ID: 1183507137

View in Genome Browser
Species Human (GRCh38)
Location 22:38215446-38215468
Sequence GTTGTGTTGGGACCAAAACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183507133_1183507137 1 Left 1183507133 22:38215422-38215444 CCTGAGGTCACATTTCACTTAGT 0: 1
1: 0
2: 1
3: 17
4: 150
Right 1183507137 22:38215446-38215468 GTTGTGTTGGGACCAAAACCTGG 0: 1
1: 0
2: 1
3: 1
4: 76
1183507130_1183507137 25 Left 1183507130 22:38215398-38215420 CCAGTTCACGGATGGGGAAACAG 0: 1
1: 0
2: 16
3: 209
4: 1544
Right 1183507137 22:38215446-38215468 GTTGTGTTGGGACCAAAACCTGG 0: 1
1: 0
2: 1
3: 1
4: 76
1183507129_1183507137 26 Left 1183507129 22:38215397-38215419 CCCAGTTCACGGATGGGGAAACA 0: 1
1: 0
2: 15
3: 185
4: 1462
Right 1183507137 22:38215446-38215468 GTTGTGTTGGGACCAAAACCTGG 0: 1
1: 0
2: 1
3: 1
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183507137 Original CRISPR GTTGTGTTGGGACCAAAACC TGG Exonic
900780820 1:4616130-4616152 GTTGTGTTGGGTGCTAAACCCGG + Intergenic
902239891 1:15081411-15081433 GATGTCTAGGGAGCAAAACCAGG + Intronic
903694384 1:25196318-25196340 GGAGTGTGGGGACCAACACCCGG + Intergenic
905083269 1:35344811-35344833 ATTGCCCTGGGACCAAAACCAGG - Intronic
908855404 1:68421239-68421261 TTTTTGTTGTAACCAAAACCTGG + Intergenic
909722435 1:78791293-78791315 GTTGAGTTGAAACCAAAATCTGG + Intergenic
912174310 1:107139137-107139159 GTTGAGTTGGGCCTATAACCAGG - Intergenic
922536555 1:226385457-226385479 GATCTGTTGGGAGAAAAACCTGG - Intronic
924919385 1:248611900-248611922 GCTGTGTTTGGGCCCAAACCAGG - Intergenic
1063104144 10:2977966-2977988 GGTGTTTAAGGACCAAAACCAGG + Intergenic
1069860898 10:71471219-71471241 GTTGTGGTGGGAGCAAGAGCCGG - Intronic
1070754877 10:78985739-78985761 GCTGTATTGGGACCAAGCCCAGG + Intergenic
1071996143 10:91151309-91151331 GTGGTCTTGGGATCAACACCTGG - Intergenic
1072458753 10:95600527-95600549 GTTGTCTTGGGTTCAAATCCAGG + Intergenic
1075505501 10:123017856-123017878 GTTGAGTTGGGCTAAAAACCTGG + Intronic
1076845743 10:133068709-133068731 GGTGTGTGGGGGCCAAATCCCGG + Intergenic
1080997415 11:37620307-37620329 TTTTTGTTTGGATCAAAACCCGG - Intergenic
1082262747 11:50089893-50089915 GGTGTGCTGGGACCTAAAGCAGG - Intergenic
1085423524 11:76383175-76383197 GTTGTGTGGGGAGGAAGACCAGG + Intronic
1095915031 12:47469397-47469419 CTTGTGTTGAGTCCAAAACATGG + Intergenic
1100817257 12:98398178-98398200 GGTATGTTGGGACAAAGACCAGG + Intergenic
1102700448 12:114834686-114834708 GTTGTTTTGGCTCCAAAAGCTGG + Intergenic
1108373104 13:49790630-49790652 GTAATGTTGTGACCAATACCAGG + Intronic
1113758197 13:112828700-112828722 GTTCTGTCCTGACCAAAACCAGG + Intronic
1116756825 14:48958466-48958488 GTTGGGTTGGTACCAAAAGGTGG + Intergenic
1125680363 15:41526830-41526852 GTTGGGTTGGGAGCTAAACATGG - Intronic
1131157934 15:90086318-90086340 ATTGTGTTGGGAACAAGAGCAGG - Intronic
1138045154 16:53714772-53714794 CTTGTGTTGGAACCACAGCCAGG + Intronic
1138176216 16:54900629-54900651 CCTCTGTGGGGACCAAAACCAGG + Intergenic
1138502559 16:57456771-57456793 GCTGTGATGGGACTGAAACCTGG + Intronic
1139300991 16:65945346-65945368 GCAGAGTTGGGACCAAAGCCTGG + Intergenic
1151006608 17:70445017-70445039 GGTGTTTAGGGACCAAAATCTGG - Intergenic
1152130443 17:78472944-78472966 GTTTTCTTGGGACCAAGCCCAGG + Intronic
1152269193 17:79313812-79313834 GTTGTGGTGGGCTCAAGACCTGG - Intronic
1153007904 18:513695-513717 TCTGTGCTGGGACTAAAACCTGG - Intergenic
1153690389 18:7586499-7586521 TTAGGGTTGGGAGCAAAACCAGG + Intronic
1157979173 18:52361089-52361111 GTCATGTTGAGACAAAAACCTGG + Intronic
1159408257 18:68034708-68034730 GTTTTGTTGGGAACTAAACAGGG - Intergenic
925985824 2:9213886-9213908 CTTGTGTTGGGACCAGTTCCAGG + Intronic
926844666 2:17123237-17123259 GTAGTGTTGTAACCAAAAGCAGG + Intergenic
928356991 2:30625726-30625748 GTTTTGATGGGTACAAAACCAGG + Intronic
935878125 2:107534517-107534539 GTGGTGTTGGGAACAATGCCTGG - Intergenic
942367751 2:175246078-175246100 GTTGGGTTGGGTTTAAAACCAGG - Intergenic
947023697 2:225712729-225712751 TTTGGTTTGGGACAAAAACCTGG + Intergenic
947352004 2:229256033-229256055 CTTGTGTTGGAAACAGAACCAGG - Intronic
1170031264 20:11946723-11946745 GCTGTGTTAGGAACCAAACCAGG + Intergenic
1172553396 20:35819406-35819428 GTTGTGTTTGGAGCAAGAACAGG - Intronic
1173086508 20:39924365-39924387 TTTGTTTTGGGATCAAATCCAGG + Intergenic
1176672417 21:9746913-9746935 ATTGTGTTGGGAACAAAAAGTGG - Intergenic
1177940061 21:27399099-27399121 TTTGTGTTGGGAGAAAACCCAGG - Intergenic
1179526169 21:41977286-41977308 GTTGTGTAAGGAACAAAAACAGG - Intergenic
1180217746 21:46336650-46336672 ATGGTGTTGAGACCAAGACCTGG + Intronic
1183507137 22:38215446-38215468 GTTGTGTTGGGACCAAAACCTGG + Exonic
1185172587 22:49302431-49302453 GTTGTTTTGAGAATAAAACCAGG + Intergenic
950936313 3:16842959-16842981 GCTGTGGTGGGCCCAAGACCAGG + Intronic
952286606 3:31975579-31975601 GTTGTGGTGGGCCCTAAATCAGG + Intronic
952389545 3:32868221-32868243 GTTGTGTTGAGAACAGAAACTGG + Intronic
953333922 3:42078070-42078092 GTTGAGGTGGGACTAAATCCAGG + Intronic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
978683423 4:111411269-111411291 ATTGTCTTGATACCAAAACCTGG - Intergenic
985939420 5:3122578-3122600 GCTGTGGTGCCACCAAAACCGGG + Intergenic
987569443 5:19637398-19637420 GTAGTGTAGGGACCAGAACAAGG - Intronic
997564892 5:134879435-134879457 GTTGGGTTGGACCCCAAACCTGG + Intronic
1002589018 5:180275412-180275434 CTTGTGTTGGGACCAATAAAAGG - Intronic
1005127891 6:22469946-22469968 GTTGTCTTGATACCAAAACTTGG - Intergenic
1017030290 6:150214923-150214945 GTGGTGTTGGCACCAGGACCTGG + Intronic
1020103229 7:5407269-5407291 GCTATGCTGGGACCAGAACCAGG + Intronic
1025858956 7:65308605-65308627 GGTGTGCTGGCACCCAAACCAGG - Intergenic
1028244346 7:88458963-88458985 GTTGTTTTAGGACCATATCCTGG + Intergenic
1029666797 7:102000648-102000670 GTTGTGTGAAGGCCAAAACCAGG - Intronic
1041691229 8:60689493-60689515 GTAGTGTTGGGACTCAAAGCAGG + Intronic
1043829932 8:84975719-84975741 TTTGTGTTGCCACCAAATCCTGG - Intergenic
1050770486 9:9192476-9192498 TTTCTGTTGGGATTAAAACCAGG - Intronic
1061093232 9:128438850-128438872 GCTGGGTTGGGGCCAACACCAGG + Intergenic
1188766120 X:34093709-34093731 GTTATGCTGATACCAAAACCAGG + Intergenic
1189166204 X:38863565-38863587 GTTATGATGGGATCAAAGCCAGG + Intergenic
1190997101 X:55620500-55620522 TTTGAGTGGGGACCAAAATCTGG + Intergenic
1192411495 X:70936991-70937013 GTTGTGTTGGGAGAAGAAACTGG - Intergenic
1192437118 X:71149728-71149750 GCAGAGCTGGGACCAAAACCTGG + Intronic