACATGG - Intronic
1109418278 13:62073534-62073556 GTGCAGAATTGGAAAAGACATGG - Intergenic
1109683274 13:65781706-65781728 TTGCAGAAATGCAAATGACAAGG + Intergenic
1110004440 13:70248702-70248724 GTGAAGAAATGGGCACCACATGG + Intergenic
1110174542 13:72540060-72540082 GTGCAGAAATGGCAAGGAATAGG + Intergenic
1110293538 13:73835577-73835599 GTGCAGAAAGGGCAAGGAAAAGG + Intronic
1110774665 13:79394214-79394236 GGGCTGGAATGGAAAGCATATGG - Intronic
1111014124 13:82355118-82355140 CAACAAAAATGGAAAGCACAAGG - Intergenic
1111367794 13:87272369-87272391 TTGCAGAGATAGAAAGCATAAGG - Intergenic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112121568 13:96418155-96418177 GCACAGAAATGCAAAACACATGG + Intronic
1112938254 13:104827580-104827602 CTGCATACATGGAAAGTACATGG - Intergenic
1113610678 13:111642765-111642787 AGGCAGAAAGGGAAAACACAGGG - Intronic
1115534682 14:34362097-34362119 GTGCAGCAATGGAAGGCTTATGG - Intronic
1118894706 14:69936099-69936121 GGGGAGAAATGAAAATCACAGGG - Intronic
1118987166 14:70766410-70766432 GTACATAAATGGAAACCATAGGG + Intronic
1119689272 14:76658121-76658143 GTGCAGGACAGGAAAGCATAAGG - Intergenic
1120624603 14:86809446-86809468 GTACAGCAAGGGAAAACACAGGG - Intergenic
1120812690 14:88820623-88820645 GTTCAGAGATGGAAAGTTCATGG + Intergenic
1121021006 14:90580088-90580110 GTGCAGAAAATCAGAGCACAGGG - Intronic
1121330509 14:93046645-93046667 GTGGTCAACTGGAAAGCACAGGG + Intronic
1121399187 14:93657242-93657264 GTGCACAAATTTTAAGCACATGG + Intronic
1121806715 14:96833042-96833064 GTGCAGAGATTGAAAACATAAGG - Intronic
1121961800 14:98266750-98266772 GAGATGAAATGGAAAGCCCATGG - Intergenic
1122301068 14:100731453-100731475 GTGCAGAAAGAGAGACCACAGGG + Intronic
1124014950 15:25866106-25866128 GGGAAGAAATGGTAAGCACGGGG + Intergenic
1125462217 15:39918223-39918245 CTACAAAAATGGAAAGGACATGG + Intronic
1128212178 15:65910470-65910492 GTGATGACATGGAAAGGACACGG - Intronic
1128539550 15:68517061-68517083 GTGGAGAAAAGGAAAGCATTTGG - Intergenic
1128548343 15:68582011-68582033 GTGGAGAAGAGGAAAGCAGATGG + Intronic
1129531024 15:76264845-76264867 ATGTAGAAATGGAAATCAAAAGG + Intronic
1130904442 15:88229930-88229952 GTACAGAACTGGGTAGCACAGGG + Intronic
1132444979 15:101907683-101907705 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1133379781 16:5320321-5320343 GTGCAGAGTTGGGAAGTACATGG + Intergenic
1133835357 16:9362804-9362826 GTGCAGGAGAGGAAAGCATAAGG - Intergenic
1133841090 16:9410089-9410111 GTGCAGAAAAGGAAAATCCATGG - Intergenic
1135106867 16:19657413-19657435 CTGCAGAAATGGGAAGGCCAAGG - Intronic
1135666787 16:24342483-24342505 AGGCAAAAATGGAAAGCAAAGGG - Intronic
1135866043 16:26102965-26102987 GTGCAGAAGTGGAAAGAACATGG + Intronic
1135933029 16:26755540-26755562 GTGCAGAAATAGAAGGCTCGAGG - Intergenic
1137366081 16:47860862-47860884 ATGCAGAAATGGAAAGAATGTGG - Intergenic
1138318604 16:56091536-56091558 ATGCAGCCATGGAAACCACAAGG + Intergenic
1138666972 16:58578665-58578687 ATGAAAAAATGGTAAGCACACGG + Intronic
1140788826 16:78369830-78369852 GTGCTGTAATGGAAACCATAAGG + Intronic
1141025425 16:80541722-80541744 GTGGAGAAATGGAAAGGCCAGGG + Intronic
1141794483 16:86261196-86261218 GTGGAAAGATGGAAAGAACATGG + Intergenic
1142158230 16:88542708-88542730 GTGCGGGAATGGGAAGCACCAGG + Intergenic
1142493661 17:294518-294540 GTGCAGAAATGGACGGCAGAGGG + Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1143560293 17:7689691-7689713 ATGCAGAAATGGTAAGGACTGGG + Exonic
1144456549 17:15423447-15423469 GTGCTGAAATGGAGGGCACGTGG + Intergenic
1145408216 17:22629275-22629297 GTGTAGAAAGGGAAAGGAAAAGG + Intergenic
1147217276 17:38908212-38908234 GTGCAGACACGGAATGGACAGGG - Intronic
1147841831 17:43377353-43377375 GTACAGAAACGTTAAGCACAGGG + Intergenic
1147935737 17:44009733-44009755 GGGCAGAAATCCAAAGCCCAGGG + Intergenic
1148971964 17:51491465-51491487 ATGGTGAAATGGATAGCACAAGG - Intergenic
1150179124 17:63096428-63096450 TTGAAGAAATGGAGAGAACATGG + Intronic
1150591474 17:66566316-66566338 GTCCAGAAGTGGAAAGAAGATGG + Intronic
1150819110 17:68420672-68420694 GTGCCTTAATGGGAAGCACACGG + Exonic
1152713134 17:81884869-81884891 GGGCAAAAAAAGAAAGCACAGGG - Intergenic
1155509918 18:26566351-26566373 GTGCAGCCAGGGAAAACACAGGG - Intronic
1155795293 18:30027851-30027873 ATGAAGAAATGGAAAGCAAAAGG - Intergenic
1156373526 18:36492112-36492134 GTGGAGGACTGGAAAGAACACGG - Intronic
1157131144 18:45008524-45008546 TTGCAGAGATGGAAAGAAAAAGG + Intronic
1158081594 18:53598960-53598982 ATGCAGAAATGCTAAGCACAAGG + Intergenic
1158289593 18:55924301-55924323 GGGCTAAAATGGCAAGCACATGG + Intergenic
1158675750 18:59516549-59516571 GTGCTGAAAAGGAAAGTCCAGGG + Intronic
1159234051 18:65648118-65648140 GAGGAGAAGAGGAAAGCACAGGG + Intergenic
1160640336 19:126034-126056 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1161996647 19:7717017-7717039 GTGAAGACATGGCAAGAACATGG + Intergenic
1162129620 19:8518133-8518155 ATTCAGAGATGGAAAGCACTAGG + Intergenic
1162252304 19:9455995-9456017 GTGTAAAAAAGGAAAGCACTGGG + Intergenic
1163715915 19:18872028-18872050 GGGCAGGAATGGAAAGCACGGGG - Intronic
1164261092 19:23569286-23569308 TTGGTGAAATGGAAAGCACCCGG - Intronic
1164389474 19:27805576-27805598 GTGCACAAATGCAGAACACATGG - Intergenic
1165668451 19:37654884-37654906 ATGCACAAATGGAAACGACAGGG + Intronic
1166476164 19:43126698-43126720 TTGCAGAAATGAAAAACACGTGG - Intronic
1167172742 19:47844026-47844048 GGGAAGAGATGGAAAGCAAAGGG - Intergenic
1167728961 19:51239067-51239089 CTGCAGTACTGGAAATCACAGGG + Intronic
1168024234 19:53632171-53632193 GTGAAGAAGTGGAAAGCAGCTGG + Intronic
1168446864 19:56425848-56425870 TTGGAGAAAGGGAAAACACATGG - Exonic
1168456061 19:56509359-56509381 GTGAAGAAATGCATAGGACAAGG - Intronic
925119745 2:1409018-1409040 TTGTAGAAACGCAAAGCACAGGG + Intronic
925885045 2:8388177-8388199 GTGCAGAAATGGAGAAAACAAGG + Intergenic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
927851554 2:26503193-26503215 GGGGAGAAATGGAGAGGACAGGG - Intronic
928693928 2:33829576-33829598 GTGCAGAGATAGATAACACATGG + Intergenic
929077452 2:38090116-38090138 GTACATAAATAGAAGGCACATGG - Intronic
929387807 2:41431863-41431885 AGGCAGAAATGGAAATTACATGG - Intergenic
931296390 2:60930098-60930120 ATGGAGAAATGGAAAGAATAGGG + Exonic
931428390 2:62191342-62191364 GTGAAGAAATGAAAGGCACAAGG - Intergenic
931774432 2:65528250-65528272 CTGCAGGAATGGAAAGGAAAGGG + Intergenic
933605190 2:84375289-84375311 TCACAGAAATGGATAGCACAGGG + Intergenic
935251966 2:101270965-101270987 TTGCAGAAATGCAAAAAACATGG + Intergenic
935611994 2:105035501-105035523 AGGCAGAAATGGAATCCACAGGG - Intergenic
938341275 2:130538151-130538173 CTGCACTCATGGAAAGCACAAGG + Intergenic
938348556 2:130582558-130582580 CTGCACTCATGGAAAGCACAAGG - Intronic
938588057 2:132711201-132711223 GGAGAGAAAGGGAAAGCACATGG - Intronic
940823172 2:158380633-158380655 GTATAGAAATGCAAAGGACAAGG + Intronic
942019821 2:171855980-171856002 GTGAAGAAAGGGAAAGCATCAGG + Intronic
945179238 2:207074969-207074991 TTGGAGAAAGGGAAAGCAAAAGG - Exonic
946185195 2:217976827-217976849 GTCAAGAGATGGAAAGCAAAAGG + Intronic
948841572 2:240652911-240652933 ATTAAGAAATGGAAAGAACATGG + Intergenic
1168803166 20:656749-656771 GTGGAGAAATGGAAAGGCAAAGG + Intronic
1171172655 20:23029236-23029258 GTGCAGAAATGGAAAGGCCATGG - Intergenic
1172408689 20:34707025-34707047 CTGCAGAAATGGAAACACCAAGG - Intronic
1173485812 20:43440240-43440262 GGGCAGAAATGGGAAGAACTGGG - Intergenic
1174005189 20:47405018-47405040 GTGAAGAGATGGAAAGAATAAGG - Intergenic
1174705056 20:52646960-52646982 GTGCTGAAATGGGAAGTAGAAGG - Intergenic
1175005840 20:55682041-55682063 GTAGAGATAGGGAAAGCACAAGG - Intergenic
1175621922 20:60454677-60454699 GTGGAGACATTGAAAGGACAGGG - Intergenic
1177683600 21:24408499-24408521 AAGCAGAAATGGAAAGAAAATGG + Intergenic
1178051746 21:28755083-28755105 GTGCAGAGATGGGAAGTCCAGGG + Intergenic
1178642568 21:34356856-34356878 GTGCAAAAATGGAAAGAACTAGG + Intergenic
1178971672 21:37183785-37183807 GTGCAGAAGTGGAAGCCACTAGG + Intronic
1179479224 21:41667068-41667090 AGGCAGAAAGGGGAAGCACATGG + Intergenic
1179838955 21:44057947-44057969 GTGCAGTAATGGAGATCAGAAGG + Intronic
1180579922 22:16824500-16824522 GAGCACAAATGGAAAGAAAAAGG + Intergenic
1181568342 22:23752828-23752850 GGGCAGAAATGGGAGGCAGAGGG + Exonic
1182434633 22:30322485-30322507 GTGAAGAAATGGAAAGGCCTAGG + Intronic
1182886287 22:33776939-33776961 ATGCAGAGATGGTCAGCACATGG + Intronic
1182966465 22:34526208-34526230 CTGTAGAGATGGAAAGCATATGG - Intergenic
1183085150 22:35482412-35482434 GTGCAAAAATTGAAAGCAGCAGG - Intergenic
1183141191 22:35941518-35941540 CTGGAAAAATGGAAAGAACAGGG - Intronic
1183506444 22:38211756-38211778 GTGCAGAAATGGAAAGCACATGG - Intronic
1183959233 22:41401218-41401240 GTGCAGCCACGGCAAGCACAGGG + Intergenic
949143539 3:665871-665893 GTGAAGAAATGGAAAGAAGCTGG - Intergenic
949906549 3:8863165-8863187 GGGCAGGAAGGGAAAGAACAAGG - Intronic
949988568 3:9559170-9559192 GTGCAGAAATGGAACTCAGATGG - Intergenic
950151211 3:10688925-10688947 GTGCAGATGTGGAAACCACCTGG + Intronic
950666310 3:14497425-14497447 GAGCTGAAATTGAAAGGACAAGG + Intronic
952233631 3:31456522-31456544 GTGCAGAAAAGGGGAACACAAGG - Intergenic
952617763 3:35295795-35295817 GTGCAGAAATCGAATACAAACGG - Intergenic
952722651 3:36549292-36549314 CTGCAGAAATTAAAAGCACAAGG + Intergenic
953708575 3:45250073-45250095 GTGGAGCAATGGAAAGAACCTGG + Intergenic
955299044 3:57759836-57759858 GTACAGCCATGGAAAGCACTGGG - Intronic
956042156 3:65155867-65155889 GTGAAGAAATGGGAATCACTGGG + Intergenic
956388940 3:68751127-68751149 GTGCAGAAATGAAAAGAAATGGG + Intronic
956411134 3:68980967-68980989 GGGAAGAAATGGAAAGAACTGGG - Intronic
958179227 3:90036185-90036207 GACACGAAATGGAAAGCACATGG - Intergenic
958260105 3:91370102-91370124 GTACTGCAATGGAAAGCTCAAGG + Intergenic
958996861 3:100915291-100915313 GTGCAGAAATGGCAATCCCTTGG - Intronic
960156119 3:114298564-114298586 GAGGACAGATGGAAAGCACAGGG - Intronic
960810376 3:121622265-121622287 GTACAGCCATGGAAACCACAGGG + Exonic
961170738 3:124796193-124796215 GTGCAGAATACGAAAGCAGAAGG - Intronic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961389718 3:126545111-126545133 GTGCAGAGCTGGACAACACAGGG + Intronic
962149739 3:132880176-132880198 AAGCAGAAATGGAAAGAACCTGG - Intergenic
962296982 3:134199357-134199379 GTTCATGAATGTAAAGCACAGGG + Intronic
963958328 3:151280203-151280225 ATGGAGAAATGGAAAGCTAAAGG + Intronic
964029721 3:152123248-152123270 GTTCAGATATGCAAAACACACGG + Intergenic
965195736 3:165591749-165591771 GAGGAGACATGGAAAGCACTAGG - Intergenic
966161402 3:176972555-176972577 GTGAAGAAATGGGAAGCCCTAGG + Intergenic
966627699 3:182036487-182036509 GTGAAGAAAAGGAAAGGAAAGGG - Intergenic
966959697 3:184922871-184922893 GAGAAGAAATGGAAAGGAAATGG + Intronic
967529608 3:190533498-190533520 GTTCAGACAGGGGAAGCACAGGG - Intronic
967835330 3:193957760-193957782 GTTCTGAAATGGTAACCACATGG - Intergenic
968919063 4:3513266-3513288 ATGCTGAAGTGGAAAGCTCAGGG + Intronic
969124648 4:4937685-4937707 GTGCAGAAATGGAAATCCACTGG + Intergenic
969709447 4:8834426-8834448 GTGCACAAAAGGAAACCACAGGG - Intergenic
970608005 4:17699758-17699780 CTGCAGAAATGGCAAACAAATGG + Intronic
971150975 4:24031271-24031293 GGCCAGAAATGGAATGCAAATGG - Intergenic
972024758 4:34362760-34362782 TAACAGGAATGGAAAGCACATGG + Intergenic
972170714 4:36342353-36342375 GTTCAGTAATGGAAGGCAGATGG + Intronic
972656254 4:41066563-41066585 GTCCAGAAATGGACAGGTCAGGG + Intronic
972946490 4:44263106-44263128 CTGCAGCAACGGAAAGCATATGG + Intronic
975589475 4:75986034-75986056 CTGTAGAGAAGGAAAGCACAGGG - Intronic
976653937 4:87467008-87467030 GTGCAGACTTGAAAAGCACAAGG - Intergenic
976782325 4:88774817-88774839 GTGAAGAAAAGGAAAGGACTTGG + Intronic
977448707 4:97165921-97165943 GTTCTGAAAGGGAAAGAACAAGG + Intergenic
977535640 4:98253712-98253734 GTGATGAAATGGAAAGACCATGG + Intergenic
977734916 4:100402715-100402737 GTACAGAAATGGAAAGGAATGGG + Intronic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
978745707 4:112191763-112191785 GTGCTGACCTGGAAAGCACAGGG - Exonic
979544807 4:121927883-121927905 TTTCAGGAATGGAAAGCAGATGG - Intronic
979625419 4:122839684-122839706 CTGCAGAAATGAAATGGACAGGG - Intronic
981488083 4:145308843-145308865 GTGCAAAAAGGGAAAACCCAAGG + Intergenic
981781401 4:148435170-148435192 GTGGAGTCATGGAAATCACACGG - Exonic
982112948 4:152072828-152072850 CTGCAGAAAAGGAAGGCACCAGG + Intergenic
982850445 4:160308721-160308743 GTTCAGAAATTGAAAGCATTAGG + Intergenic
984050993 4:174865106-174865128 GTGAAGACATGGAGAACACAAGG + Intronic
984299595 4:177898008-177898030 ATGCACAAACAGAAAGCACAAGG - Intronic
984408852 4:179370065-179370087 GTGAAGGCATGGAAGGCACATGG + Intergenic
987387984 5:17348251-17348273 GAGCAGAAGTGGAAAGCATGAGG + Intergenic
987831244 5:23098534-23098556 GCTCAGAAATGGAAAATACAAGG - Intergenic
988692751 5:33588885-33588907 GGGCAGAAATGCAGATCACAGGG + Intronic
989041387 5:37233135-37233157 CTCCAGAAAGGGAAAACACATGG + Intronic
989961278 5:50418611-50418633 GTGGATAAATGAAAAGCACATGG - Intronic
992233923 5:74688857-74688879 GAGCAGAGATGGAAAGAATATGG - Intronic
993180084 5:84541445-84541467 GTGAAGGAGAGGAAAGCACATGG - Intergenic
993679863 5:90862973-90862995 GGGTAAAAATGCAAAGCACATGG + Intronic
995097399 5:108254426-108254448 GTGGAGAAAAGGAAAGCATTCGG - Intronic
995455534 5:112347968-112347990 GTGCAGATATGGTAAGCAGTAGG - Intronic
998190009 5:140015639-140015661 ATCCAGAAATGGAAAGCTCCAGG - Intronic
998737261 5:145156630-145156652 TTGCAGAACTAGAAAGGACAAGG + Intergenic
998867704 5:146521918-146521940 GTGCAGAACTGCAAAGCTGAGGG - Intergenic
999181999 5:149676308-149676330 GGGGAGAAATGGGAAGCAGAGGG + Intergenic
999998286 5:157113262-157113284 GTGATGAAATGTGAAGCACAAGG - Intronic
1000579817 5:163022218-163022240 ATGCAGAAATGAAAAAGACAAGG - Intergenic
1000586109 5:163100913-163100935 TTAAAGAAATGGAAAGAACATGG - Intergenic
1001237394 5:170041891-170041913 GAGGAGAGATGGAAAGGACAGGG + Intronic
1002737014 5:181400381-181400403 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1002747685 6:74437-74459 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1002958388 6:1891171-1891193 CTGTAGAAATGGAAACCACGTGG - Intronic
1003448043 6:6202968-6202990 GTGTACAAATTCAAAGCACATGG - Intronic
1005247436 6:23904172-23904194 GAGCAACAATGGAAAGCAGAAGG + Intergenic
1005814795 6:29541768-29541790 GTGCAGAAATGGAAGGTAGATGG - Intergenic
1006065423 6:31458127-31458149 CACCAGAAATGGTAAGCACATGG - Intergenic
1008006169 6:46411819-46411841 GTGCAGAAATGTAATGGGCAAGG + Intronic
1008057810 6:46963337-46963359 TTGCAGAAGAGGAAAGGACAAGG - Intergenic
1008995131 6:57650302-57650324 GTACTGCAATGGAAAGCTCAAGG - Intergenic
1009024866 6:57986550-57986572 GTGCAGAGAAGAAAAGTACAAGG - Intergenic
1009058175 6:58364451-58364473 GAGAAGAAATGGAAAGCTGAGGG + Intergenic
1009183667 6:60549062-60549084 GTACTGCAATGGAAAGCTCAAGG - Intergenic
1009232650 6:61082662-61082684 GAGAAGAAATGGAAAGCTGAGGG - Intergenic
1009589816 6:65653148-65653170 GTGAAGAAATAGAAAACACAGGG - Intronic
1011390454 6:86846808-86846830 TTGCAGAAATGGAGAGAGCAAGG - Intergenic
1012080846 6:94756671-94756693 GTACAGAAATGGAAGACTCATGG + Intergenic
1013063546 6:106660824-106660846 GGAGAGAAAGGGAAAGCACATGG + Intronic
1013648939 6:112174238-112174260 GAGCAAGAATGAAAAGCACACGG - Intronic
1013697536 6:112721612-112721634 CTCCAGAGATAGAAAGCACATGG - Intergenic
1014855006 6:126389472-126389494 TTGCAGAAATGGAAAAGAAAAGG - Intergenic
1015000956 6:128214705-128214727 GTGAAGAATTGGAAAGAACGTGG + Intronic
1015084481 6:129272516-129272538 GTAGAGATTTGGAAAGCACATGG - Intronic
1015253521 6:131152442-131152464 GTTCAGTAATGAAAAGCACACGG + Intronic
1015712152 6:136153869-136153891 GAGCAGAGATGGACAGCAGAGGG - Intronic
1016614350 6:146029090-146029112 GTGCCGAAATGAAACGGACAAGG + Intronic
1016922926 6:149313995-149314017 AAGCAGAAATGGAAAGGACCTGG + Intronic
1017183494 6:151576969-151576991 GGGGAAAAATGGATAGCACAGGG - Intronic
1017357257 6:153524224-153524246 GTGCAGAATTGGGAAGGTCATGG + Intergenic
1017791656 6:157805132-157805154 GGCCAGAAGTGGAAAGCACTGGG - Intronic
1019242111 6:170675915-170675937 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1019358637 7:593856-593878 GTGCATAAATGAGAAGCTCATGG + Intronic
1019369451 7:653307-653329 GTACAGAAATGGACAGAACCTGG - Intronic
1019606448 7:1912579-1912601 GTGCAGGGATGGGGAGCACAGGG - Intronic
1020402348 7:7793405-7793427 GTGAAGTAGTGGAAAGAACAGGG - Intronic
1020490048 7:8770819-8770841 ATGTAGAATTGGAAAGCAGAAGG + Intergenic
1023025458 7:36045861-36045883 TTGCAGAAGTGAAAAGGACAAGG + Intergenic
1023576098 7:41628769-41628791 GTGCAGAGAGTGATAGCACAGGG - Intergenic
1024337787 7:48226706-48226728 GTGCAAAAATAGAAGGAACATGG - Intronic
1028300949 7:89200039-89200061 GTTCAAACATGAAAAGCACAAGG - Intronic
1028532278 7:91851405-91851427 GTGCAGAAAAGGAAAGCAGCAGG + Intronic
1031149889 7:118041416-118041438 GTGCAGAAAGTCAGAGCACATGG - Intergenic
1031374230 7:121004545-121004567 GTGCAGAAGTGAAATGCAAAGGG + Intronic
1033847543 7:145452662-145452684 GGGGAGAAATGGAGAACACAGGG + Intergenic
1034683841 7:152952305-152952327 GTGCAGAACTGGACAGAACAAGG - Intergenic
1035102758 7:156415031-156415053 GTTCAGAATTGGAAAGGAAAGGG + Intergenic
1035506007 8:132185-132207 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1035621500 8:1038659-1038681 TTACAGAAATAGAAACCACAGGG - Intergenic
1036412852 8:8518710-8518732 GAGCAAAAATGGAAACCAAAAGG + Intergenic
1036474585 8:9081563-9081585 GTGAAGAAATGGGTAGCAGAGGG - Intronic
1036824581 8:11966217-11966239 TTGCAGAAATACACAGCACAGGG - Intergenic
1039322829 8:36451737-36451759 GTGCAGGAGTTCAAAGCACATGG - Intergenic
1039687116 8:39815186-39815208 GTGAAGAAATGGAAAGTGCTAGG + Intronic
1040758557 8:50809681-50809703 GTACAGAAAAGGAAAGCAATAGG - Intergenic
1042041023 8:64588740-64588762 CTGCAGAAATAGACTGCACATGG - Intronic
1042674873 8:71308921-71308943 GGCCAGAGATGGAAAGCAAATGG - Intronic
1043004017 8:74795989-74796011 GAGCAGCAATGGAAAGCAGAGGG + Intronic
1043236636 8:77876291-77876313 CAGGAGAAATGGAAATCACAGGG + Intergenic
1043571851 8:81612875-81612897 GTGGACAAAAAGAAAGCACAAGG + Intergenic
1044491393 8:92820765-92820787 TTGCAGAAATGGAATGCATGTGG + Intergenic
1045056339 8:98371509-98371531 GTGCAGTAGGAGAAAGCACAAGG + Intergenic
1045641656 8:104257968-104257990 TTGCAGAAATGTACAGCAAATGG + Intergenic
1046159420 8:110340927-110340949 GAGGAGTAATGGAAAGAACATGG + Intergenic
1047755590 8:127915950-127915972 GTGAATATGTGGAAAGCACAGGG - Intergenic
1048206646 8:132420766-132420788 CTCCAGAAATGCAAAACACATGG - Intronic
1049081991 8:140450728-140450750 CATCAGAAAGGGAAAGCACAGGG - Intronic
1051168767 9:14296322-14296344 GAACAGAAAAGCAAAGCACATGG + Intronic
1051194198 9:14545536-14545558 GGGGAGAAATGGAAAGAAGACGG + Intergenic
1051438932 9:17062360-17062382 GTGCAGAAGTGTCAAGCTCATGG + Intergenic
1051563202 9:18466138-18466160 TGGCAGTTATGGAAAGCACAGGG - Intergenic
1052466402 9:28835854-28835876 GTGCAGTAATAGAAAGAAAATGG - Intergenic
1053341105 9:37333426-37333448 GGGCAGGAATAAAAAGCACAGGG - Intronic
1054871306 9:70049339-70049361 GTGCAGAACTGAAACGCAGATGG - Intronic
1054882847 9:70163164-70163186 GAGCAGAAATGCAAGGCAGATGG - Intronic
1055914722 9:81389380-81389402 GGGGAGAGATGGAAGGCACAGGG + Intergenic
1056926636 9:90840041-90840063 GGGCAGCAGTGGAAAGGACAGGG + Intronic
1058759748 9:108119460-108119482 GTTCAGCTATGGAGAGCACAGGG + Intergenic
1060336336 9:122726693-122726715 CTTCAGAAGTGGAAACCACATGG + Intergenic
1060721980 9:125985660-125985682 GTGCAGAGATGGACAACACCTGG - Intergenic
1061049732 9:128187350-128187372 GTGCTGGGATGGGAAGCACAGGG + Intronic
1203602302 Un_KI270748v1:25149-25171 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1185776685 X:2808949-2808971 GTCCAGAGATGGAAAGGGCAAGG + Intronic
1186185796 X:7018563-7018585 TTGCAGAAATGAAAAACACATGG - Intergenic
1187536464 X:20145633-20145655 GGGTGGAAATGGAAACCACACGG + Intergenic
1187589379 X:20699740-20699762 ATGCAGAAATTGAAGGCAGATGG + Intergenic
1188459493 X:30407272-30407294 CTACAGAAATGGAAAGAAGAGGG - Intergenic
1189279420 X:39810707-39810729 GCACAGAAATGGTAAGCACAAGG + Intergenic
1193443914 X:81576964-81576986 GTTCAGAAATCGAAGGCCCATGG - Intergenic
1193463436 X:81817785-81817807 GTGCAGAAAAATAAAGCACCAGG - Intergenic
1193682475 X:84539705-84539727 GTATAAAAATAGAAAGCACAAGG - Intergenic
1194824412 X:98543741-98543763 GTTCACATATGGAAGGCACATGG - Intergenic
1197284052 X:124574571-124574593 AGGCTGAAAGGGAAAGCACAGGG + Intronic
1197655449 X:129111754-129111776 GAGCAGATTTGGAAAGAACACGG - Intergenic
1197821941 X:130550360-130550382 TTCCAGAAATGAGAAGCACAAGG + Intergenic
1199272415 X:145899319-145899341 CTGCAGAAATGGAAGGCAGCAGG - Intergenic
1199964994 X:152812251-152812273 GGGCAGGAATGCAAACCACAGGG - Intergenic
1199971913 X:152867565-152867587 CTGCAGAAATGGGAAGAACTTGG + Exonic
1200270173 X:154675330-154675352 GTGCAGAGATGGTATGAACAGGG + Intronic
1201293302 Y:12442519-12442541 GTCCAGAGATGGAAAGGGCAAGG - Intergenic