ID: 1183511706

View in Genome Browser
Species Human (GRCh38)
Location 22:38239225-38239247
Sequence CAGCCCTCGCAGATGGTACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183511700_1183511706 15 Left 1183511700 22:38239187-38239209 CCACACCCTCTGGTGACACATGC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 1183511706 22:38239225-38239247 CAGCCCTCGCAGATGGTACGTGG 0: 1
1: 0
2: 0
3: 3
4: 63
1183511697_1183511706 20 Left 1183511697 22:38239182-38239204 CCCCTCCACACCCTCTGGTGACA 0: 1
1: 0
2: 0
3: 27
4: 370
Right 1183511706 22:38239225-38239247 CAGCCCTCGCAGATGGTACGTGG 0: 1
1: 0
2: 0
3: 3
4: 63
1183511702_1183511706 9 Left 1183511702 22:38239193-38239215 CCTCTGGTGACACATGCCAGCAC 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1183511706 22:38239225-38239247 CAGCCCTCGCAGATGGTACGTGG 0: 1
1: 0
2: 0
3: 3
4: 63
1183511696_1183511706 24 Left 1183511696 22:38239178-38239200 CCTGCCCCTCCACACCCTCTGGT 0: 1
1: 0
2: 6
3: 91
4: 1023
Right 1183511706 22:38239225-38239247 CAGCCCTCGCAGATGGTACGTGG 0: 1
1: 0
2: 0
3: 3
4: 63
1183511701_1183511706 10 Left 1183511701 22:38239192-38239214 CCCTCTGGTGACACATGCCAGCA 0: 1
1: 0
2: 0
3: 17
4: 193
Right 1183511706 22:38239225-38239247 CAGCCCTCGCAGATGGTACGTGG 0: 1
1: 0
2: 0
3: 3
4: 63
1183511703_1183511706 -7 Left 1183511703 22:38239209-38239231 CCAGCACTATGAATTCCAGCCCT 0: 1
1: 0
2: 0
3: 10
4: 156
Right 1183511706 22:38239225-38239247 CAGCCCTCGCAGATGGTACGTGG 0: 1
1: 0
2: 0
3: 3
4: 63
1183511699_1183511706 18 Left 1183511699 22:38239184-38239206 CCTCCACACCCTCTGGTGACACA 0: 1
1: 0
2: 0
3: 25
4: 229
Right 1183511706 22:38239225-38239247 CAGCCCTCGCAGATGGTACGTGG 0: 1
1: 0
2: 0
3: 3
4: 63
1183511698_1183511706 19 Left 1183511698 22:38239183-38239205 CCCTCCACACCCTCTGGTGACAC 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1183511706 22:38239225-38239247 CAGCCCTCGCAGATGGTACGTGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183511706 Original CRISPR CAGCCCTCGCAGATGGTACG TGG Intronic
900685964 1:3947783-3947805 CAGCCGGCGCAGATGGGAGGGGG - Intergenic
902478385 1:16699740-16699762 CAGCCGTCGCGGATGCTACGTGG - Intergenic
902478675 1:16700715-16700737 CAGCCGTCGCGGATGCCACGGGG + Intergenic
907021435 1:51070141-51070163 CAGGCCTCCCAGATGGTAGCAGG + Intergenic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
911336146 1:96583115-96583137 CAGCAATGGCAGATGGTACTTGG + Intergenic
912572854 1:110637370-110637392 CAGCCCTAGCTGATGGTGGGTGG + Intergenic
919065520 1:192688612-192688634 AAGCCATGGCAGATGGTACCTGG - Intergenic
1062968573 10:1628947-1628969 CAGCCCTCGCAGGAGCTACAGGG - Intronic
1076203531 10:128577073-128577095 CAGCCCTAGGAGATGCTAGGTGG + Intergenic
1085652871 11:78284371-78284393 CAGCCATTGCAGATGGTGAGCGG - Intronic
1089368440 11:117935362-117935384 AAGCCTTCTCAGATGGTTCGAGG - Intergenic
1091973731 12:4809426-4809448 CAGGCCTCGCAGAGGGCCCGGGG - Exonic
1091983026 12:4881898-4881920 CAGCCCCCGCAGTTGGCACTTGG - Intergenic
1094496378 12:30991962-30991984 CAGGCCTTGCAGATGGCATGTGG - Exonic
1096426709 12:51510069-51510091 CAGCCTGCACAGCTGGTACGAGG + Exonic
1110661059 13:78059834-78059856 CAGCCTTCCTAGATGTTACGGGG - Intergenic
1117066238 14:52015239-52015261 CAGCGCTCACAGATGGTCGGGGG + Exonic
1120357460 14:83452907-83452929 CAGCCCTCACTGATTGTAAGAGG - Intergenic
1127723499 15:61725659-61725681 CAGCCCTGGCAGAAGGAAAGAGG + Intergenic
1129651723 15:77495901-77495923 CAGCCCTCACGAATGGTAGGTGG + Intergenic
1132933210 16:2469031-2469053 CAGCCCTCACAGATGGTGTTTGG - Intergenic
1136297685 16:29312990-29313012 CAGCCCTCTCAGAAGGAAGGAGG - Intergenic
1137985161 16:53100985-53101007 CAACCCTTTCAGATGGTACAGGG - Intronic
1142059239 16:88019068-88019090 CAGCCCTCTCAGAAGGAAGGAGG - Intronic
1151381331 17:73727665-73727687 CAGCACTCGCAGCAGGTAAGTGG + Intergenic
1157565009 18:48673985-48674007 CAGCCCTTGCAGTTGGGGCGGGG - Intronic
1158649286 18:59272451-59272473 CAGCTCATGCAGCTGGTACGTGG + Exonic
1158935398 18:62360109-62360131 GATCCCTCCCAGATGGCACGTGG + Intronic
1159271513 18:66158767-66158789 CAGCCCTAGAAGATGGTATTGGG - Intergenic
1160065416 18:75569683-75569705 CAGCTCTTGCAGATTGTACATGG - Intergenic
1162255540 19:9486352-9486374 CAGCCTTCCCAAATGGTACAGGG + Intronic
1164165609 19:22671927-22671949 AAGCCATGACAGATGGTACGTGG + Intergenic
1164580711 19:29433302-29433324 CAGCCCTTGCAGATGGGTCGGGG - Intergenic
1202712404 1_KI270714v1_random:25571-25593 CAGTCGTCGCGGATGCTACGTGG - Intergenic
1202712694 1_KI270714v1_random:26546-26568 CAGCCGTCGCGGATGCCACGGGG + Intergenic
942947673 2:181687329-181687351 CAGCCCTCCCAGAGGGAACTGGG + Intergenic
1170768224 20:19310057-19310079 CAGCCCTGGGAGATGGTGCCTGG + Intronic
1171071136 20:22069766-22069788 CAGCCCCGGGAGATGGTATGTGG - Intergenic
1171377700 20:24704789-24704811 CAGCTCTCGCACATGCTACCTGG - Intergenic
1172060477 20:32183957-32183979 AAGCCCTGGCACATGGTAGGTGG + Intergenic
1180169495 21:46050512-46050534 CAGCCCTCCAAGGTGGCACGGGG + Intergenic
1183511706 22:38239225-38239247 CAGCCCTCGCAGATGGTACGTGG + Intronic
1183971042 22:41477707-41477729 CAGCCCCTGCAGATGGCCCGCGG + Intronic
1184701093 22:46173094-46173116 CAGCTCTTGCAGAAGGTACTTGG + Intronic
951955571 3:28249657-28249679 CAGCCCTCTCAGGTGGTTCTTGG + Intronic
988668280 5:33354047-33354069 AAGCCGTGGCAGATGGTACCTGG - Intergenic
992873468 5:81028906-81028928 AAGCCCTGCCAGATGGTACCTGG + Intronic
994232366 5:97322715-97322737 CATCCCTGGCAGATGGAAGGTGG + Intergenic
998144105 5:139716527-139716549 CAGCCCTGGGAGATGGTTCTGGG - Intergenic
999319898 5:150607629-150607651 CAGGTCTCACAGCTGGTACGTGG + Intronic
1003172308 6:3729476-3729498 CAGCCCTACCAGGTGGTACAGGG - Intronic
1013883117 6:114929097-114929119 AAGCCGTGACAGATGGTACGTGG - Intergenic
1015891922 6:137978047-137978069 CAGACCTCACAGATGGAATGAGG + Intergenic
1019198475 6:170296015-170296037 CAGCCCCAGCAGATGATCCGCGG - Intronic
1027493689 7:78861127-78861149 AAGCCTTCACAGATGGTACCTGG - Intronic
1032494178 7:132348611-132348633 CAGCCCTGGGAGATGCTAGGAGG - Intronic
1032908443 7:136401136-136401158 GAGCCCTAGCTGATGGTACCTGG + Intergenic
1044254543 8:90045286-90045308 AAGCCCTGACAGATGGTACCTGG + Intronic
1045948637 8:107826733-107826755 CAGCACTCGCTGAGGGTACGTGG - Intergenic
1048586412 8:135778184-135778206 CAGCCCCCGCACATGGGACAGGG - Intergenic
1048682809 8:136864899-136864921 AAGCCCTCACAGCTGGTAAGTGG - Intergenic
1050205496 9:3191932-3191954 CAGCCCTCTCAGCAGGTACCTGG - Intergenic
1060235333 9:121858711-121858733 GAGTCCTCGCTGATGGTGCGAGG - Intronic
1185468693 X:370049-370071 CAGCCCTCTCAGAGGGTCCCTGG - Intronic
1185659315 X:1714336-1714358 CAGCCCTCGCTGATGGGGGGTGG + Intergenic
1187519495 X:20001232-20001254 CAGCCCTGGTAGCTGGTACAAGG - Intergenic