ID: 1183509570

View in Genome Browser
Species Human (GRCh38)
Location 22:38227011-38227033
Sequence CGGAGGGGATGGAGGGACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1601
Summary {0: 1, 1: 1, 2: 4, 3: 102, 4: 1493}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183509570 Original CRISPR CGGAGGGGATGGAGGGACGA AGG Intronic
900003525 1:29232-29254 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900023245 1:199748-199770 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900102854 1:970221-970243 CGGAGGGGGTGGGGGGCCCAGGG + Intronic
900110008 1:1001398-1001420 CGAAGGGGGCGCAGGGACGAGGG + Intergenic
900204717 1:1427059-1427081 GGGGGGAGATGGAGGGATGAAGG - Intronic
900300241 1:1973449-1973471 GGGAGGGGATGGAGGCCAGAAGG + Intronic
900482646 1:2906681-2906703 CTCAGGGGAGGGAGGGAGGAAGG + Intergenic
900569744 1:3352387-3352409 CGGAGGGGAGGGAGGGTCAGTGG - Intronic
900681730 1:3920288-3920310 AGGAAGGGAGGGAGGGAGGAGGG - Intergenic
900926747 1:5710750-5710772 AGGAAGGGAAGGAGGGAAGAGGG + Intergenic
900932128 1:5744106-5744128 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
900932136 1:5744126-5744148 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
900932151 1:5744166-5744188 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
900932158 1:5744182-5744204 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
900932192 1:5744266-5744288 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
900932200 1:5744286-5744308 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
901128048 1:6943166-6943188 CGGAGGGGAGGAGGGGAGGAGGG - Intronic
901258988 1:7857264-7857286 GGGAGAGGAAGGAGGGAAGAGGG - Intergenic
901435190 1:9243190-9243212 CAGAGGGGGTGGTGGGAGGAGGG + Intronic
901462866 1:9401919-9401941 CGAAGGGGAGGGAGGGAGGCCGG + Intergenic
901787105 1:11632016-11632038 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
901844354 1:11972606-11972628 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
902044362 1:13513802-13513824 GGGCGGGGAGGGAGGGGCGAGGG + Exonic
902126142 1:14213311-14213333 CGGAGGGGATGGGAGGAAGAGGG - Intergenic
902283039 1:15388320-15388342 GGGAGGGGAGGGAGGGAGGTGGG - Intronic
902553829 1:17235195-17235217 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
902908894 1:19580446-19580468 CAGAGAGGATTGAGGGAAGATGG + Intergenic
903019975 1:20386983-20387005 TGGAGGAGATGGGGGGAGGAGGG + Intergenic
903034610 1:20485866-20485888 GGGAGGGGAGGGAGAGAGGAGGG + Exonic
903273644 1:22207655-22207677 AGGAGTGGAGGGAGGGAAGACGG - Intergenic
903304650 1:22404233-22404255 TGAAGGGGATGGAGGGAGGCAGG + Intergenic
903331712 1:22600058-22600080 AAGGGGGGATGGAGGGAGGAAGG + Intronic
903331720 1:22600078-22600100 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
903343390 1:22669029-22669051 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903369175 1:22824266-22824288 AGGAAGGGAGGGAGGGAAGAAGG + Intronic
903524125 1:23980083-23980105 GGGAGGGGACGGAGTGAAGATGG - Intronic
903674204 1:25054277-25054299 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
903674211 1:25054293-25054315 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
903690036 1:25166936-25166958 CGGAAGGGAGGGAGGGAGGGAGG + Intergenic
904203872 1:28839874-28839896 AGGAAGGGAGGGAGGGAAGAAGG + Intronic
904277486 1:29393918-29393940 AGGAGGGGAGGGAGGGAGGAAGG - Intergenic
904422268 1:30402000-30402022 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
904653644 1:32025710-32025732 GGGAAGGGAGGGAGGGAAGAAGG - Intronic
904787848 1:32996012-32996034 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
905175945 1:36135411-36135433 CGGAGGAGAGGAAGGGCCGAGGG + Intergenic
905199707 1:36307407-36307429 CGGGAGGGAAGGAGGGAGGAAGG + Intronic
905231998 1:36520379-36520401 CGGAGGGGAGCCAGGGACCAAGG - Intergenic
905396497 1:37669877-37669899 AGGAGGGGAGGGAGGGAGGGAGG - Intergenic
905481931 1:38267810-38267832 AAGAAGGGATGGAGGGAGGAAGG - Intergenic
905671523 1:39793656-39793678 AGGAGGGGAGGGAGGGAGGGAGG + Intergenic
905942973 1:41878861-41878883 AGGAGGGGAGGGAGGGAGGGAGG - Intronic
906197723 1:43939270-43939292 AGGAGGGGAGGGAGGGAGGGAGG + Intergenic
906197731 1:43939287-43939309 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
906659460 1:47572255-47572277 CCCAGGGGATGGATGGATGATGG - Intergenic
906661981 1:47589546-47589568 CGGTGAGGAAGGAGGGATGATGG - Intergenic
906843578 1:49165779-49165801 GGAAGGGGATGGAGGAAGGAAGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907286134 1:53381032-53381054 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
907303478 1:53501997-53502019 GGGAGGGGTGGGAGGGACAAGGG + Intergenic
907437479 1:54458917-54458939 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
907443131 1:54490559-54490581 GGGAGGGGAGGGAGGGAGGGAGG - Intergenic
907560796 1:55385696-55385718 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
907561987 1:55399581-55399603 AGGACGGGATGGAGTGAGGAGGG + Intergenic
907873754 1:58466269-58466291 GGGAGGGGAGGGAGGGATGGGGG - Intronic
908223919 1:62036896-62036918 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
908296531 1:62718558-62718580 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
909016816 1:70388998-70389020 AGGGGGGGAGGGAGGAACGAAGG - Intergenic
909213105 1:72849646-72849668 GGGAAGGGAGGGAGGGAGGAGGG - Intergenic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
909447656 1:75765580-75765602 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
909589260 1:77327686-77327708 TGGAGGGGAGGGAGAAACGAAGG - Intronic
909692101 1:78420842-78420864 AGGAGGGAAGGGAGGGAGGAAGG - Intronic
909738755 1:79001176-79001198 GGGGGGGGAGGGAGGGAGGAAGG + Intronic
909741067 1:79030321-79030343 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
910369906 1:86504270-86504292 CGCAGAGGCTGGAGGGAAGAAGG - Intergenic
910474828 1:87595635-87595657 AGGAGGGAAGGGAGGGAAGAGGG - Intergenic
910601763 1:89040195-89040217 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
911090613 1:94014264-94014286 AGGAAGGGAAGGAGGGACGAAGG + Intronic
911456056 1:98125142-98125164 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
911601872 1:99856303-99856325 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
911708583 1:101043024-101043046 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
911708593 1:101043048-101043070 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
911834372 1:102597052-102597074 GGGAGGGGAGGGAGGAAGGAAGG + Intergenic
912763405 1:112387983-112388005 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
912806306 1:112759454-112759476 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913183867 1:116348904-116348926 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
913573136 1:120141537-120141559 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
913601065 1:120421491-120421513 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
913954955 1:143281128-143281150 AGGATGGGAGGGAGGGAGGAAGG - Intergenic
913982484 1:143534313-143534335 AGGATGGGAGGGAGGGAGGAAGG + Intergenic
914264482 1:146026833-146026855 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
914294393 1:146306334-146306356 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
914362230 1:146944987-146945009 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
914362238 1:146945007-146945029 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
914555437 1:148757117-148757139 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
915330477 1:155108786-155108808 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
915330485 1:155108806-155108828 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
915426765 1:155833749-155833771 AGGAGGGGAGGAAGGGAGGAGGG + Intronic
915545169 1:156592890-156592912 CAGAGTGGAAGGAGGGACCAGGG - Intronic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
915939889 1:160112350-160112372 CGGGGCGGGAGGAGGGACGATGG + Intergenic
916046677 1:161005278-161005300 GGGAGGGGAAGGAGGAAGGAGGG - Intronic
916339268 1:163710792-163710814 AGGAAGGGAGGGAGGGAGGATGG - Intergenic
916779519 1:168009465-168009487 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
916853242 1:168725304-168725326 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
917518609 1:175729597-175729619 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
917572403 1:176281891-176281913 GGGAGGGGAGGGAGAGAGGAAGG - Intergenic
917790402 1:178495694-178495716 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
918212849 1:182366891-182366913 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
918373695 1:183887183-183887205 AGGAGGGGAAGGAGGGAGGGAGG - Intronic
918395883 1:184112473-184112495 GGGAGGGGAGGGAGGGAGGGAGG + Intergenic
918857754 1:189780666-189780688 AGGGAGGGATGGAGGGAAGAAGG + Intergenic
918920918 1:190708714-190708736 AGGAGGGGAGGTAGGGAAGAAGG - Intergenic
919564011 1:199160972-199160994 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
920077520 1:203348058-203348080 TGGAGGGGATGGAGAGCCGTAGG + Exonic
920116283 1:203624131-203624153 AGGAGGGAAGGGAGGGAGGAAGG + Intergenic
920214160 1:204350462-204350484 CGGAGGGGATGGTGGTGGGATGG - Intronic
920370943 1:205478955-205478977 GGGAGGGCAGGGAGGGAGGAGGG + Intergenic
921170981 1:212549504-212549526 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
921771918 1:219050528-219050550 AGGGGGAGATGGAGGGAGGAAGG + Intergenic
922820765 1:228483948-228483970 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
922978067 1:229801562-229801584 CAGAGTGGATGGAGGGACAGTGG + Intergenic
923093490 1:230756991-230757013 AGGAAGGGAGGGAGGGAGGATGG + Intronic
923241644 1:232090796-232090818 TGGAGGGGAAGGAGGAACGTGGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923452866 1:234136175-234136197 AGGAGGGAAGGGAGGGAAGAAGG - Intronic
923482447 1:234397458-234397480 GGGAGGGGAAGGAGGGAGGATGG + Intronic
923750084 1:236739493-236739515 CGGAGGGCATGAAGGCAGGACGG - Exonic
924035642 1:239933805-239933827 AGGAGGGGAGGGAGGGAGGCAGG + Intergenic
924038519 1:239960042-239960064 GGGAGGGGAAGGAAGGATGAAGG - Intergenic
924041103 1:239984729-239984751 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
924063197 1:240197410-240197432 CGGAGGGGGTGGAGGGATCCTGG + Intronic
924181276 1:241440635-241440657 CGGTGGGGAGGGAGGGAGGGAGG + Intergenic
924206184 1:241713392-241713414 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
924583603 1:245342723-245342745 AGAAGGGGAGGGAGGGAGGATGG + Intronic
924728648 1:246692587-246692609 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
924852028 1:247840303-247840325 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1062833854 10:623622-623644 AGGAGGGGAAGGAAGGACGCAGG + Intronic
1062833893 10:623725-623747 AGGAGGGGAGGGACGGACGCAGG + Intronic
1063049446 10:2430861-2430883 CGGAGGGAAGGGAGGGAGGGAGG + Intergenic
1063153400 10:3356475-3356497 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1063407810 10:5813445-5813467 AGGAGGGGAGGGAGCGAGGAGGG + Exonic
1063623940 10:7672005-7672027 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1064121529 10:12623384-12623406 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1064288824 10:14015003-14015025 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1064304308 10:14151723-14151745 GGGAAGGGAGGGAGGGAGGAAGG - Intronic
1064635242 10:17358596-17358618 AGGAGGAGAAGGAGGGAGGAAGG + Intronic
1064703976 10:18051176-18051198 GGAAGGGGATGGAGGGAGGGAGG + Intergenic
1064741540 10:18439788-18439810 CAGAAGGGAGGGAGGGAGGAAGG - Intronic
1064826631 10:19410625-19410647 AGGAGGGGAGGGAGGGAGGAAGG - Intronic
1065223349 10:23518506-23518528 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1065421979 10:25555054-25555076 AGAAGGGGAGGGAGGGAGGAAGG + Intronic
1065501787 10:26390530-26390552 CGGAGGGGATGAAGAGAGGTTGG + Intergenic
1065689099 10:28315218-28315240 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1065732006 10:28718075-28718097 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1065804044 10:29378630-29378652 CGGGGGGTATGAAGGGACAAAGG + Intergenic
1065817530 10:29495601-29495623 CTGAGGGGAGGGAGGGACAGTGG + Intronic
1065955331 10:30688797-30688819 CTGAGGGGAGGGAGGGACAGTGG - Intergenic
1066021066 10:31302723-31302745 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1066242368 10:33550819-33550841 AGGAGGGGCTGGAAGGAGGAAGG - Intergenic
1066458826 10:35595529-35595551 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1066779761 10:38931597-38931619 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1066779768 10:38931613-38931635 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1066951450 10:42122036-42122058 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1067050876 10:43019508-43019530 GGGAGGGGAGGGAGGGAGGGAGG + Intergenic
1067256886 10:44650133-44650155 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1067359310 10:45563018-45563040 GGGAGGGGAAGGAGAGAGGAAGG - Intronic
1067744537 10:48925695-48925717 CAGAGCTGATGGAGGGATGATGG + Intronic
1068033505 10:51732006-51732028 AGGAAGGGAGGGAGGGACGGGGG - Intronic
1068079525 10:52302707-52302729 CTAGGGGGATGGAGGGACGGAGG - Intergenic
1068329077 10:55538409-55538431 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1068329239 10:55539039-55539061 AGGAAGGGAGGGAGGGAAGAAGG - Intronic
1068766317 10:60767916-60767938 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1068850346 10:61731726-61731748 TGGAAGGGAGGGAGGGAGGAAGG + Intronic
1069828784 10:71270337-71270359 CGGAAGGGAGGGAGGGAGGGAGG + Intronic
1069928211 10:71865778-71865800 GGGAGGGGATGGGGGGATGCTGG - Intergenic
1070537721 10:77392137-77392159 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1070537729 10:77392153-77392175 AGGAAGGGAGGGAGGGAGGAGGG + Intronic
1070706702 10:78644843-78644865 CAGAAGGGATGGAAGGACAAAGG + Intergenic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071070167 10:81682374-81682396 AGGACGGCATGGAGGAACGAGGG + Intergenic
1071372578 10:84967319-84967341 AGGAAGGGATGGAGGGAGGCAGG + Intergenic
1071534707 10:86418530-86418552 CGGAGGGGAGGAAGGAAAGAAGG + Intergenic
1071596644 10:86932664-86932686 TGGAGGGGATGGAAGGAGGGTGG + Exonic
1071729898 10:88237288-88237310 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1072100730 10:92226869-92226891 GGGAAGGGATGGAGGGAACAGGG + Intronic
1072554010 10:96500787-96500809 AGGAAGGGAGGGAGGGACGGAGG + Intronic
1072723214 10:97793668-97793690 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1072886936 10:99285531-99285553 GGGAGGGGAGGAAGGGAGGAGGG + Intergenic
1072975523 10:100054205-100054227 TGGGGGGGATGGAGGAAAGAAGG - Intronic
1073059310 10:100723992-100724014 GGGCGGGGAGGAAGGGACGAGGG + Intergenic
1073127935 10:101163561-101163583 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073531013 10:104232100-104232122 CGGAGGGAGAGGAGGGAGGAGGG + Intronic
1073662650 10:105493877-105493899 AGGAAGGGAAGGAGGGAAGAAGG + Intergenic
1074409156 10:113210892-113210914 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1074439069 10:113459148-113459170 GGGAGGGCATGGAGGGAAGGAGG - Intergenic
1074514206 10:114149715-114149737 AGGAAGGGAGGAAGGGACGAAGG + Intronic
1074695860 10:116049798-116049820 CGGGGGAGATGGAGGGATGGGGG + Intergenic
1074729698 10:116356373-116356395 AAGAGGGGAGGGAGGGAGGAAGG + Intronic
1074827932 10:117228274-117228296 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1074953814 10:118367601-118367623 AGGAAGAGAGGGAGGGACGAAGG + Intergenic
1074961761 10:118452447-118452469 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1075122717 10:119675916-119675938 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1075153242 10:119953725-119953747 AGGAAGGGAGGGAGGGAGGAGGG - Intergenic
1075384882 10:122048400-122048422 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1075627382 10:123972671-123972693 GGGCGGGGATGGAGGGACGGAGG + Intergenic
1075798284 10:125136172-125136194 CGAAGGGGCTGGAGGGACCCAGG + Intronic
1075804333 10:125174628-125174650 TGGTGGGGATGGTGGGAGGAGGG - Intergenic
1075814802 10:125256693-125256715 GGGTGGGGATGGAGGGCTGATGG + Intergenic
1075844190 10:125532008-125532030 AGGAGGGGATGGTGGTACGGGGG - Intergenic
1075847250 10:125554981-125555003 AGGAAGGGAGGGAGGGACGGAGG - Intergenic
1075863461 10:125697365-125697387 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1075893391 10:125973786-125973808 CGGAAGGGATGGGGGCATGATGG - Intronic
1075925987 10:126252152-126252174 TGGATGGGATGGATGGATGATGG + Intronic
1076004594 10:126938755-126938777 CGGAGGGGATGAAGACAGGAGGG + Intronic
1076063346 10:127430046-127430068 GGGAGGGGAGAGGGGGACGATGG - Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076778102 10:132709292-132709314 AGGAGGGGATGGGGGAAGGAGGG + Intronic
1076850152 10:133088596-133088618 CGGAGGGGAGGGAGCGACAGGGG + Intronic
1076878781 10:133230182-133230204 CGGCTGGGACGGAGGGACGGCGG + Intergenic
1076923362 10:133467057-133467079 GGGCTGGGATGGAGGGACCACGG - Intergenic
1077223661 11:1428340-1428362 CGGAGGGGATGGAGCCACTGGGG - Intronic
1077253240 11:1569988-1570010 CTGAGGGGAGGCAGGGATGAGGG - Intronic
1077283129 11:1754401-1754423 TGGAGGGGATGAAGGGATGGAGG + Intronic
1077283168 11:1754521-1754543 TGGAGGGGATGGAGGGATGGAGG + Intronic
1077283178 11:1754546-1754568 TGGAGGGGATGGAGGGATGGAGG + Intronic
1077287740 11:1775306-1775328 GAGAGGGGATGGAGGGGGGATGG + Intergenic
1077287881 11:1775740-1775762 GAGAGGGGATGGAGGGGGGATGG + Intergenic
1077358241 11:2128413-2128435 CTGTGGGGATGGAGGGACAGGGG - Intergenic
1077556792 11:3229911-3229933 GGGAGGGGATGGAGGGAGGCTGG - Intronic
1077620845 11:3721698-3721720 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1077664821 11:4098369-4098391 GGGAGGGGAGGGAGGGAGGAGGG - Intronic
1078484008 11:11705353-11705375 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1078660346 11:13280834-13280856 GGGAGGAGATGAGGGGACGATGG - Intronic
1078923658 11:15854493-15854515 AGGAGGGGAGGGAAGGAAGAGGG + Intergenic
1078942375 11:16022370-16022392 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1078968331 11:16373882-16373904 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1079089205 11:17469053-17469075 GGGAAGGGAGGGAGGGAGGAGGG - Intronic
1079133446 11:17762811-17762833 GGGTGGGAATGGAGAGACGAAGG - Intronic
1079390472 11:20017944-20017966 GGGAAGGGAGGGAGGGAGGAAGG - Intronic
1079733268 11:23962328-23962350 CTGAGAGGATGGAGAGACAACGG + Intergenic
1079989949 11:27235919-27235941 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1080048905 11:27838439-27838461 GGGAGGGAAGGGAGGGAGGATGG - Intergenic
1080050233 11:27851952-27851974 GGGAGGGGAGGGAGGGAGGGAGG - Intergenic
1080135029 11:28844596-28844618 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1080294418 11:30709201-30709223 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1080336445 11:31202906-31202928 CTGAGGGGATGGATGGAGGGTGG + Intronic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080956331 11:37099969-37099991 AGGAAGGGATGGAGGGAGGAAGG - Intergenic
1081261523 11:40967170-40967192 AGGAAGGGATGGAGGGAGGAAGG + Intronic
1081636739 11:44726907-44726929 GGGAGGGGAGGGACGGACGGCGG + Intronic
1081787543 11:45757833-45757855 GGAAGAGGATGGAGGGAGGATGG + Intergenic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1082986379 11:59173491-59173513 CGGAGCAGATGGAGAGAGGAGGG + Intronic
1083187147 11:61024293-61024315 AGGAAGGGATGGAGGGAGGGAGG - Intergenic
1083413905 11:62512926-62512948 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1083651596 11:64207704-64207726 CAGAAGGGAGGGAGGGAAGAGGG - Intronic
1083696175 11:64444318-64444340 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1083743379 11:64722691-64722713 GGGAAGGGATGGAGAGAGGAGGG - Intronic
1083853006 11:65378807-65378829 AGGGGTGGATGGAGGGAAGAGGG - Intronic
1083962954 11:66024637-66024659 TGGAGGGCAAGGAGGGACCATGG - Intronic
1084125156 11:67094505-67094527 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1084374038 11:68763981-68764003 GGGAGGGCAGGGAGGGACAAGGG + Intronic
1084907966 11:72363204-72363226 GGGAGGGGACGGAGGGAAGGAGG + Intronic
1085002627 11:73054602-73054624 AGGAGGGGAGGGAGGGATGGAGG + Intronic
1085847500 11:80083178-80083200 AGGACGGGAGGGAGGGAGGAAGG - Intergenic
1085868935 11:80326661-80326683 GGGAGGGGAGGAAGGGAGGAAGG + Intergenic
1086034674 11:82402157-82402179 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1086635239 11:89074745-89074767 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1086826224 11:91502128-91502150 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1087501163 11:98955998-98956020 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1088462355 11:110093968-110093990 TGGGGGTGAAGGAGGGACGAGGG - Intronic
1088579269 11:111299759-111299781 CGGGGGCGAAGGAGGGAGGAGGG + Intronic
1088650078 11:111949774-111949796 CAGAGGTGATGGAAGGAGGAAGG - Intronic
1088840949 11:113627279-113627301 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089045500 11:115498915-115498937 CAGAGGGGATAGAGCGACCAGGG + Intronic
1089162740 11:116452086-116452108 GGGAGGGGATTGAGAGAAGATGG - Intergenic
1089196309 11:116695845-116695867 AGGAGGGGAAGGAGGGAAGGAGG - Intergenic
1089747739 11:120628861-120628883 AGGAAGGGAGGGAGGGAAGAAGG - Intronic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090531040 11:127591836-127591858 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1090531047 11:127591852-127591874 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1090611848 11:128478366-128478388 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1090611855 11:128478382-128478404 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1090623585 11:128585298-128585320 GGGAGGGAAGGGAGGGAAGAAGG + Intronic
1091376944 12:31286-31308 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1091423001 12:359780-359802 AGGAAGGGATGAAGGGAAGAAGG + Intronic
1091461038 12:643405-643427 CGGAGCGGATGTAGGCCCGAGGG - Intronic
1091542255 12:1472710-1472732 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1091618913 12:2071050-2071072 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1091648161 12:2289343-2289365 GGGAGGGGGTGGATGGAGGAGGG + Intronic
1091718169 12:2794683-2794705 GGGATGGGAGGGAGGGAGGAAGG + Intergenic
1091755883 12:3051209-3051231 AGGGAGGGATGGAGGGAGGAAGG - Intergenic
1091812079 12:3408191-3408213 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1092374886 12:7947297-7947319 GGGAGGGGAGGGAGGGAGGGAGG - Intergenic
1092810305 12:12266588-12266610 GGGAGGGGAGGGACGGAGGAAGG - Intronic
1092937915 12:13380848-13380870 AGGTGGAGATGGAGGGAGGATGG - Intronic
1093038796 12:14356481-14356503 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1093675053 12:21928390-21928412 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1094292153 12:28863619-28863641 GGGAGGGGAGGGAGGGAGGGAGG - Intergenic
1094292179 12:28863803-28863825 GGGAGGGGAGGGAGGAAGGAAGG - Intergenic
1095464332 12:42475084-42475106 AGGAGGGGATGGTGGGATGGTGG - Intronic
1095669511 12:44842082-44842104 CGGAAGGGAGGGAGGGAGGGAGG + Intronic
1095998437 12:48109318-48109340 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1096398002 12:51281308-51281330 CGGGAGGGATGGAGGGAGGCAGG - Exonic
1096460722 12:51820404-51820426 CGGCGGGGACGGAGGGACTGCGG + Intergenic
1096790326 12:54040373-54040395 GGGAAGGGAGGGAGGGAGGAAGG - Intronic
1096983671 12:55743242-55743264 GGGAGGGGGCGGAGGGAGGAGGG - Intergenic
1097462215 12:59875885-59875907 TGGAGGGGATGGAGGGGGTATGG - Intergenic
1097750320 12:63345497-63345519 GGGAGGGGAAGGAGGCACAAGGG - Intergenic
1097750327 12:63345517-63345539 GGGAGGGGAAGGAGGCACAAGGG - Intergenic
1098171521 12:67751803-67751825 CGCAGTGGCTGGAGGGCCGAAGG - Intergenic
1098802426 12:74978421-74978443 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1099134920 12:78885366-78885388 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1099693429 12:85991250-85991272 AGGAGAGGATGGAGAGATGATGG - Intronic
1100034444 12:90234327-90234349 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1100065715 12:90641497-90641519 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1100149558 12:91719796-91719818 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1100209030 12:92381941-92381963 GAGGGGGGATGGAGGGAGGAAGG + Intergenic
1100214005 12:92428678-92428700 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1100243949 12:92737734-92737756 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1100346213 12:93734052-93734074 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
1100370803 12:93967042-93967064 CGGGAGGGATGGAGGGAGGGAGG - Intergenic
1100515447 12:95323112-95323134 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1100877192 12:98975004-98975026 GGGAGGGGAGGGAGGGAGGAAGG - Intronic
1101061939 12:100981465-100981487 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1101348287 12:103905626-103905648 AGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1101641392 12:106587593-106587615 CGGAGAGGAGGGAGGGAGCAAGG - Intronic
1101902667 12:108802555-108802577 AGGAAGGGAGGGAGGGACGGAGG + Intronic
1101925181 12:108965954-108965976 GGGAGGGAATGGAGGGAGGGAGG - Intronic
1102175570 12:110871535-110871557 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1102526567 12:113516235-113516257 AGGAAGGGATGGAGGGAGGGAGG - Intergenic
1102748611 12:115272178-115272200 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1102900052 12:116629387-116629409 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1103017816 12:117509259-117509281 GGAAGGGGATGGAAGGAGGAGGG - Intronic
1103030106 12:117606344-117606366 AGGAGGGGAGGGAGGGAGGAAGG - Intronic
1103030115 12:117606364-117606386 AGGAGGGGAGGGAGGGAGGAAGG - Intronic
1103030124 12:117606384-117606406 AGGAGAGGAGGGAGGGAGGAAGG - Intronic
1103030131 12:117606404-117606426 AGGAGGGGAGGGAGGGAGGAAGG - Intronic
1103030140 12:117606424-117606446 AGGAGGGGAGGGAGGGAGGAAGG - Intronic
1103030149 12:117606444-117606466 AGGAGGGGAGGGAGGGAGGAAGG - Intronic
1103030158 12:117606464-117606486 AGGAGAGGAGGGAGGGAGGAAGG - Intronic
1103030165 12:117606484-117606506 AGGAGGGGATGGAGGAAGGAAGG - Intronic
1103030172 12:117606504-117606526 AGGAGGGGAGGGAGGAAGGAAGG - Intronic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103350897 12:120282894-120282916 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1103925669 12:124422345-124422367 AGGAAGGGAGGGAGGGAGGAGGG + Intronic
1104004617 12:124883229-124883251 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1104134509 12:125924286-125924308 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1104238555 12:126963837-126963859 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1104248157 12:127062579-127062601 GGGAGGGGATGGATGGAAGGAGG - Intergenic
1104437488 12:128767385-128767407 CAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1104668798 12:130666784-130666806 AGGGAGGGATGGAGGGAGGAAGG + Intronic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104950443 12:132437529-132437551 GGGAGGGGAGGGAGGAAGGAGGG + Intergenic
1105578909 13:21675569-21675591 CGGAGGAGGAGGAGGGCCGAAGG - Intronic
1106602485 13:31199944-31199966 CGGCGGAGACGGAGGGAGGAGGG + Exonic
1107851667 13:44577415-44577437 CGGAGGAGGAGGAGGGAAGATGG + Intergenic
1108166293 13:47696703-47696725 CCAAGGGGATGGAGGAACCACGG - Intergenic
1108332675 13:49405744-49405766 AGGAAGGGAGGGAGGGACGGAGG + Intronic
1108645333 13:52421380-52421402 AGGAGGGGATGGAGAGAGGTTGG + Intronic
1108794796 13:54017885-54017907 AGGAAGGGATGGAGGGAGGGAGG + Intergenic
1109036169 13:57263469-57263491 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1109119464 13:58435978-58436000 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1109119472 13:58435998-58436020 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1109181531 13:59219961-59219983 CAGAGGGGAGGAAGGGAGGAAGG + Intergenic
1109321561 13:60816623-60816645 CGGAAGGGAGGGAGGAAGGAAGG - Intergenic
1109671325 13:65612233-65612255 GGGAGGGAAGGGAGGGAGGAAGG + Intergenic
1109749731 13:66673322-66673344 AGAAGGGGAAGGAGGAACGAAGG - Intronic
1110641526 13:77830203-77830225 AGGGGGGGAGGGAGGGAAGAAGG - Intergenic
1110779654 13:79449995-79450017 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1110912426 13:80981173-80981195 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1110912459 13:80981269-80981291 AGGAAGGGATGGAGGGAGGGAGG + Intergenic
1111048321 13:82846427-82846449 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1111048378 13:82846629-82846651 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1111048429 13:82846783-82846805 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1111084128 13:83351790-83351812 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1111317192 13:86578145-86578167 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1111882044 13:93969710-93969732 TAGAGGGGAGGGAGGGATGAAGG - Intronic
1112070726 13:95846423-95846445 AGGAGGGGAGGGGGGGAGGAGGG + Intronic
1112108996 13:96273960-96273982 AGGAGGGGAGGGAGGGAGGGAGG - Intronic
1112227072 13:97550247-97550269 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1112539871 13:100298593-100298615 GGGAGGGGAGGGAGGGAGGGAGG - Intronic
1112539882 13:100298614-100298636 GGGAGGGGAGGGAGGGAGGGAGG - Intronic
1113637513 13:111929707-111929729 GGGGGGGCATGGAGGGAGGAAGG + Intergenic
1113673956 13:112195734-112195756 AGGAGGGGAGAGAGGGAGGAAGG - Intergenic
1113674067 13:112196156-112196178 AGGAAGGGATGGAGGGAGGGAGG - Intergenic
1113813778 13:113158218-113158240 AGGAAGGGAGGGAGGGAGGAGGG - Intergenic
1113975642 13:114225556-114225578 GGGAGGGGAGGGAGGGGGGATGG + Intergenic
1113981736 13:114281912-114281934 GGGAGGGGAGGGAGGGGCGGGGG + Intronic
1113990454 14:16023989-16024011 TGGAAGGGATGGAGGGAGGGAGG - Intergenic
1113992440 14:16038159-16038181 AGGAGGGGATGCAGGAATGAGGG + Intergenic
1114735425 14:25038857-25038879 GGGAGGAGATGGAGGGACCAGGG + Intronic
1115399580 14:32941213-32941235 GGGAAGGGAGGGAGGGAGGAGGG - Intronic
1115399597 14:32941251-32941273 GGGAGGGGAAGGAGGGAGGAGGG - Intronic
1115640984 14:35335570-35335592 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1116324105 14:43509087-43509109 CGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1116394509 14:44431211-44431233 GGGAGGGGATGGGGGATCGAGGG + Intergenic
1116475169 14:45331375-45331397 GGGAGGGGAGGGAGGGATGGAGG - Intergenic
1116475190 14:45331421-45331443 GGGAGGGGAGGGAGGGATGGAGG - Intergenic
1116747292 14:48836886-48836908 GGGAGGGGAGGGAGTGAAGAGGG - Intergenic
1117401108 14:55358966-55358988 GGGATGGGAAGGAGGGAGGAAGG + Intronic
1117732708 14:58739911-58739933 AGGAGAGGATGGTGGGAAGAAGG + Intergenic
1118605052 14:67496750-67496772 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1118795480 14:69139859-69139881 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1118925404 14:70187093-70187115 CGAAGGGGGTGGGGGGAGGAGGG - Intronic
1119045830 14:71318209-71318231 AGGAAGGGAGGGAGGGAGGAGGG - Intergenic
1119551342 14:75516165-75516187 AGGAGGGGAAGGAGGGAGGAAGG - Intergenic
1120309397 14:82810836-82810858 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1120309439 14:82810964-82810986 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1120438680 14:84509377-84509399 AGGAGGGGAGGAAGGGAGGAAGG + Intergenic
1120635332 14:86943936-86943958 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1120635372 14:86944056-86944078 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1120666379 14:87311266-87311288 CGGGAGGCATGGAGGGAGGAAGG - Intergenic
1120948529 14:90020487-90020509 CGGAAGGGAGGGAGGGAGGGAGG - Intronic
1120948592 14:90020639-90020661 GGCAGGGGAGGGAGGGAGGAAGG - Intronic
1121417737 14:93790342-93790364 GGGATAGGATGGAGGGAGGATGG + Intergenic
1121741802 14:96257902-96257924 AGGATGGGAGGGAGGGAAGAAGG + Intronic
1122031238 14:98914182-98914204 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1122033231 14:98928748-98928770 CGGAGGGGATGAAGGGCTGTGGG - Intergenic
1122222784 14:100251750-100251772 GGGAGGGGAGGAAGGGACAAAGG - Intronic
1122411778 14:101529313-101529335 CAGAGGGCATGGAGGGCCCAGGG + Intergenic
1122427015 14:101616131-101616153 CGGAAGGGAGGGAGGGAGGGAGG + Intergenic
1122546045 14:102523477-102523499 CGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1122874079 14:104655209-104655231 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1123174156 14:106401433-106401455 CGCGGGGGATGGCGGGACGTCGG - Intergenic
1123182364 14:106482366-106482388 CGCGGGGGATGGCGGGACGTCGG - Intergenic
1202937489 14_KI270725v1_random:104657-104679 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1202944539 14_KI270726v1_random:14364-14386 CGCGGGGGATGGCGGGACGTCGG + Intergenic
1124336554 15:28861624-28861646 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1124424739 15:29554361-29554383 AGGAAAGGATGGAGGGAGGAAGG + Intronic
1124472457 15:30000441-30000463 AGGAAGGGAGGGAGGGAGGAGGG + Intergenic
1124604919 15:31162727-31162749 GAGAGGGGATGCAGGGATGAGGG + Intergenic
1124618407 15:31259583-31259605 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1124856132 15:33391129-33391151 TGGTGGGGCTGGAGGGATGAGGG - Intronic
1125150108 15:36521442-36521464 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1125674504 15:41494943-41494965 CGCAGGGGAGGGAGGGGCGTGGG + Intronic
1125744087 15:41987377-41987399 TGCAGGGGAGGGAGGGATGAAGG + Intronic
1125807419 15:42505884-42505906 TGGAAGGGAGGGAGGGAGGAAGG - Intronic
1126173378 15:45713073-45713095 GGGAGGGGAGGGAGGGAGGGAGG - Intergenic
1126173433 15:45713250-45713272 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1126628778 15:50712656-50712678 GGGGGGGGAGGGAGGGAGGAAGG - Intronic
1126857847 15:52856198-52856220 GGGAGGGGAGCGAGGGGCGAGGG + Intergenic
1127586392 15:60382047-60382069 GGGAGGGGAGGGAGGGAGGGAGG + Intronic
1128478821 15:68019926-68019948 GGGAGCTGATGGAGGTACGAAGG + Intergenic
1128514827 15:68335655-68335677 GGGCCGGGATGGAGGGAAGAGGG - Intronic
1129521509 15:76189347-76189369 AGGAGGGGAGGGAGGGAGGAAGG + Intronic
1129748327 15:78040692-78040714 AGGGGGGGAGGGAGGGAGGAAGG + Intronic
1129933020 15:79428172-79428194 GGGAGGGGAGGGAGGGAGGAAGG - Intergenic
1130383827 15:83394245-83394267 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1130392111 15:83466030-83466052 AGGAGGGAATGGAGGCAGGAAGG - Intronic
1130577042 15:85102204-85102226 AAGAGGGGTTAGAGGGACGAGGG + Intronic
1130681573 15:86001573-86001595 AGGAAGGGAGGGAGGGACGGAGG - Intergenic
1130721006 15:86386056-86386078 GGGAGGGGAGAGAGGGAGGAGGG - Intronic
1130839216 15:87682050-87682072 AGGGAGGGATGGAGGGAAGAAGG + Intergenic
1130951727 15:88596213-88596235 AGGAGGGGAGGGAGGGGGGAGGG - Intergenic
1131009391 15:89004603-89004625 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1131361181 15:91792068-91792090 CAAAGGGGATGGAGGGAGGAGGG - Intergenic
1131492625 15:92876123-92876145 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1131508246 15:93034556-93034578 CGGAAGAGAGGGAGGGAAGAGGG + Intergenic
1131588530 15:93722423-93722445 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1131588544 15:93722459-93722481 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1131588551 15:93722475-93722497 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1131588558 15:93722491-93722513 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1131600900 15:93847587-93847609 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1131830946 15:96354292-96354314 AGGAGGGGATGGAGGGGCGGGGG - Intergenic
1132020417 15:98356557-98356579 AGGAAGGGATGGAGAGAGGAAGG + Intergenic
1132238914 15:100242540-100242562 GGGAGAGGATGGAGAGAGGAGGG - Intronic
1132361229 15:101217606-101217628 AGGAAGGGATGGAGGGAGGGAGG + Intronic
1132449976 15:101961708-101961730 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
1132880889 16:2161231-2161253 GGGAGGGGACGGAGGGAGGGAGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132915218 16:2340413-2340435 CGGAGGGGATGCGGGGTCGCGGG + Intronic
1132918053 16:2364776-2364798 AGGAGGGGAGGGAGGGAGGAAGG + Intergenic
1133331845 16:4979798-4979820 GGAAGGGGATGGAGGGACCTCGG - Intronic
1133431659 16:5742303-5742325 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1133520293 16:6549556-6549578 AGGAGGGGAGGAAGGGAGGAAGG + Intronic
1133559872 16:6941225-6941247 GGGAGGGGATGGAGGGAGGGAGG - Intronic
1133567362 16:7008656-7008678 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1133567373 16:7008683-7008705 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1133567380 16:7008699-7008721 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1133567387 16:7008715-7008737 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1133567394 16:7008731-7008753 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1133567407 16:7008762-7008784 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1133567418 16:7008789-7008811 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1133567425 16:7008805-7008827 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1133567449 16:7008857-7008879 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1133567475 16:7008921-7008943 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1133567482 16:7008937-7008959 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1133567505 16:7008989-7009011 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1133567512 16:7009005-7009027 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1133567529 16:7009045-7009067 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1133567563 16:7009121-7009143 AGGGAGGGATGGAGGGAGGAAGG - Intronic
1133588277 16:7216991-7217013 GGGAAGGGAGGGAGGGAGGAAGG - Intronic
1133839289 16:9394109-9394131 TGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1133853061 16:9524267-9524289 GGGAGGGGAGGGAGGGAGGGAGG - Intergenic
1134223180 16:12371261-12371283 AGGAAGGGAGGGAGGGAGGAGGG - Intronic
1134288012 16:12879248-12879270 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1134440524 16:14297110-14297132 AGGAGGGGAGGGAGGGAGGGAGG - Intergenic
1134680871 16:16124599-16124621 CGCAGGGTAGGGAGGGCCGAAGG - Intronic
1135016516 16:18928284-18928306 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1135050015 16:19185145-19185167 AGGAGGGGAAGGAGGGAGAAAGG - Intronic
1135050020 16:19185161-19185183 AGGAGGGGAGGGAGGAAGGAGGG - Intronic
1135156494 16:20057549-20057571 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1135200751 16:20436142-20436164 AGGAAGGGAGGGAGGGAAGAAGG - Intronic
1135480854 16:22819087-22819109 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1135529079 16:23237231-23237253 GGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1135806468 16:25547296-25547318 AGGAGGGGAAGTAGGGAGGAAGG - Intergenic
1135892642 16:26371450-26371472 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1135913137 16:26579186-26579208 AGAAGGGGAGGGAGGGAGGAAGG - Intergenic
1136333633 16:29597264-29597286 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1136589013 16:31206055-31206077 AGGAGGGGAGGGAGGGAGGAAGG - Intergenic
1136698178 16:32105413-32105435 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1136730343 16:32405933-32405955 GGGAAGGGATGAAGGGAAGAAGG - Intergenic
1136769427 16:32822444-32822466 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1136798677 16:33048702-33048724 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1136946062 16:34652569-34652591 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1136956391 16:34791592-34791614 AGGAAGGGAGGGAGGGAGGATGG + Intergenic
1137373842 16:47933458-47933480 AGGAAGGGATGGAGGGAGGAAGG + Intergenic
1137524481 16:49222733-49222755 AGGGGGGGAGGGAGGGAGGAAGG - Intergenic
1137776670 16:51060728-51060750 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1137983904 16:53091811-53091833 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1138049461 16:53761040-53761062 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1138133524 16:54501888-54501910 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1138202555 16:55100972-55100994 AGGAAGGAATGGAGGGAAGAAGG + Intergenic
1138498375 16:57423005-57423027 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1138498400 16:57423071-57423093 GGGAAGGGATGGAGAGAGGAAGG + Intergenic
1139004185 16:62551223-62551245 AGGAAGGGATGAAGGGAGGAAGG - Intergenic
1139028981 16:62855875-62855897 AGGGAGGGATGGAGGGAGGAAGG + Intergenic
1139210021 16:65067981-65068003 AGGAAGGGAGGGAGGGAAGAAGG + Intronic
1139240735 16:65389401-65389423 AGGAAGGAATGGAGGGAGGAAGG - Intergenic
1139246773 16:65452354-65452376 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1139494727 16:67308122-67308144 AGGATGGGAGGGAGGGAGGAAGG - Intronic
1139701551 16:68710959-68710981 GGGAGGGGAAGGAGGGGGGAGGG + Intronic
1139945850 16:70641520-70641542 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1139959077 16:70707406-70707428 GAAAGGGGATGGAGGGAGGAGGG + Intronic
1140215029 16:73000236-73000258 GAGAGAGGAGGGAGGGACGAAGG + Intronic
1140357522 16:74319168-74319190 TGGAGGGGATGCAGGGAGGGTGG - Intergenic
1140914621 16:79482969-79482991 GGGAGGGGAGGGAGGGAAGGAGG - Intergenic
1140914673 16:79483104-79483126 GGGAGGGGAGGGAGGGAAGTAGG - Intergenic
1140914716 16:79483205-79483227 GGGAGGGGAGGGAGGGAAGGAGG - Intergenic
1140967683 16:79983063-79983085 TGGCAGGGATGGAGGGAGGAAGG - Intergenic
1141177142 16:81728530-81728552 AGGAAGGGAGGGAGGGAGGAGGG - Intergenic
1141234586 16:82203696-82203718 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1141263675 16:82476238-82476260 AGGAGGAGAAGGAGGGAGGAGGG - Intergenic
1141411672 16:83838375-83838397 GGAAGGGGAGGGAGGGAGGAAGG + Intergenic
1141427161 16:83951947-83951969 AGGGGGGGAAGGAGGGAGGAAGG - Intronic
1141427202 16:83952055-83952077 AGGGGGGGAAGGAGGGAGGAAGG - Intronic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141557581 16:84846206-84846228 GGGAAGGGAAGGAGGGAGGAAGG - Intronic
1141682941 16:85554776-85554798 GGGGGGGGAGGGAGGGAGGACGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142251472 16:88993847-88993869 GGGAGGGGAAGAAGGGAGGAGGG - Intergenic
1203071843 16_KI270728v1_random:1084549-1084571 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1203143446 16_KI270728v1_random:1783915-1783937 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1142541238 17:661062-661084 AGGGAGGGATGGAGGGAGGAGGG - Intronic
1142683270 17:1562423-1562445 CGGAGGGGCAGCAGGGACGGAGG - Intronic
1142753574 17:2002623-2002645 AGGAAGGGAGGGAGGGAGGAGGG - Intronic
1142810373 17:2393166-2393188 CGTAGGGGATGGAGGGACGTGGG - Intronic
1142958256 17:3535483-3535505 GGAAGGGGAAGGAGGGAAGAAGG - Intronic
1143021203 17:3917995-3918017 GGGAGGGAACGGAGGGAGGAAGG + Intergenic
1143482189 17:7234217-7234239 CGGTGGGGTTGGGGAGACGAAGG - Exonic
1143513485 17:7408126-7408148 CGGGGGGAAAGGAGGGAGGAGGG - Intronic
1143619829 17:8074446-8074468 AGGAGGGGAGGGAGGGGCCAAGG - Intronic
1143701102 17:8660852-8660874 AGGAAGGGAGGGAGGGAGGATGG - Intergenic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1144561002 17:16320276-16320298 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
1144867667 17:18347304-18347326 CAGCTGGGATGGAGAGACGAGGG - Intronic
1145692347 17:26755653-26755675 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1145709078 17:26952280-26952302 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1145733276 17:27209912-27209934 GGGAGGGGAGGGAGGGAAGCAGG - Intergenic
1145751077 17:27355507-27355529 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1146086319 17:29833675-29833697 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1146367303 17:32238917-32238939 TGGAAGGGAGGGAGGGAGGAAGG - Intronic
1146410671 17:32581482-32581504 GGGAAGGGAGGGAGGGAGGAAGG - Intronic
1146441295 17:32897326-32897348 GAGAGGGGAGGGAGGGAAGAAGG - Intergenic
1146521860 17:33531711-33531733 CGTAGAGGATGGAGGAAAGAAGG - Intronic
1146763263 17:35496514-35496536 AGGAGGGGCCGGAGGGACGGTGG - Intronic
1146932439 17:36786941-36786963 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1147292353 17:39454063-39454085 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1147323143 17:39657947-39657969 CCCAGGGGAGGGAGGGAGGAAGG - Intronic
1147472676 17:40677598-40677620 CTAAGGGGCTGGTGGGACGACGG - Intergenic
1147590485 17:41680033-41680055 GGGAGGGGAGGGAGGGAGGGAGG + Intergenic
1147780132 17:42935024-42935046 GGGAGGGGAGGGAAAGACGATGG - Intergenic
1147819730 17:43234490-43234512 CCGAGGGGACGAGGGGACGAGGG + Intergenic
1147821042 17:43241888-43241910 CCGAGGGGACGAGGGGACGAGGG + Intergenic
1147821848 17:43246377-43246399 CCGAGGGGACGAGGGGACGAGGG + Intergenic
1147825450 17:43267336-43267358 CCGAGGGGACGAGGGGACGAGGG + Intergenic
1147826581 17:43273803-43273825 CCGAGGGGACGAGGGGACGAGGG + Intergenic
1147827470 17:43278681-43278703 CCGAGGGGACGAGGGGACGAGGG + Intergenic
1147828578 17:43284842-43284864 CCGAGGGGACGAGGGGACGAGGG + Intergenic
1147829686 17:43290993-43291015 CCGAGGGGACGAGGGGACGAGGG + Intergenic
1147831464 17:43300744-43300766 CCGAGGGGACGAGGGGACGAGGG + Intergenic
1148489015 17:48011532-48011554 CGAAGAGGAAGGAGGGACGACGG + Intergenic
1148580186 17:48738328-48738350 TGGAGGGCATGGAGAGACCAGGG - Intergenic
1148787167 17:50151021-50151043 CGGGGGGGAGGGAGGGAGGGAGG - Intergenic
1148801698 17:50231114-50231136 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1149289972 17:55208560-55208582 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1149394021 17:56220793-56220815 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1149394035 17:56220833-56220855 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1149536632 17:57438409-57438431 AGGAGGGGATGGAGGAAGAAGGG - Intronic
1150293047 17:63992910-63992932 AGGAGGGGAAGGAAGGAGGAAGG + Intergenic
1150502037 17:65660354-65660376 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1150502047 17:65660382-65660404 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1150521988 17:65878209-65878231 AGGAAGGGAGGGAGGGAAGAAGG + Intronic
1150552232 17:66221366-66221388 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
1150697734 17:67420367-67420389 GGGAGGGGAGGGAGGAAGGAAGG - Intronic
1150919308 17:69466546-69466568 TGGAGGGGATGCAGTGCCGATGG - Intronic
1151310496 17:73289724-73289746 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1151345720 17:73500199-73500221 TGGAGGAGATGGAGGGAGGATGG - Intronic
1151345736 17:73500251-73500273 TGGAGGAGATGGAAGGAGGATGG - Intronic
1151345743 17:73500281-73500303 TGGAGGAGATGGAAGGAGGATGG - Intronic
1151345753 17:73500321-73500343 TGGAGGAGATGGAGGGAGGATGG - Intronic
1151345782 17:73500436-73500458 TGGAGGAGATGGAGGGAGGATGG - Intronic
1151345830 17:73500650-73500672 TGGAGGAGATGGAGTGAGGAGGG - Intronic
1151345884 17:73500873-73500895 TGGAGGAGATGGAGGGAGGATGG - Intronic
1151393101 17:73801220-73801242 GGGAGGGAATGGAAGGAGGAAGG - Intergenic
1151427929 17:74043266-74043288 GGGAGGGGAGGCAGGGAGGAAGG + Intergenic
1151535154 17:74735169-74735191 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1151544484 17:74784409-74784431 TGGAGGGGAAGGAAGGAGGATGG + Intronic
1151606806 17:75142642-75142664 AGGGGGGGATGGAGGGAAGGGGG + Intronic
1152362360 17:79838740-79838762 CGGAGGAGCTGGAGAGACGCGGG - Intronic
1152581247 17:81166379-81166401 CGGAGGGGAGGCATGGAGGAGGG + Intergenic
1152617418 17:81344414-81344436 CGGAGGCGAAGGAGGCAAGATGG - Intergenic
1152913043 17:83016490-83016512 GAGAAGGGATGGAGGGAGGAGGG + Intronic
1153632801 18:7088222-7088244 CGGAGGAGACGAAGGGAGGAAGG - Intronic
1153720084 18:7892908-7892930 GGGAGGCGATGGGGTGACGAGGG - Intronic
1153951283 18:10059840-10059862 CCGAGGGGACGAAGGGACGAGGG - Intergenic
1154519171 18:15208444-15208466 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1154959733 18:21296426-21296448 TGGAGGGGATGGAGAGAGGGTGG + Intronic
1155195387 18:23469362-23469384 GGGAGGGGAGGGAGGGAGGGAGG - Intronic
1155507696 18:26548707-26548729 CGCAGGGGATGGAGGGGAGGGGG + Intronic
1155762158 18:29582105-29582127 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1155762170 18:29582145-29582167 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1155829202 18:30491884-30491906 GGGAAGGGATGGAGGGAGGGAGG + Intergenic
1155910842 18:31502779-31502801 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1156265315 18:35482740-35482762 CGGAAGGGAGGGTGGGAGGAAGG - Intronic
1156991989 18:43420255-43420277 GGGAAGGGATGGAGGAAGGAAGG - Intergenic
1157085192 18:44573384-44573406 GGGAGGGGAAGAAGGGAGGAAGG + Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157239674 18:45997632-45997654 GGGAGGGGAGGGAGGGAAGGGGG - Intronic
1157358301 18:46955090-46955112 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1157964476 18:52192503-52192525 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1158259139 18:55588246-55588268 GGGAGGGGACGGAGGGAAGGGGG + Intronic
1158560098 18:58506215-58506237 AAGAGGGGAGGGAGGGAGGAGGG + Intronic
1158712864 18:59852808-59852830 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1159139333 18:64373519-64373541 AGGAAGGGAGGGAGGGACGGAGG - Intergenic
1159238757 18:65713133-65713155 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1159292982 18:66446184-66446206 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1159356084 18:67338345-67338367 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1159512655 18:69416127-69416149 AGGAAGGGAGGGAGGGACGGAGG + Intronic
1159964111 18:74579320-74579342 GGGAGGGGATGGAGAGGGGAGGG - Intronic
1160128772 18:76205260-76205282 CGGAAGGGAGGGAGGGAGGGAGG + Intergenic
1160362336 18:78294554-78294576 AGGAGGGGGAGGAGGAACGATGG + Intergenic
1160635278 19:70840-70862 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1160667112 19:336057-336079 AGCAGGGGAAGGAGGGAGGAAGG + Intronic
1160706086 19:531083-531105 CTGAGGGGTGGGAGGGGCGAGGG - Intergenic
1160748617 19:723131-723153 GGGAGGGGATGGGGGCACAAGGG + Intronic
1160872085 19:1282231-1282253 TGAAGGGGAAGGAGGGAGGAGGG + Intergenic
1161023369 19:2022527-2022549 AGGGAGGGATGGAGGGAGGAAGG - Intronic
1161274298 19:3406994-3407016 CGAGGGGGAGAGAGGGACGAGGG + Intronic
1161329302 19:3678704-3678726 CGGGAGGGATGGAGGGATGGCGG + Intronic
1161329369 19:3678906-3678928 AGGAAGGGATGGAGGGATGGAGG + Intronic
1161412560 19:4124357-4124379 GGGAGGAGACGGAGGGATGAAGG + Intergenic
1161631324 19:5357780-5357802 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1161638071 19:5401811-5401833 AGGAAGGAAGGGAGGGACGAAGG + Intergenic
1161913912 19:7214848-7214870 AGGTGGGGACGGAGGGAAGAAGG - Intronic
1161954171 19:7483550-7483572 CAGAGGGCATAGAGGAACGAGGG + Intronic
1162076602 19:8192006-8192028 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1162171182 19:8790248-8790270 CTGAGGGGAGGGAGGGAGGGAGG + Intergenic
1162330619 19:10027073-10027095 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1162514473 19:11139623-11139645 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1162524156 19:11197666-11197688 GGGTGGGGATGGAGAGACGCTGG + Intronic
1162877635 19:13632573-13632595 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1162927753 19:13938559-13938581 GGGTGGGGATGGAGGGATGGGGG + Intronic
1163020255 19:14477819-14477841 CAGGAGGGAGGGAGGGACGATGG - Exonic
1163082340 19:14953085-14953107 GGGAGCAGATGGAGGGAAGAAGG + Intronic
1163234462 19:16022761-16022783 AGGAGGGGATGCAGGGACTGTGG - Intergenic
1163378527 19:16949051-16949073 AGGGGGGGAGGGAGGGAGGAAGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163504237 19:17695335-17695357 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1163504263 19:17695513-17695535 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1163677539 19:18662851-18662873 GGGAGGGGAGGAAGGGAGGAGGG + Intronic
1163779688 19:19239840-19239862 GGGAGGAGTTGGAGGGAGGAGGG - Intronic
1164441791 19:28284806-28284828 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441798 19:28284822-28284844 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441805 19:28284838-28284860 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441830 19:28284900-28284922 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164441866 19:28285021-28285043 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441932 19:28285238-28285260 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164441961 19:28285326-28285348 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164478756 19:28595274-28595296 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1164521316 19:28982268-28982290 CGGAGGAGATGGGAGGAGGATGG + Intergenic
1164654405 19:29910215-29910237 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1164654412 19:29910231-29910253 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1164741143 19:30576358-30576380 CAGTGGAGATGGAGGAACGATGG - Intronic
1164925595 19:32127671-32127693 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1165013848 19:32866797-32866819 CAGAGGGGATGGAGGAGGGACGG - Intronic
1165077942 19:33291179-33291201 CCGAGGGGAGGTGGGGACGATGG - Intergenic
1165448465 19:35869309-35869331 AGCAAGGGATGGAGGGAGGAGGG + Intronic
1165738723 19:38193380-38193402 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1165922122 19:39305661-39305683 TTGGGGGGATGGAGGGACTACGG + Intergenic
1166402813 19:42496030-42496052 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1166676082 19:44741910-44741932 CGGAGAGGGTGGGGGGACGAGGG + Intergenic
1166824059 19:45598499-45598521 AGGAGGGGTGGGAGGGAGGAGGG - Intronic
1166946796 19:46402215-46402237 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1166948082 19:46409243-46409265 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1167140093 19:47644443-47644465 GGGAGGGGAAGGAGGGAGGGAGG - Intronic
1167295332 19:48646191-48646213 GGGAGGGGGAGGAGGGAGGAAGG - Exonic
1167691181 19:50984285-50984307 AGGAAGGGAGGGAGGGAGGAGGG - Intergenic
1167708728 19:51097678-51097700 CGGGGGGGATGGGGGGGCGGGGG + Exonic
1167737017 19:51300919-51300941 CAGAGGGGATGGAGGAGGGATGG + Intergenic
1168156239 19:54474269-54474291 CGCAGGGGATGGAGTGAAGCAGG + Intergenic
1168230684 19:55029105-55029127 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1168512850 19:56987333-56987355 AGGAGGGGATGAAAGGACCAGGG - Intergenic
1168725043 19:58576380-58576402 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1202682339 1_KI270712v1_random:18513-18535 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
924979380 2:207078-207100 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
924979406 2:207138-207160 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
924979434 2:207198-207220 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
924979488 2:207326-207348 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
924979496 2:207346-207368 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
924979514 2:207390-207412 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
924979571 2:207526-207548 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
924979579 2:207546-207568 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
924979598 2:207590-207612 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
925222161 2:2150851-2150873 GGGAAGGGAAGGAGGGAAGAAGG + Intronic
925466527 2:4111084-4111106 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
925925719 2:8668548-8668570 ATGAGGGGATGGATGGATGAGGG + Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926191577 2:10732206-10732228 AGGGAGGGATGGAGGGAAGAAGG - Intronic
926291977 2:11538828-11538850 AGGAAGGGATGGAGGGAGGGAGG - Intronic
926337422 2:11875086-11875108 GTGAGGGGATGGGGGGGCGAGGG - Intergenic
926440395 2:12882785-12882807 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
926534405 2:14092799-14092821 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
926542850 2:14202929-14202951 AGGAAGGAATGGAGGGAGGAAGG + Intergenic
926700250 2:15798680-15798702 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
926920766 2:17937493-17937515 AGGAGGGGAGGGAGGGAGAAAGG - Intronic
926921815 2:17946734-17946756 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
927087480 2:19686294-19686316 GGGAGGGGAGGGAGGGAGGTAGG + Intergenic
927350382 2:22105612-22105634 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
927472324 2:23385577-23385599 CGGAGGAGGAGGAGGAACGAGGG + Exonic
927578883 2:24223767-24223789 GGGAGGGGAGTGAGGGAAGAAGG + Intronic
928903334 2:36344627-36344649 CGGAGGGGAGGGAGGGGAGAAGG + Intergenic
929342202 2:40834242-40834264 CAGATGGGAAGGAGGGAGGAAGG - Intergenic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929617763 2:43325554-43325576 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930330867 2:49981389-49981411 TGAAGGGGAGGGAGGGAAGAGGG + Intronic
930352647 2:50277396-50277418 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
930584396 2:53252440-53252462 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
931254615 2:60558765-60558787 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
931264624 2:60649789-60649811 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
931773397 2:65518655-65518677 AGGAAAGGATGGAGGGAAGAAGG - Intergenic
931787761 2:65635924-65635946 GGGAGGAGACGGAGGGAGGAAGG + Intergenic
931924030 2:67051689-67051711 GGGAGGGAAGGGAGGGATGAAGG - Intergenic
931940004 2:67241545-67241567 AGGAAGGGAGGGAGGGATGAAGG + Intergenic
931996504 2:67844018-67844040 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
933124920 2:78593202-78593224 AGGAGAGGAGGGAGGGAGGAAGG - Intergenic
933214324 2:79610704-79610726 GGGATGGGATGGAGAGAGGAGGG + Intronic
933660442 2:84923131-84923153 GGGAGGGGAGGGAGGGAGGGAGG + Intergenic
933664159 2:84951092-84951114 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
933847477 2:86337440-86337462 GGGAGGGGACGGAGGGGCGCGGG + Intronic
934056111 2:88252971-88252993 GGGAGGGAAGGGAGGGAGGAAGG - Intergenic
934249440 2:90336587-90336609 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
934260139 2:91466875-91466897 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
934303446 2:91798810-91798832 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
934329813 2:92053950-92053972 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
934468031 2:94283852-94283874 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
934880447 2:97972449-97972471 GGGAGGGGAGGGAGGGAAGGCGG + Intronic
934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG + Intronic
934947156 2:98550240-98550262 GGGAGGGGATGGAGCGGGGAGGG + Intronic
935540312 2:104340582-104340604 CGGAGGGGAAAGAGTGAGGAAGG - Intergenic
935613191 2:105047480-105047502 GGAAGGGGATGGAGGTAGGAGGG + Intronic
935620514 2:105125872-105125894 AGGAAGGGAGGGAGGGAGGAGGG + Intergenic
935646964 2:105345524-105345546 AGGAAGGGAGGGAGGGAAGAAGG - Exonic
935985453 2:108668349-108668371 TGGAGGGGATGGGGAGAAGATGG - Intronic
935999357 2:108811123-108811145 GGGAGGGGAAGAAGGGAAGAAGG - Intronic
936137883 2:109911996-109912018 TGGAGGGGATGGGGAGAAGATGG - Intergenic
936206814 2:110459489-110459511 TGGAGGGGATGGGGAGAAGATGG + Intronic
936459090 2:112698355-112698377 GAGAGGGGAGGGAGGGACGGAGG - Intergenic
936566202 2:113584203-113584225 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
937089372 2:119195839-119195861 AGGAGGGGAGGGAGGAAGGAAGG + Intergenic
937089381 2:119195863-119195885 AGGAGGGGAGGGAGGAAGGAAGG + Intergenic
937293769 2:120797719-120797741 GGGAGGGGAGAGAGGGAGGAGGG + Intronic
937293775 2:120797735-120797757 AGGAGGGGAGAGAGGGAGGAGGG + Intronic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937341682 2:121095414-121095436 TGGAGAGGCTGGAGGGAGGACGG - Intergenic
937793329 2:125986367-125986389 CGGAGGGAATGAAGGAAGGAAGG + Intergenic
937814046 2:126231616-126231638 AGGAGGAGATGGAAGGAGGAAGG - Intergenic
938112488 2:128578392-128578414 TGGAGAGGAGGGAGGGAGGAAGG - Intergenic
938121247 2:128635840-128635862 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
938519169 2:132049073-132049095 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
939038656 2:137162701-137162723 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
939181788 2:138811820-138811842 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
939384075 2:141474052-141474074 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
939535387 2:143421436-143421458 GGGAAGGGAAGGAGGGACAAAGG + Intronic
939733849 2:145819312-145819334 AGGAGGGGATGGAGGGAGGAAGG - Intergenic
939733870 2:145819377-145819399 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
939733892 2:145819439-145819461 GGGAGGGGATGGAGGGATGGAGG - Intergenic
940372920 2:152922679-152922701 AGAAAGGGATGGAGGGAGGATGG - Intergenic
940692568 2:156937493-156937515 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
940852215 2:158699176-158699198 AGGAGGGGGAGGAGGGAGGAGGG + Intergenic
940900912 2:159125570-159125592 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
941114323 2:161454277-161454299 TGGGAGGGATGGAGGGAAGAAGG - Intronic
941282302 2:163567971-163567993 AGGAAGGGACGGAGGGAGGATGG + Intergenic
941408809 2:165126653-165126675 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
941919974 2:170840606-170840628 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
942342312 2:174961196-174961218 GGGAAGGGAGGGAGGGAAGAAGG + Intronic
942462449 2:176177913-176177935 CGAGGGGGATTGAGGGAAGATGG - Intergenic
942482336 2:176402929-176402951 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
942496041 2:176541070-176541092 AGGAGGGGAGGGGGGGAGGAGGG + Intergenic
942629440 2:177939514-177939536 GGGAAGGGAGGGAGGGAGGAAGG + Intronic
942763800 2:179430146-179430168 TGGAGGGAATGGGGAGACGATGG + Intergenic
942893581 2:181021567-181021589 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
943022241 2:182589254-182589276 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
944155007 2:196598513-196598535 GGGAGGGGATGGAGAGAGGAGGG + Intergenic
944412093 2:199456100-199456122 GGGAGGGGGTGGGGGGAGGAAGG + Intronic
944797241 2:203199812-203199834 GGGAGGGAATGGAGGGAGGAAGG - Intronic
945128630 2:206541517-206541539 TGGAGGGGAAAGAGGGACAAAGG + Intronic
945298611 2:208195162-208195184 AGGAGGGCAGGTAGGGACGATGG + Intergenic
945588337 2:211695980-211696002 GGGAAGGGAAGGAGGGAGGAAGG - Intronic
945612380 2:212019814-212019836 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
945744653 2:213705281-213705303 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
945876119 2:215279854-215279876 GGGAAGGGAGGGAGGGAGGAAGG + Intergenic
946077832 2:217090076-217090098 TGGAGGGTAGGGAGGGAGGACGG + Intergenic
946109737 2:217404111-217404133 GGGAGGGGAGGGAGGGAAGAAGG - Intronic
946176810 2:217927333-217927355 TGGAAGGGATGAAGGGAAGAAGG + Intronic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
946393569 2:219431298-219431320 CAGAGAGGATGGAGGGAGCAAGG - Intergenic
946524817 2:220507271-220507293 AGGAAGGGCTGGAGGGACGGAGG - Intergenic
946784719 2:223230914-223230936 AGGAAGGGATGGAGGAAGGAAGG - Intergenic
946833324 2:223746982-223747004 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
947029925 2:225782554-225782576 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
947077051 2:226355952-226355974 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
947272115 2:228347948-228347970 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
947661249 2:231870125-231870147 AGGAAGGGATGGAGGAAGGAGGG - Intergenic
947909211 2:233790568-233790590 GGGAGGGGAGGGAGGAAGGAAGG - Intronic
947975026 2:234358006-234358028 GGGAGGGGAGGGAGGGAGGGAGG - Intergenic
948273283 2:236689872-236689894 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
948408829 2:237743287-237743309 CAGAGGGGAGGGAGGGAGGGTGG + Intronic
948433911 2:237939237-237939259 TGGAGGGGATGGAGGGGTGGGGG + Intergenic
948458681 2:238118898-238118920 CGGAGGAGGTGGATGGAGGAGGG + Intronic
948539224 2:238675018-238675040 CGGGAGGGAGGGAGGGAGGAAGG - Intergenic
948577761 2:238965369-238965391 GGGAGGAGAGGGAGGGAGGAGGG - Intergenic
948724248 2:239922041-239922063 AGGAAGGGAGGGAGGGAAGAAGG - Intronic
948806150 2:240454095-240454117 GGGAGGGGAGGGAAGCACGATGG + Intronic
948856264 2:240731995-240732017 AGGAGGGGATGACGGGAGGAGGG + Intronic
949016863 2:241718368-241718390 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
949038743 2:241834641-241834663 CTGAAGGGCTGGAGGGACCAGGG - Intergenic
1168744072 20:221336-221358 GGGAGGGAATGGAGGGAAGGAGG + Intergenic
1168974403 20:1953240-1953262 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1169113084 20:3045810-3045832 CGTGGGGGCTGGAGGGACGCGGG + Intergenic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1169541210 20:6601494-6601516 CGGAGGAGATGGAAAGACAAAGG - Intergenic
1170091103 20:12590515-12590537 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1170142513 20:13139090-13139112 AGGAGGAGAAGGAGGGAGGATGG - Intronic
1170278465 20:14619428-14619450 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1170501806 20:16982418-16982440 AGGAGGGAAGGGAGGGAGGAGGG - Intergenic
1170501840 20:16982534-16982556 AGGAAGGGAGGGAGGGAGGAGGG - Intergenic
1170561609 20:17563382-17563404 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1170631742 20:18072317-18072339 AGGAGGGGAGGGAGGGAGGAAGG - Intergenic
1170631766 20:18072373-18072395 AGGAGGGGAGGGAGGGAGGAAGG - Intergenic
1170631773 20:18072389-18072411 AGGAAGGGAGGGAGGGAGGAGGG - Intergenic
1170813916 20:19696952-19696974 AGGAGGAGAGGGAGGGAAGAAGG + Intronic
1170832669 20:19856579-19856601 AGGAAGGGAGGGAGGGAGGATGG + Intergenic
1170938247 20:20827876-20827898 GGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1172113970 20:32563015-32563037 TGGAGGGGAAGGAGGGTAGAGGG + Intronic
1172204580 20:33153832-33153854 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1172632279 20:36386440-36386462 AGGAAAGGATGGAGGGAAGAAGG + Intronic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1172858733 20:38030215-38030237 AGGAAGGGAGGGAGGGAGGAGGG + Intronic
1173305246 20:41841374-41841396 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1173424472 20:42930997-42931019 GGGAGGGGGTTGAGGGAGGAAGG - Intronic
1173644245 20:44623673-44623695 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1173662731 20:44745550-44745572 GGGAGGGGAGGGAGGGAAAAAGG + Intergenic
1173912611 20:46681440-46681462 AAGAGGGGAAGGAGGGAGGAGGG + Intronic
1173918726 20:46728097-46728119 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1174137554 20:48391035-48391057 AGGAGGGGAAGGAGGAAGGAAGG + Intergenic
1174140835 20:48412574-48412596 AGGAAGGGAGGGAGGGAAGATGG - Intergenic
1174164580 20:48575712-48575734 AGGAGGGGAGGGAGGGAGGGAGG + Intergenic
1174246867 20:49188195-49188217 GGGAGAGGAAGAAGGGACGAAGG + Exonic
1174262773 20:49308698-49308720 TGGAGGGGATGCAGGTAGGAAGG - Intergenic
1174346300 20:49932602-49932624 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1174415855 20:50366508-50366530 GGGAGGGGAAGGAGGGAGGGAGG - Intergenic
1174418168 20:50381148-50381170 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
1174577331 20:51545755-51545777 AGGAGTGGATGGAGGGTGGATGG + Intronic
1174790092 20:53469835-53469857 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1174899947 20:54488777-54488799 AGGAAGGGAGGGAGGGACGAGGG - Intronic
1174960520 20:55151765-55151787 AGGAGGGGAGGGAGGGGGGAGGG - Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175250044 20:57603788-57603810 TGGAGGGGATGGAGTCAGGAGGG - Intergenic
1175278598 20:57788068-57788090 AGGAGGGGATGGAGGATGGATGG + Intergenic
1175392479 20:58636004-58636026 GGGAGGGGAGGGAGGAAGGAAGG + Intergenic
1175474960 20:59265615-59265637 AGGAGGGAAGGGAGGGAGGAAGG - Intergenic
1175914653 20:62419977-62419999 GGGAGGGGCTGGAGGGGCCAGGG + Intronic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1175984061 20:62755445-62755467 AGGGAGGGATGGAGGGAGGATGG - Intronic
1176115688 20:63430978-63431000 GGGTGGGGATGGAGGCACGAGGG + Intronic
1176513702 21:7767452-7767474 GGGAGGGAAGGGAGGGAGGAAGG - Intronic
1177046879 21:16182506-16182528 GGGAGGGGAGGGAGGGACGGAGG - Intergenic
1177264583 21:18765788-18765810 TGGAAGGGATGAAGGGAAGAGGG - Intergenic
1177963226 21:27695251-27695273 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1177963245 21:27695369-27695391 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1178016092 21:28347498-28347520 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1178042273 21:28652447-28652469 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1178252159 21:31013851-31013873 AGGAAGGGAGGGAGGGAGGAGGG + Intergenic
1178624349 21:34202790-34202812 AGGAGGGGATGGAGGCGAGATGG + Intergenic
1178627353 21:34229182-34229204 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1178627362 21:34229206-34229228 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1178647815 21:34397976-34397998 GGGAGGGAAGGGAGGGAGGAAGG - Intronic
1178887765 21:36496884-36496906 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1178887772 21:36496900-36496922 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1178887792 21:36496944-36496966 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1178887832 21:36497036-36497058 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1178887839 21:36497052-36497074 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1178887909 21:36497216-36497238 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1179151887 21:38816053-38816075 GGGAGGGGAGGGAGGGAGGGAGG + Intronic
1179151900 21:38816078-38816100 GGGAGGGGAGGGAGGGAGGGAGG + Intronic
1179475017 21:41637465-41637487 AGGAAGGGAAGAAGGGACGAAGG - Intergenic
1179713351 21:43275409-43275431 CAGAGCAGATGGAGGGAGGAGGG - Intergenic
1179725311 21:43338582-43338604 AGGAGGGGATGGAGGCAGGGAGG - Intergenic
1179958219 21:44752676-44752698 AGGAAGGGAGGGAGGGACAAAGG + Intergenic
1180168012 21:46040113-46040135 GGGAGAGGCTGGAGGGAGGATGG - Intergenic
1180172053 21:46064749-46064771 AGGAAGGGAGGGAGGGAGGAGGG + Intergenic
1180172063 21:46064784-46064806 AGGAAGGGATGGAGGGATGGAGG + Intergenic
1180314831 22:11269358-11269380 AGGAGGGGATGCAGGAATGAGGG - Intergenic
1180316817 22:11283537-11283559 TGGAAGGGATGGAGGGAGGGAGG + Intergenic
1180525426 22:16254661-16254683 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1180614601 22:17119493-17119515 CGGAGGTGGTGGAGGGGCGGAGG + Exonic
1180735025 22:18010028-18010050 GGGAGGGGAGGGAGGGAAGCAGG + Intronic
1180892238 22:19297516-19297538 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1181666715 22:24403603-24403625 CGGAGGGGCTGGAGGGCCAAGGG - Intronic
1181759227 22:25046403-25046425 AGGAAGGGATGGAGAGAGGAAGG - Intronic
1181759231 22:25046419-25046441 AGGAAGGGATGGAGAGAGGAAGG - Intronic
1181885305 22:26017363-26017385 AGGAGGGGAGGGAGGAAGGAAGG - Intronic
1181931932 22:26408834-26408856 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1182090895 22:27594137-27594159 GGGAGGGACTGGAGGGAGGAAGG + Intergenic
1182093397 22:27610921-27610943 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1182232502 22:28849459-28849481 GGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1182243178 22:28933784-28933806 GGGAGGGGGAGGAGGGAGGAGGG - Intronic
1182408336 22:30158541-30158563 GGGAGGGGAGGGAGGAAGGAAGG - Intronic
1182760640 22:32719916-32719938 TGGAGGGGAAGGGGGGACAAGGG + Intronic
1182769127 22:32781060-32781082 TGGAAGGGAGGGAGGGAGGAAGG - Intronic
1183042596 22:35193521-35193543 GGGAGGGGAGGGAGGGAGGGAGG + Intergenic
1183325329 22:37188294-37188316 AGGAGGGGATGGAGGGAGAGAGG + Intronic
1183483047 22:38075337-38075359 GGGAGGGGAGGGAGGGTGGAGGG - Exonic
1183509561 22:38226986-38227008 CGGAGAGGACGGAGGGATGGAGG + Intronic
1183509570 22:38227011-38227033 CGGAGGGGATGGAGGGACGAAGG + Intronic
1183615691 22:38944027-38944049 AGGATGGGAGGGAGGGAGGAAGG - Intergenic
1183618367 22:38958726-38958748 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1183640079 22:39087297-39087319 CGGAGAGGAGGGAGGGATGTGGG - Intronic
1183697294 22:39430619-39430641 GGGAGGTGATGGTGGGAGGAGGG - Exonic
1183698797 22:39438162-39438184 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
1183698852 22:39438317-39438339 AGGAAGGGAGGGAGGGAGGAGGG - Intergenic
1183796301 22:40121222-40121244 CGGAAGGGAGGGAGGGAGGGAGG - Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184229952 22:43153017-43153039 GGGAGGGGAGGGAGGGAGGAAGG - Intronic
1184443846 22:44535767-44535789 TGGAGCCGATGGAGGGACCACGG - Intergenic
1184480308 22:44742892-44742914 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1184480316 22:44742921-44742943 AGGAAGGAAGGGAGGGACGAAGG + Intronic
1184604459 22:45564193-45564215 TGGAGGAGATGGAGGGAGGCAGG - Intronic
1184642420 22:45879566-45879588 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1184853860 22:47136090-47136112 CGGAGGGAAGTGAGGCACGATGG + Intronic
1184924165 22:47625835-47625857 TGGTGGGTATGGAGGGACAAGGG - Intergenic
1185107567 22:48882965-48882987 CAGAAGGGATGGATGGATGAGGG - Intergenic
1203290091 22_KI270735v1_random:28261-28283 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1203322946 22_KI270737v1_random:86263-86285 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
949251056 3:1984256-1984278 AGGAAGGGATGAAGGGAGGAAGG + Intergenic
949433545 3:4003975-4003997 GGGAGGGGAGGGAGGGAGGGAGG + Intronic
949547531 3:5084585-5084607 CAAAGGGGAGGGAGGGACGCAGG + Intergenic
949706809 3:6827813-6827835 AGGAAGGGAGGGAGGAACGAAGG - Intronic
949830926 3:8213248-8213270 AGGAAAGGATGGAGGGAAGAAGG - Intergenic
950360803 3:12448274-12448296 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
950404107 3:12793976-12793998 AGGAGGGGAGGAAGGGAGGAAGG - Intergenic
950458293 3:13105606-13105628 AGGAGGGGATGGAGGGGCAGTGG - Intergenic
950467266 3:13162873-13162895 CCGGGGGGATGGATGGACAAAGG - Intergenic
950579706 3:13854151-13854173 AGGAAGGGAAGGAGGGACGGAGG + Intronic
951376832 3:21928333-21928355 AGGGAGGGAGGGAGGGACGAAGG + Intronic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
951710891 3:25584148-25584170 AGGATGGGAGGGAGGGAAGAGGG - Intronic
952089278 3:29864967-29864989 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952358515 3:32606419-32606441 GGGAGGGGAGGGAGGAAGGAAGG + Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952459567 3:33510207-33510229 TGGGGGGGATGAAGGGAGGAAGG + Intronic
952946864 3:38483830-38483852 AGGAGGGGAGGGAGGGAGGCAGG - Exonic
953029860 3:39172097-39172119 GGGCAGGGATGGAGGGAGGAGGG + Intergenic
953156241 3:40377100-40377122 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
953439239 3:42904079-42904101 AGGAGGGGAGGGAGGGAGGGAGG - Intronic
953474516 3:43194294-43194316 AGGAGGGGAGGGAGGGACACAGG - Intergenic
953563497 3:44012672-44012694 CGGCGGAGATGGGGAGACGATGG - Intergenic
953640319 3:44701027-44701049 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
953640343 3:44701107-44701129 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
953668763 3:44945105-44945127 TGGCGGGGATGGAGGGAGGCAGG + Intronic
954338060 3:49931598-49931620 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
954361825 3:50126237-50126259 CAGAAGGGATGGTGGGAAGAGGG + Intergenic
955751497 3:62189186-62189208 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
955874548 3:63476081-63476103 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
956321948 3:68007601-68007623 GGGAGGGGAGGGAGGGAGGTGGG - Intronic
956796015 3:72719393-72719415 GGGAGGGGAGGGAGGAAGGAAGG + Intergenic
957507425 3:81140856-81140878 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
957740726 3:84264996-84265018 GGGAGGGGATGGAGGGAGCAAGG - Intergenic
957850896 3:85806274-85806296 TGGAAGGGAGGGAGGGAGGAAGG + Intronic
957979788 3:87494196-87494218 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
958005219 3:87802028-87802050 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
958094904 3:88931329-88931351 TGGAAGGGAGGGAGGGAGGAAGG - Intergenic
958732581 3:97974509-97974531 GGGCGGGGAGGGAGGGAGGAAGG + Intergenic
958980060 3:100709837-100709859 GGAAGGGGCTGGAGGGAGGAGGG + Intronic
959133892 3:102392531-102392553 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
959205222 3:103298396-103298418 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
959314736 3:104788854-104788876 AGGAAGGGATGGAGGGAGGGAGG + Intergenic
959416647 3:106083999-106084021 AGGAAGGGATGGAGGGAGGGAGG + Intergenic
959627649 3:108471058-108471080 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
959687941 3:109167801-109167823 AGGGAGGGATGGAGGGAGGAAGG + Intergenic
959795296 3:110420340-110420362 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
960672185 3:120164844-120164866 GGGCGGGGATGGTGGGACTAAGG + Intronic
960770018 3:121183663-121183685 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
960959544 3:123060305-123060327 GGGAGGGGAGGAAGGGAGGAAGG - Intergenic
961175893 3:124834663-124834685 GGGAGGGGAGGGAGGAAAGAAGG + Intronic
961660241 3:128464836-128464858 GGGAAGGGAGGGAGGGAGGAGGG - Intronic
961812063 3:129527696-129527718 TGGAGTGGAGGGAGGGAGGATGG - Intergenic
962072204 3:132044676-132044698 GGGAGGGGAGGGAGGGGGGAGGG + Intronic
962416047 3:135183195-135183217 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
962416054 3:135183211-135183233 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
962490867 3:135892974-135892996 GGGAAGGGAGGGAGGGAGGAAGG + Intergenic
962769691 3:138600905-138600927 AGGAGGAGAAGGAGGGAGGAGGG + Intergenic
962769701 3:138600930-138600952 AGGAGGAGAAGGAGGGAGGAGGG + Intergenic
963108402 3:141665579-141665601 AGGAGGGGAGGGAGGGAGGAAGG + Intergenic
963108463 3:141665787-141665809 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
963108470 3:141665803-141665825 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
963108477 3:141665819-141665841 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
963108484 3:141665835-141665857 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
963108538 3:141666025-141666047 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
963108560 3:141666077-141666099 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
963337748 3:143996603-143996625 AGGAGGTGGTGGAGGGACCAGGG + Intronic
963652925 3:148006924-148006946 AGGAGGAGAGGGAGGGAGGAAGG - Intergenic
963769809 3:149378519-149378541 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
963894720 3:150673145-150673167 CGGATGGAAGGGAGGGAGGAAGG - Intronic
963913015 3:150830986-150831008 CGGATGGGACGGAGGGAGGAAGG - Intergenic
964121229 3:153185835-153185857 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
964205881 3:154174506-154174528 AGCAGGGGTTGGAGGGAAGAAGG + Intronic
964733394 3:159891391-159891413 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
964903876 3:161694057-161694079 TGGAAGGGAGGGAGGGAGGAAGG - Intergenic
965171108 3:165265657-165265679 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
965186894 3:165476499-165476521 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
965186946 3:165476665-165476687 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
965186966 3:165476721-165476743 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
965211634 3:165797288-165797310 AGGGGGGGAGGGAGGGAGGAAGG - Intronic
965373932 3:167897711-167897733 GGGAGGGGAGGGAGGCAGGAAGG + Intergenic
965736838 3:171829737-171829759 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
965845858 3:172960901-172960923 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
966126278 3:176580470-176580492 TGGAGGTGATGGAGGGTGGAAGG + Intergenic
966204749 3:177394793-177394815 GGGAGGGGAGGGAGGGAGGGAGG - Intergenic
966291806 3:178368294-178368316 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
966291813 3:178368310-178368332 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
966291820 3:178368326-178368348 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
966291827 3:178368342-178368364 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
966589106 3:181660226-181660248 GGGACGGGATGAAGGGAGGAAGG + Intergenic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
966936485 3:184712959-184712981 AGGAGGGAAGGGAGGGAGGAAGG - Intergenic
967055305 3:185825028-185825050 CGGAGGAGGAGGAGAGACGAGGG - Exonic
967227215 3:187303489-187303511 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
967249063 3:187518439-187518461 AGGAAGGGAGGGAGGGACGGAGG + Intergenic
967337537 3:188361435-188361457 GGGAGGGGAAGGAGGGAGGGAGG - Intronic
967401595 3:189068797-189068819 AGGAAGGGAGGGAGGGAGGAGGG + Intronic
967824214 3:193865858-193865880 AGGAGGGGCTTGAGGGAAGAGGG - Intergenic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968258170 3:197297920-197297942 CGGAGGGGGCGAAGGGACGGGGG + Intronic
968339268 3:197941366-197941388 GGGAGGGGAGAGAGGGAGGAAGG - Intronic
968393561 4:212901-212923 CGGAGGGGACTGAGGACCGAGGG - Intergenic
968419738 4:473846-473868 CGGAGGGGACTGAGGACCGAGGG + Intronic
968652972 4:1767354-1767376 AGGAGGGGAGGGAGGGAGGAGGG - Intergenic
968712196 4:2127124-2127146 CGGAGGGTAGGGAGGGGTGAGGG + Intronic
968736496 4:2299639-2299661 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
968943640 4:3652400-3652422 CGGAGGGGAAGGAGAGCAGAAGG - Intergenic
969051359 4:4375496-4375518 GGGAAGGGAAGGAGGGAGGAAGG - Intronic
969143858 4:5102894-5102916 GGGAGGGGAGGGAGGAAGGAAGG - Intronic
969270733 4:6098442-6098464 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970444520 4:16112703-16112725 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444529 4:16112724-16112746 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444538 4:16112745-16112767 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444549 4:16112766-16112788 GGGAGGGGAGGGAGGGAGGGAGG + Intergenic
970572069 4:17393013-17393035 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
970688647 4:18596920-18596942 AGGAGAGGATGGAGGAAAGAAGG + Intergenic
970689949 4:18611526-18611548 AGGAAGGGATGGATGGAGGAGGG + Intergenic
970689964 4:18611577-18611599 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
970689990 4:18611668-18611690 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970690068 4:18611890-18611912 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970690128 4:18612037-18612059 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
970690154 4:18612128-18612150 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970690214 4:18612275-18612297 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
970690240 4:18612366-18612388 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970690296 4:18612524-18612546 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
970690353 4:18612692-18612714 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
970697979 4:18699664-18699686 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
970869427 4:20798686-20798708 CTGAGGGGATGGAGTGGCGGAGG - Intronic
970932668 4:21531320-21531342 GGGAAGGGAGGGAGGGAGGAAGG - Intronic
971034139 4:22675066-22675088 GGGAGGGGAGGGAGGGAGGGAGG - Intergenic
971563085 4:28106215-28106237 GGGAAGGGAGGGAGGGAGGAAGG + Intergenic
971563103 4:28106268-28106290 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
971664331 4:29462184-29462206 GAGGGGGGATGGAGGGAGGAGGG + Intergenic
971861177 4:32108112-32108134 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
971915778 4:32868283-32868305 AGGAAGGGAGGAAGGGACGAAGG + Intergenic
972055523 4:34797185-34797207 AGGGAGGGATGGAGGGAAGAAGG - Intergenic
972790255 4:42364960-42364982 GGGAGGGGAGGGAGGAAGGAAGG - Intergenic
973161241 4:47019581-47019603 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
973739065 4:53901843-53901865 AGGAAGGGAGGGAGGGACAAAGG + Intronic
973762606 4:54133367-54133389 GGGGAGGGAGGGAGGGACGAAGG + Intronic
973833772 4:54789098-54789120 AGGAGGGGAAGGAGAGAGGAGGG - Intergenic
974308584 4:60174520-60174542 CTGAGAGGATGGAGAGATGATGG - Intergenic
974319588 4:60329561-60329583 AGGGAGGGATGGAGGGAGGAAGG + Intergenic
974326844 4:60423811-60423833 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975044439 4:69783836-69783858 AGGAGAGGATGGAGAGAGGATGG + Intronic
975226239 4:71876234-71876256 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
975895365 4:79083793-79083815 CAGATGGGATGGAGGGAGGACGG - Intergenic
975905323 4:79204522-79204544 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
975905329 4:79204538-79204560 AGGAAGGGACGGAGGGAGGAAGG - Intergenic
976245514 4:83002442-83002464 AGGAGGGGAGGGAAGGAGGAAGG + Intronic
976465655 4:85365899-85365921 CGGAGGGGAGGAAGGAAGGAAGG - Intergenic
976574298 4:86651382-86651404 AGGAAGGGATGGAAGGAGGAAGG - Intronic
976633101 4:87259678-87259700 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
977014313 4:91673639-91673661 AGGAGGGGAGGGAGGGAGGAGGG - Intergenic
977285211 4:95097251-95097273 GAGAGGGGAGGGAGGGACAAAGG + Intronic
977555910 4:98487151-98487173 AGGGGGGGATGGAGGGAAGGAGG + Intronic
977593366 4:98851013-98851035 AGGAGGGGAGGGAGGAAGGAAGG + Intergenic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
977815997 4:101415089-101415111 AGGAAGGGAGGGAGGGAAGAAGG + Intronic
977870198 4:102081743-102081765 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
977870325 4:102082895-102082917 AGGAGGAGATGGAGGGAGGGAGG - Intergenic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978286720 4:107086426-107086448 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
978399089 4:108312255-108312277 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
978541250 4:109818522-109818544 AGGAAGGGAGGGAGGGAAGAAGG - Intronic
978598338 4:110402422-110402444 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
978702329 4:111662629-111662651 GGGAGGGGGAGGAGGGAGGATGG + Intergenic
979481074 4:121218521-121218543 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
979520923 4:121665746-121665768 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
979768166 4:124488483-124488505 AGGAGGGGAGGGAGGGAGGGAGG + Intergenic
979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG + Intergenic
980650897 4:135713727-135713749 AGGGAGGGATGGAGGGAGGAAGG - Intergenic
980727312 4:136780313-136780335 TGGAAGGGAGGGAGGGAGGAAGG - Intergenic
981092164 4:140743010-140743032 AGGAAGGGATGGAGGGAGGGAGG + Intronic
981280938 4:142957799-142957821 CAGAGGAGATGGAGGGCGGATGG - Intergenic
981413365 4:144458851-144458873 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
981454282 4:144935535-144935557 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
981801912 4:148667649-148667671 CCGAGGGGATGGTGGGTAGAAGG - Intergenic
981842295 4:149126612-149126634 CAGAAGGGAGGGAGGGATGAAGG + Intergenic
981912259 4:149995422-149995444 CGGAAGGAAGGGAGGGAGGAAGG + Intergenic
982261729 4:153500036-153500058 CGGAAGGGAGGAAGGGAGGAAGG - Intronic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983666873 4:170192784-170192806 AGCTGGGAATGGAGGGACGATGG + Intergenic
983813789 4:172097531-172097553 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
984622239 4:181966952-181966974 CGAAGGGGAGGGAGAGAAGAAGG - Intergenic
984675555 4:182543236-182543258 TGGAGGGAAGGGAGGGAGGAAGG + Intronic
984957730 4:185062707-185062729 AGGAAGGGAGGGAGGGAGGACGG - Intergenic
984963556 4:185121329-185121351 AGGAGAGGATGAAGGGAAGATGG - Intergenic
985081286 4:186266868-186266890 CGGCGGGGAAGGAGGGAGGAGGG + Intronic
985100990 4:186458486-186458508 GTGGGGGGAGGGAGGGACGAGGG - Intronic
985106937 4:186509337-186509359 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
985106953 4:186509377-186509399 AGGAAGGGAGGGAGGGAGGAGGG + Intronic
985271240 4:188196901-188196923 CGGCGGAGATGGGGGGCCGAGGG + Intergenic
985561073 5:586118-586140 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
985625962 5:987830-987852 GGGAGGGGAAGGAGGGAAGGAGG + Intergenic
985719380 5:1481311-1481333 CGGAGAGCATGGAGGGAGGGAGG - Intronic
985747685 5:1656401-1656423 CGGAGGGGATGGAGGAGCTGAGG - Intergenic
985829557 5:2218215-2218237 AGGAAGGGAAGGAGGGATGAGGG + Intergenic
985830858 5:2228579-2228601 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
986530102 5:8726995-8727017 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
986759786 5:10869459-10869481 AGGAGGGGAGGGAGGAAGGAAGG - Intergenic
986956719 5:13159400-13159422 AGGAAGGGATGGAGGGAGAAAGG + Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987182225 5:15379807-15379829 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
987296679 5:16559108-16559130 CGGAGGGGTTGGAGGTGGGAAGG - Intronic
987314724 5:16713551-16713573 GGGAGGGGAGGGAGGGAGCAAGG + Intronic
987373909 5:17217452-17217474 TGGAGGGGGTGGAGGGGAGACGG + Intronic
987677618 5:21095571-21095593 AGGAAGGGAGGGAGGGAGGATGG - Intergenic
988836473 5:35037523-35037545 AGGAGGGGAGGAAGGGAGGAAGG - Intronic
989234720 5:39133402-39133424 CGGAGGTGTTGGAGGAAAGAAGG + Intronic
989248654 5:39282065-39282087 AGGGGGGGAGGGAGGGAGGAAGG - Intergenic
989279155 5:39621748-39621770 CGGAGAGGATGGAGAGACAAAGG - Intergenic
990334110 5:54755658-54755680 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
992183934 5:74225738-74225760 GGAAGGGGAGGGAGGGAAGAAGG - Intergenic
993170289 5:84411431-84411453 GAGAGGGGAGGGAGGGACGGAGG - Intergenic
993604460 5:89971269-89971291 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
993971341 5:94423178-94423200 CTGGGGGGTTGGAGGGATGAAGG + Intronic
994412091 5:99419618-99419640 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
994481732 5:100345638-100345660 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
995016802 5:107318912-107318934 GGGAGGGGAGGAAGGGAGGAAGG + Intergenic
995565061 5:113425860-113425882 GGAAGTGGATGGAGGGAAGATGG + Intronic
995814985 5:116158117-116158139 GGGAAGGGAGGGAGGGAGGAAGG - Intronic
996577974 5:124997684-124997706 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
996793515 5:127319044-127319066 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
996924802 5:128811879-128811901 GGGAGGGGAGGGAGGAAGGAAGG - Intronic
997470679 5:134115285-134115307 CGGAGGGGAGTGAGGGGCGGTGG - Intronic
998203989 5:140146242-140146264 CGGAGGGGAGGGAGGGGAGCTGG - Intergenic
998411599 5:141915370-141915392 CAGAGGGGATGGTGGGACTCAGG + Intergenic
998638940 5:143987547-143987569 AGGAAGGGAGGAAGGGACGAAGG - Intergenic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
998963829 5:147516131-147516153 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
999751670 5:154632231-154632253 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
999751681 5:154632259-154632281 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
999758529 5:154682887-154682909 CGGGTGGAATGGAGGGAGGAGGG - Intergenic
999946362 5:156600305-156600327 GGGAGGGGATGGAGGAGAGAAGG - Intronic
1000064531 5:157683444-157683466 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1000520999 5:162294170-162294192 AGGAAGGGATGGAGGGAAGGAGG + Intergenic
1000573772 5:162949976-162949998 GGGAGGGGAAGGAGTGAAGAGGG + Intergenic
1000696183 5:164387203-164387225 AGGATGGGAGGGAGGGAGGAAGG + Intergenic
1000976823 5:167774199-167774221 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1000984930 5:167855956-167855978 AGGAGGGAAGGGAGGGAAGAAGG + Intronic
1000992935 5:167929216-167929238 AGGGAGGGATGGAGGGAGGAAGG + Intronic
1001089465 5:168726534-168726556 GGGAGGGGAGGGAGGGAGGCAGG + Intronic
1001328523 5:170746252-170746274 CGGAGGGGATGGGGGGGCATGGG + Intergenic
1001496361 5:172189994-172190016 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1001682490 5:173569267-173569289 GGGAGGGGGTAGAGGGAAGAAGG + Intergenic
1001774447 5:174317964-174317986 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1001825717 5:174743381-174743403 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1001919376 5:175588522-175588544 GGGAGGAGAGGGAGGGAAGAAGG + Intergenic
1001923200 5:175616917-175616939 CAGTGGTGATGGAGGGACAAGGG + Intergenic
1002102360 5:176863791-176863813 AGGAGGGGAAGGAGGGAAGAAGG - Intronic
1002188615 5:177467661-177467683 GGGTGGGGATGGCGGGAGGATGG - Intronic
1002190749 5:177476201-177476223 AGGTGGGGGTGGAGGGAGGAGGG - Intergenic
1002278176 5:178116266-178116288 GGGAGGGGGTGGAGGTAGGATGG + Intronic
1002297860 5:178241357-178241379 CAGAGGGGATGTGGGGAAGAGGG + Intronic
1002466857 5:179412461-179412483 CGGTGGGGGGGGAGGGAGGAAGG - Intergenic
1002678660 5:180941083-180941105 TGGAAGGGAGGGAGGGAGGAAGG + Intronic
1002913854 6:1512521-1512543 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1003226070 6:4207132-4207154 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1003242590 6:4357691-4357713 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003318969 6:5035677-5035699 GGGAGGGGAGGGAGGGAGGGAGG - Intergenic
1003491746 6:6628281-6628303 AGAAGGGGAGGGAGGGAGGAAGG - Intronic
1003517397 6:6828184-6828206 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1003812241 6:9796933-9796955 GGGAAGGGAGGGAGGGAGGATGG + Intronic
1003860669 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG + Intergenic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860690 6:10319449-10319471 CGGTGGGGATGGCGGGACGTGGG + Intergenic
1003860699 6:10319479-10319501 CCGTGGGGATGGCGGGACGTGGG + Intergenic
1003860708 6:10319509-10319531 CCGTGGGGATGGCGGGACGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003866345 6:10366275-10366297 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1003878826 6:10462131-10462153 GGGAGGGAAGGGAGGGAGGAAGG + Intergenic
1004447056 6:15710141-15710163 GGGAGGGGAGGGAGGGAGGGAGG - Intergenic
1004748661 6:18538556-18538578 GGGAGGGAAGGGAGGGAGGAAGG - Intergenic
1004751324 6:18565580-18565602 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1004898101 6:20168732-20168754 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1005205169 6:23394101-23394123 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1005771795 6:29081379-29081401 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1006367067 6:33621949-33621971 TGGAGGGGGCGGAGGGACGGAGG + Intronic
1006438592 6:34039887-34039909 AGGAGGGGATGGGGGGACTCTGG - Intronic
1006438966 6:34041500-34041522 CGGAGGGGAGGGGAGGAGGATGG - Intronic
1007408631 6:41648960-41648982 GGGAGAGGAGGGAGGGAAGAAGG - Intronic
1008273365 6:49515915-49515937 GGGAGGGGAGGGAGGGAGGGAGG - Intronic
1008288412 6:49682815-49682837 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
1009761533 6:68012969-68012991 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1009828911 6:68904108-68904130 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1010111339 6:72237247-72237269 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1010418267 6:75641095-75641117 AGGAGAGGATGGAGGGAGGTGGG - Intronic
1010800436 6:80168540-80168562 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1011017776 6:82777687-82777709 AGGAGGGGAGGGAGGGATGGAGG + Intergenic
1011164599 6:84431906-84431928 AGGAAGGGAGGGAGGGACGGAGG - Intergenic
1011268197 6:85548082-85548104 AGGGGGGGCTGGAGGGAGGAAGG + Intronic
1011742610 6:90377633-90377655 AGGAGGGGAGGGAGGGAGGAAGG - Intergenic
1011841196 6:91501085-91501107 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1011994467 6:93567513-93567535 CAGAGGGGATATAGGGACCAGGG - Intergenic
1012036580 6:94148923-94148945 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1012362557 6:98400982-98401004 AGGGAGGGATGGAGGGAGGAAGG + Intergenic
1013123275 6:107159310-107159332 CGGAAGGGAGGGAGGGAAGGAGG + Intronic
1014180162 6:118375323-118375345 GGGAAGGGATGGAGGGAGGGAGG + Intergenic
1014248627 6:119093985-119094007 GGGAGGGGAGGGAGGGAGGGAGG - Intronic
1014351578 6:120352810-120352832 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1014495237 6:122113634-122113656 GGGAGGGGATGGAGAAACAAGGG - Intergenic
1014531691 6:122566625-122566647 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1014626557 6:123733264-123733286 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1014676983 6:124379136-124379158 GGGAGGGGAGGGAGGGAGGGAGG + Intronic
1014677013 6:124379207-124379229 GGGAGGGAAAGGAGGGAAGAGGG + Intronic
1015093327 6:129385141-129385163 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
1015163967 6:130182629-130182651 GGGAGGGGAGGGAGGAAGGAAGG + Intronic
1015424431 6:133049369-133049391 AGGGAGGGATGGAGGGAGGAAGG - Intergenic
1015514159 6:134068353-134068375 AGGAAGGGATGGAGGGAGGGAGG + Intergenic
1015549368 6:134396096-134396118 CGGGGGAGAGGGAGGGAGGAAGG - Intergenic
1015743243 6:136481629-136481651 TGGTGGGGATGGAGGGAGTAGGG + Intronic
1016409337 6:143765564-143765586 CACAGGGGGTGGAGGGACCATGG - Exonic
1016636889 6:146302895-146302917 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1016772823 6:147870821-147870843 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
1016785355 6:148005512-148005534 AGGAGGGGAAGGAAGGAAGAGGG + Intergenic
1016867174 6:148778867-148778889 CGGATGGGATGGAGGGGGGTGGG - Intronic
1017286342 6:152680923-152680945 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1017587703 6:155945532-155945554 GGGAGGGGATGGCAGGAGGAAGG - Intergenic
1017790279 6:157792095-157792117 AGGAAGGGATGGAGGGAAGGAGG - Intronic
1017830717 6:158126480-158126502 GGGAGGAGATGGAGGGAGGGAGG + Intronic
1017873008 6:158502507-158502529 CGGTGGGGATGGAGTAGCGAGGG - Exonic
1017885652 6:158597470-158597492 TGGAAGGGATGGAAGGACAAAGG + Intronic
1017953972 6:159162711-159162733 CAGAGGAGATGGAGGAACAAAGG + Intergenic
1018400477 6:163415123-163415145 CGGAGAGGAGGGAGGGGCGGGGG - Exonic
1018641157 6:165906073-165906095 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1018670072 6:166169767-166169789 GGGAGGTGAAGGAGGAACGAGGG + Intergenic
1018699584 6:166416080-166416102 TGGAGGTGATGGAGGAAGGATGG - Intronic
1018834320 6:167471721-167471743 GGGAGGGGCTGGAGTGATGAGGG - Intergenic
1018857239 6:167683475-167683497 CACAGGGGATGGAGGGATGGGGG + Intergenic
1019103334 6:169649748-169649770 TGGAGGGGATGGAGGAATGGAGG - Intronic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1019103571 6:169650737-169650759 TGGTGGGGATGGAGGGATGGAGG - Intronic
1019320709 7:414216-414238 AGGAGGGGGAGGAGGGAGGAGGG - Intergenic
1019320717 7:414232-414254 AGGAGGGGGAGGAGGGAGGAGGG - Intergenic
1019320725 7:414248-414270 AGGAGGGGGAGGAGGGAGGAGGG - Intergenic
1019320749 7:414310-414332 AGGAGGGGGAGGAGGGAGGAGGG - Intergenic
1019320763 7:414342-414364 AGGAGGGGGAGGAGGGAGGATGG - Intergenic
1019320770 7:414358-414380 AGGAGGGGGAGGAGGGAGGAGGG - Intergenic
1019324172 7:429945-429967 CGGAGGCGATGGAGGGAGGCAGG - Intergenic
1019416707 7:931012-931034 AGGAGGGTAGGGAGGGACGGAGG + Intronic
1019697284 7:2452662-2452684 GGGAGGGAAGGGAGGGAGGAAGG - Intergenic
1019781398 7:2942334-2942356 GGAAGGGGAGGGAGGGAGGAAGG - Intronic
1019830296 7:3321737-3321759 GGGAGGGGAAGGAGGGGGGAGGG - Intronic
1020128913 7:5548785-5548807 AGGAAGGGAAGGAGGGAGGAGGG + Intronic
1020164332 7:5796386-5796408 AGGAAGGGAGGGAGGGAGGATGG - Intergenic
1020164341 7:5796410-5796432 AGGAAGGGAGGGAGGGAGGATGG - Intergenic
1020876547 7:13702216-13702238 AGGAAGGGAGGGAGGGAGGAGGG - Intergenic
1022194232 7:28049004-28049026 GGGAAGGGAGGGAGGGAGGAAGG - Intronic
1022643691 7:32211608-32211630 GAGAGGGGAGGGAGGGACGGAGG + Intronic
1023346676 7:39278106-39278128 AGGGGGGGAGGGAGGGAGGAAGG + Intronic
1023565742 7:41522156-41522178 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1023955759 7:44885477-44885499 CGGAGGCGATGGGGGGGCGGCGG - Intergenic
1024518865 7:50285154-50285176 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1024833362 7:53487633-53487655 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1025299349 7:57805739-57805761 AGGAGGGAATGCAGGGAGGAAGG - Intergenic
1025321609 7:58100280-58100302 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1025474753 7:60905521-60905543 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1025512250 7:61584353-61584375 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1025551187 7:62251949-62251971 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1025556792 7:62319256-62319278 AGGAGGGGAGGAAGGGAGGAAGG - Intergenic
1025556808 7:62319400-62319422 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1025921307 7:65915593-65915615 TGCAAGGGATGGAGAGACGAAGG - Intronic
1025948593 7:66124519-66124541 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
1026112077 7:67466396-67466418 GGGAGGGGAGAGAGGGAGGAAGG - Intergenic
1026179784 7:68028785-68028807 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1026179785 7:68028789-68028811 CGGAGGGAAGGGAGGGAGGGAGG - Intergenic
1026252167 7:68680356-68680378 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1026300147 7:69090607-69090629 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1026492140 7:70872179-70872201 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1026492160 7:70872229-70872251 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1026492173 7:70872260-70872282 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1026526938 7:71162084-71162106 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1026589011 7:71680251-71680273 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1026589032 7:71680307-71680329 AGGAAGGGATAGAGGGAGGAAGG - Intronic
1026589097 7:71680523-71680545 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1026638813 7:72106699-72106721 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1026638820 7:72106715-72106737 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1026670572 7:72387235-72387257 GGGAGGGGAGGGAGGGAGGGAGG + Intronic
1026690290 7:72545113-72545135 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1026728651 7:72892644-72892666 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1026964565 7:74431017-74431039 TGGAGAGGATGGATGGATGAAGG - Intergenic
1027115123 7:75472819-75472841 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1027261507 7:76468057-76468079 CGGGGGGAATGGAGAGAGGAGGG + Intronic
1028316068 7:89404883-89404905 AGGAAGGGAGGGAGGGACGGAGG + Intergenic
1028403197 7:90446748-90446770 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1028714509 7:93948964-93948986 AGGAAGGGAGGGAGGGACGGAGG + Intergenic
1029141608 7:98414770-98414792 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1029178677 7:98683754-98683776 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1029200039 7:98833321-98833343 TGGGGAGGATGGAGGGAGGAGGG + Intergenic
1029412795 7:100426716-100426738 AGGAAGGGATGGAGGGACAAAGG - Intronic
1029449650 7:100633592-100633614 CGGAGGAGAGGGAGGGAAGAGGG + Intronic
1029607820 7:101609680-101609702 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1029607827 7:101609696-101609718 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1029607834 7:101609712-101609734 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1029607847 7:101609744-101609766 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1029607860 7:101609776-101609798 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1029628861 7:101737789-101737811 AGGAGGGAAGGGAGGGAGGAAGG + Intergenic
1029634152 7:101772785-101772807 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1029857801 7:103536350-103536372 CGGAAGGGAGGTAGGGACGTAGG - Intronic
1030301304 7:107977106-107977128 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1030942512 7:115671364-115671386 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1031051562 7:116950640-116950662 AGGAAGGGAGGGAGGGAGGAGGG - Intergenic
1031989259 7:128186379-128186401 CGGAAGGGAGGGAGGAAGGAAGG - Intergenic
1032226105 7:130032843-130032865 AGGAGGGGAAGGAGGGAGGGAGG + Intronic
1032252758 7:130272031-130272053 CGGAGGGGATGGAGGTTGTAGGG + Intronic
1032439354 7:131930293-131930315 TGGAAGGGATGGAGGGTCAAGGG + Intergenic
1032654016 7:133907857-133907879 AGGAGGGGAAGGAGGGAGGGAGG + Intronic
1032675868 7:134129269-134129291 CAGAGTGGAGGGAGGGAGGAAGG - Intronic
1032774477 7:135096389-135096411 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1033227430 7:139572900-139572922 TGGAGGGGAGGGAGGGAGGGAGG - Exonic
1033789387 7:144773275-144773297 AGAAAGGGATGGAGGGAGGAAGG + Intronic
1034065882 7:148136095-148136117 TGGAGGGAACGGAGGGAGGAAGG + Intronic
1034065893 7:148136120-148136142 GGGAAGGGAGGGAGGGAGGAAGG + Intronic
1034194054 7:149232496-149232518 CGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1034256484 7:149727464-149727486 AGGAGGGGCTGGAGTGCCGAAGG - Intronic
1034416220 7:150965587-150965609 GGGAGGAGTTGGAGGGAAGAGGG - Intronic
1034442686 7:151094821-151094843 AGGAGGGAAGGGAGGGAGGAAGG - Intronic
1034607371 7:152329661-152329683 TGGAGGGGAAGGAGGGAGAAAGG + Intronic
1034895697 7:154875155-154875177 AGGAGGGGAGGGAGGGAGGAAGG + Intronic
1035073385 7:156160705-156160727 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1035581704 8:744466-744488 CGGAGAAGAGGGAGGGACGCAGG - Intergenic
1035673707 8:1439701-1439723 CCTAGGGGATGGCGGGAAGAAGG - Intergenic
1035770425 8:2142729-2142751 GGGAGGGGAGGAAGGGAGGAAGG - Intronic
1035776296 8:2191262-2191284 AGGAAGGGAGGGAGGAACGAAGG - Intergenic
1035902383 8:3471536-3471558 GGGAGAGGAGGGAGGGATGAAGG - Intronic
1036207491 8:6815768-6815790 GGGAGGGGATGCAGAGAAGAAGG + Intronic
1036561544 8:9903762-9903784 CGGAGGGGGTGGAGGGATGGGGG + Intergenic
1036822464 8:11951807-11951829 GGGAGGGGAGGGAGGGAGGGAGG - Intergenic
1036926884 8:12915830-12915852 TGGAGGGGTTGGATGGAGGAGGG - Intergenic
1037368226 8:18145497-18145519 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1037480613 8:19302036-19302058 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
1037540381 8:19865255-19865277 AGGAAGGGATGGAGGGAGGGAGG + Intergenic
1037567219 8:20128043-20128065 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1037573613 8:20179912-20179934 AGGAGGGGATGGGAGGAGGAAGG + Intronic
1037769604 8:21790620-21790642 GGGAGAAGATGGAGGGAGGAAGG - Intronic
1037951314 8:23020015-23020037 CAGAGGGGAGGGAGGAAGGAAGG + Intronic
1038001591 8:23396376-23396398 GGGAAGGGAAGGAGGGAGGAAGG + Intronic
1038177486 8:25194452-25194474 CGGAGGGAAGGCAGGGAGGATGG - Intronic
1038340323 8:26680512-26680534 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1038689320 8:29746696-29746718 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1038761037 8:30384470-30384492 CGGAGAGGAGGGAGGGGAGAGGG + Intronic
1038845577 8:31226453-31226475 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1039105485 8:33984937-33984959 AGGAGGGGATGGAGGATGGATGG - Intergenic
1039321615 8:36438108-36438130 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1039428472 8:37506312-37506334 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1039455908 8:37706403-37706425 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1039583756 8:38687965-38687987 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1039708531 8:40032081-40032103 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1039781313 8:40788986-40789008 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1040464282 8:47679577-47679599 TGGAGGGGATGGAGGCAGGCGGG - Intronic
1040464294 8:47679620-47679642 TGGAGGGGATGGAGGCAGGCGGG - Intronic
1040931362 8:52738639-52738661 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1041253837 8:55961859-55961881 GGGAGGGGATGGGTGGACGGTGG - Intronic
1041304815 8:56447513-56447535 TGGTGGGGAGGGAGGGATGAGGG + Intergenic
1041953628 8:63533180-63533202 AGGAAGGGAGGGAGGGAAGAGGG - Intergenic
1042040349 8:64582131-64582153 GGGTGGGGAGGGAGGGAGGAGGG + Exonic
1042062295 8:64834478-64834500 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1042922605 8:73934366-73934388 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1043084364 8:75810612-75810634 AGGAAGGGAGGGAGGGAGGAGGG - Intergenic
1043322674 8:79009416-79009438 GGGAAGGGAGGGAGGGAAGAGGG - Intergenic
1043514874 8:80986676-80986698 TGGAGGGTATGGAGGGATTAGGG + Intronic
1043587114 8:81782338-81782360 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1043692634 8:83174656-83174678 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1043862339 8:85334587-85334609 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1044253199 8:90028688-90028710 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
1044291212 8:90472541-90472563 AGGAAGGGAGGGAGGGACGGAGG - Intergenic
1044500506 8:92949610-92949632 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1044801909 8:95965681-95965703 GGGAAGGGAGGGAGGGACGGAGG + Intergenic
1045411984 8:101929262-101929284 AGGAAGGGATGGAGGGAGGGAGG + Intronic
1045523207 8:102921408-102921430 GGGAGGGAAGGGAGGGAGGAAGG - Intronic
1045718315 8:105074893-105074915 CGGGAGGGAGGGAGGGAAGAAGG - Intronic
1045755134 8:105533776-105533798 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1045755285 8:105534238-105534260 AGGAAGGGAGGGAGGGAGGAGGG - Intronic
1045789373 8:105964100-105964122 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1046066808 8:109207137-109207159 AGTAGGGGATGGAGGGAGGAGGG + Intergenic
1046200893 8:110926388-110926410 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1046547889 8:115674468-115674490 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1046561441 8:115842760-115842782 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1047061798 8:121235632-121235654 AGGAGGGGAGGGAAGGAGGAAGG - Intergenic
1047061804 8:121235648-121235670 AGGAGGGGAGGGAAGGAGGAGGG - Intergenic
1047061811 8:121235664-121235686 AGGAGGGGAGGGAAGGAGGAGGG - Intergenic
1047135956 8:122078709-122078731 GGGAAGGGAGGGAGGGAAGAGGG + Intergenic
1047305663 8:123651122-123651144 AGGAAGGGAGGGAGGGAAGAAGG - Intronic
1047779527 8:128100114-128100136 AGGGAGGGATGGAGGGAGGAAGG - Intergenic
1047806940 8:128370896-128370918 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1047826500 8:128582033-128582055 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1048359680 8:133687206-133687228 AGGAGGAGAAGGAGGGAAGATGG - Intergenic
1048382965 8:133884336-133884358 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1048690385 8:136955955-136955977 GAGAGGGGAGGGAGGGAGGAAGG - Intergenic
1048787111 8:138062358-138062380 CGGAGGGCATGGCCGGAAGAAGG + Intergenic
1048848715 8:138623827-138623849 TCGAGGGGATGGAAAGACGAAGG + Intronic
1049023636 8:139974021-139974043 CGGCAGGGATGGGGGGACCATGG - Intronic
1049454612 8:142680647-142680669 AGGAGGGGAAGGAAGGAGGAAGG + Intronic
1049661340 8:143820947-143820969 AGGAAGGGAGGGAGGGAGGAGGG + Intronic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1050260697 9:3837991-3838013 TGGAGGGGGTGGGGGGAGGAGGG + Intronic
1051606054 9:18918733-18918755 TGGATGGGAGGGAGGGACGGAGG + Intergenic
1052416929 9:28189350-28189372 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1052417022 9:28189606-28189628 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1052475716 9:28956690-28956712 AGGAGGGAAGGGAGGGAGGAAGG - Intergenic
1052982057 9:34457357-34457379 CGGAGGGAATGGAAGGGGGAGGG - Intronic
1053192515 9:36084707-36084729 AGGAAGGGATGAAGGGAGGAAGG + Intronic
1053540111 9:38964956-38964978 AGGAGGGGAAGGAGGAAGGAAGG + Intergenic
1053698449 9:40661905-40661927 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1053804461 9:41787113-41787135 AGGAGGGGAAGGAGGAAGGAAGG + Intergenic
1054140823 9:61528349-61528371 AGGAGGGGAAGGAGGAAGGAAGG - Intergenic
1054309740 9:63461318-63461340 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1054408530 9:64785468-64785490 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1054441682 9:65269271-65269293 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1054454038 9:65420439-65420461 GGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1054626029 9:67398965-67398987 AGGAGGGGAAGGAGGAAGGAAGG - Intergenic
1054766208 9:69044659-69044681 GGGAGGTGATGGAGCGAGGAGGG - Intronic
1054795309 9:69295965-69295987 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1055289703 9:74769790-74769812 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1055595092 9:77857658-77857680 AGGAGGGGAAGGAGGGAAGGAGG + Intronic
1055824501 9:80307147-80307169 AGGAGAGGAGGGAGGGAGGAGGG - Intergenic
1056100137 9:83293173-83293195 AGGAGGGGAGGGAGGGAGGAAGG + Intronic
1056614549 9:88152717-88152739 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1056643325 9:88388778-88388800 CGGCGGGGATGGGGGCACGGAGG - Intronic
1057148529 9:92775646-92775668 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1057167390 9:92939945-92939967 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1057167403 9:92939977-92939999 AGGAGGGGAGGGAGGGAGGAAGG - Intergenic
1057292934 9:93818675-93818697 AGGAAGGGATGGAGGGAGGGAGG + Intergenic
1057480341 9:95440479-95440501 GGGAGGGGAAGGAGGGAGAAGGG + Intergenic
1058687329 9:107489934-107489956 GGGAGGGGAAGGAGGGGCGCGGG + Intronic
1058777598 9:108300354-108300376 CGGTGGGCATGGAGGCATGATGG - Intergenic
1059502444 9:114766681-114766703 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1059502451 9:114766697-114766719 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1059638196 9:116191019-116191041 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1059965482 9:119609668-119609690 GGGAGGGGAAGGAGGGAGGGAGG - Intergenic
1059965525 9:119609923-119609945 AGGAGGGGAAGGAGGGAGGGAGG - Intergenic
1059994097 9:119892575-119892597 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1060124849 9:121033873-121033895 GGGAGGGGAGGGAGGAAGGAAGG - Intronic
1060298145 9:122356838-122356860 TGGAGGGGATGAAGGGACGCAGG + Intergenic
1061207869 9:129174924-129174946 CCCAGTGGATGGAGGGAGGAAGG - Intergenic
1061389010 9:130306987-130307009 TGGATGGGAGGGAGGGAGGAGGG - Intronic
1061390051 9:130312637-130312659 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1061390532 9:130315181-130315203 GGGAGGGGAGGGAGGGAGGAAGG - Intronic
1061432561 9:130540469-130540491 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1061450655 9:130665307-130665329 GGGAGGGGGTGGAGGGAGGGCGG + Intronic
1062085507 9:134646014-134646036 GAGAAGGGATGGAGGGACAAAGG - Intronic
1062113335 9:134794746-134794768 AGGAGGGGAAGGAGGGAGGAAGG + Intronic
1062201670 9:135306132-135306154 GGAAGGGGAGGGAGGGAAGAAGG - Intergenic
1062201707 9:135306224-135306246 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1062218704 9:135403018-135403040 CGGAGGCGATGAGGGGACTAAGG - Intergenic
1062504420 9:136865929-136865951 AGGAGGGGATGGACGGACCCAGG - Intronic
1062570602 9:137183367-137183389 AGGTGGGGATGGGGGGACAAGGG - Intronic
1202780812 9_KI270717v1_random:35110-35132 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1203363138 Un_KI270442v1:235371-235393 AGGAGGGGATGCAGGAATGAGGG - Intergenic
1203365123 Un_KI270442v1:249472-249494 TGGAAGGGATGGAGGGAGGGAGG + Intergenic
1185485998 X:482033-482055 AGGAGGGAAGGGAGGGAGGAAGG + Intergenic
1185598696 X:1324491-1324513 GGGAGGGGAGGGAAGGAGGAGGG + Intergenic
1185700575 X:2227908-2227930 GGGAAGGGAGGGAGGGAGGAAGG + Intronic
1185700582 X:2227924-2227946 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1185700754 X:2228294-2228316 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1185803238 X:3032378-3032400 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1185843694 X:3417197-3417219 AGGAAGAGATGGAGGGAGGAAGG - Intergenic
1185907054 X:3944835-3944857 AGGAGGGGAGGGAGGGAGGAAGG - Intergenic
1185999190 X:4989225-4989247 GGGAGGGGAGGTAGGGAGGAAGG - Intergenic
1185999223 X:4989358-4989380 GGGAGGGGAGGTAGGGAGGAAGG - Intergenic
1186020644 X:5251309-5251331 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
1186107137 X:6219612-6219634 AGGAAGGGATGGAGGAACGAAGG - Intronic
1186226599 X:7405593-7405615 AGGGAGGGATGGAGGGAGGAAGG + Intergenic
1186246692 X:7622738-7622760 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1186309027 X:8297163-8297185 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1186405174 X:9295588-9295610 AGGAAGGGAGGGAGGGAGGAGGG - Intergenic
1186834357 X:13422572-13422594 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1186927468 X:14350905-14350927 CGGAGGGGCTGGTGGGAAGGTGG + Intergenic
1187591311 X:20720536-20720558 GGGAGGGGATGGAGAGTGGAAGG - Intergenic
1187591333 X:20720664-20720686 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1187625286 X:21105237-21105259 GGGAGGGGGTGGAGGGATTACGG + Intergenic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1187808652 X:23150511-23150533 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1187882876 X:23862855-23862877 GGGAGGGGAGGGAGGGATGCAGG + Intronic
1189179107 X:38986767-38986789 CAGAGGGGCTGCAGGGAGGAGGG - Intergenic
1189691289 X:43619017-43619039 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1190010252 X:46778519-46778541 TGGAGGGGAAAGAGGGAGGAGGG - Intergenic
1190018744 X:46852253-46852275 AGGAAGGGAGGGAGGGAGGAAGG + Intronic
1190055040 X:47176350-47176372 GAGAGCGGATGGAGGGAAGAAGG - Intronic
1190074047 X:47302678-47302700 CGGAGGGGAAAGAGGGAGGAGGG - Intergenic
1190212684 X:48460544-48460566 AGGAGTGGATGGATGGATGAAGG - Intronic
1190952040 X:55155605-55155627 GGGAGGGGATGGAGGAGCTAAGG + Intronic
1192109524 X:68350467-68350489 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1193119409 X:77807798-77807820 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1194256227 X:91638260-91638282 AGGAAGGAATGGAGGGAGGAAGG - Intergenic
1195684084 X:107570162-107570184 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1195804094 X:108743163-108743185 AGGAAGGGAGGGAGGGACAAGGG + Intergenic
1195897913 X:109767122-109767144 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1195934620 X:110113023-110113045 CAGAGGGGAGGGAGGGAGGAAGG - Intronic
1196398265 X:115288902-115288924 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1196893026 X:120308771-120308793 GGGAGGGGATGGGGGGACACTGG + Intronic
1197146311 X:123176390-123176412 AGGAGGGGAGTGAGGGAGGAGGG - Intergenic
1197621850 X:128759522-128759544 AGGAAGGGAGGGAGGGATGAAGG + Intergenic
1197720090 X:129739171-129739193 CTGGGTGGATGGAGGGACAAGGG - Exonic
1198080145 X:133231897-133231919 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1198716961 X:139567774-139567796 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1198855211 X:141008308-141008330 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1199317058 X:146393471-146393493 TGGGGGGGAGGGAGGGAGGAAGG - Intergenic
1199658571 X:150023091-150023113 GGGAGGGGATGGTGGGCCCATGG + Intergenic
1199811814 X:151357074-151357096 AGGAAGGGACGGAGGGAAGAGGG - Intergenic
1199846738 X:151697091-151697113 AGGAAGGGAGGGAGGGAGGAAGG - Intronic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1200154995 X:153970527-153970549 GGGAGGAGATGGAGGGAGGGAGG + Intronic
1200246972 X:154531639-154531661 AGGGTGGGAGGGAGGGACGAGGG - Exonic
1200311861 X:155086364-155086386 AGGAAGGGAGGGAGGGACGGAGG - Intronic
1200574956 Y:4877544-4877566 AGGAAGGAATGGAGGGAGGAAGG - Intergenic
1200908549 Y:8510991-8511013 AGGAGAGGATGGAAGGAGGAAGG - Intergenic
1200908563 Y:8511036-8511058 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1201269337 Y:12239271-12239293 AGGGAGGGATGGAGGGAGGAAGG + Intergenic
1201480443 Y:14432783-14432805 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1201550069 Y:15210240-15210262 AGGGAGGGATGGAGGGAGGAAGG + Intergenic
1201702566 Y:16900499-16900521 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1201741117 Y:17325505-17325527 GGGAAGGGAGGGAGGGAGGAGGG + Intergenic
1202193731 Y:22273815-22273837 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1202273687 Y:23094792-23094814 AGGGAGGGATGGAGGGAGGAAGG + Intergenic
1202292340 Y:23325889-23325911 AGGGAGGGATGGAGGGAGGAAGG - Intergenic
1202359977 Y:24097341-24097363 AGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1202426683 Y:24728537-24728559 AGGGAGGGATGGAGGGAGGAAGG + Intergenic
1202444106 Y:24941549-24941571 AGGGAGGGATGGAGGGAGGAAGG - Intergenic
1202510800 Y:25572773-25572795 AGGAAGGGAGGGAGGGAGGAAGG - Intergenic