ID: 1183512482

View in Genome Browser
Species Human (GRCh38)
Location 22:38244177-38244199
Sequence GTGTATCCCTGAGAACTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183512482_1183512485 18 Left 1183512482 22:38244177-38244199 CCTATGAGTTCTCAGGGATACAC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1183512485 22:38244218-38244240 GAAGAGAGACTCCAGCTGCTTGG No data
1183512482_1183512488 21 Left 1183512482 22:38244177-38244199 CCTATGAGTTCTCAGGGATACAC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1183512488 22:38244221-38244243 GAGAGACTCCAGCTGCTTGGGGG 0: 1
1: 0
2: 3
3: 50
4: 267
1183512482_1183512486 19 Left 1183512482 22:38244177-38244199 CCTATGAGTTCTCAGGGATACAC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1183512486 22:38244219-38244241 AAGAGAGACTCCAGCTGCTTGGG 0: 1
1: 0
2: 3
3: 38
4: 371
1183512482_1183512487 20 Left 1183512482 22:38244177-38244199 CCTATGAGTTCTCAGGGATACAC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1183512487 22:38244220-38244242 AGAGAGACTCCAGCTGCTTGGGG 0: 1
1: 0
2: 5
3: 81
4: 387
1183512482_1183512484 -4 Left 1183512482 22:38244177-38244199 CCTATGAGTTCTCAGGGATACAC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1183512484 22:38244196-38244218 ACACAAGTTTCAACGTGGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 75
1183512482_1183512483 -9 Left 1183512482 22:38244177-38244199 CCTATGAGTTCTCAGGGATACAC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1183512483 22:38244191-38244213 GGGATACACAAGTTTCAACGTGG 0: 1
1: 0
2: 0
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183512482 Original CRISPR GTGTATCCCTGAGAACTCAT AGG (reversed) Intronic
900993687 1:6109182-6109204 AGGTCTCCCTGAGAACTCTTAGG - Intronic
903267928 1:22169434-22169456 GTGTATCACTGAGGACTTTTTGG - Intergenic
910783416 1:90967141-90967163 TTGGATCACTGAGAACTGATGGG - Intronic
913508440 1:119540736-119540758 CTAGATCCCTGAAAACTCATTGG + Intergenic
913973780 1:143437459-143437481 GTTAATGCCTGAGAACTCTTTGG + Intergenic
914068165 1:144263066-144263088 GTTAATGCCTGAGAACTCTTTGG + Intergenic
914110990 1:144703288-144703310 GTTAATGCCTGAGAACTCTTTGG - Intergenic
924643920 1:245859563-245859585 GTGTTTCCCAGAGAATTCACTGG - Intronic
1071276700 10:84062046-84062068 GTGTGTCCGTGAGCACTCACTGG + Intergenic
1072248176 10:93561181-93561203 CTGTCTCCCTGGGAACTCTTGGG + Intergenic
1074175137 10:110992197-110992219 TAGTATCGCTGACAACTCATAGG + Intronic
1075626094 10:123965486-123965508 GTGTGTCCCCGTGAACTCACTGG - Intergenic
1081616644 11:44595174-44595196 GTATCTCCCTGAGCTCTCATAGG + Intronic
1083187603 11:61026729-61026751 GTGAAGCCCAGAGAAGTCATGGG + Intergenic
1086020000 11:82216239-82216261 GAGTATCACTGAGAAATCAAGGG - Intergenic
1089410154 11:118234349-118234371 GAGTTTCCCTGAGACCTCAGGGG - Intronic
1089714150 11:120340198-120340220 TTGTATCCCTGAGAATTTAGGGG + Intronic
1089905532 11:122033977-122033999 GTGGATCCCTAAAAACTCAGGGG - Intergenic
1091858535 12:3758263-3758285 GTGTATGCATGTGCACTCATGGG - Intronic
1093495550 12:19752977-19752999 GTGTCTCCCTGAGAATCCAGAGG + Intergenic
1096904433 12:54921330-54921352 GTGTCTCCATGACAATTCATAGG + Intergenic
1097036019 12:56124330-56124352 TTGTGTCCAAGAGAACTCATTGG + Exonic
1097465014 12:59911555-59911577 CTGTTTCCCTGAGATCTGATGGG + Intergenic
1104675611 12:130710039-130710061 GGGTATCCCTGGGAGCTCACGGG + Intronic
1107104336 13:36627085-36627107 GTGTAAACCTGAGAACTACTAGG - Intergenic
1111427678 13:88109492-88109514 AGGTATCCCTGAGAACCCAAAGG - Intergenic
1112584386 13:100705164-100705186 ATGTATCCCTGATAATTCAGTGG - Intergenic
1116310235 14:43316373-43316395 GTGTAACACTGATAACTGATGGG - Intergenic
1124515152 15:30361543-30361565 GTGGATCCCAGATAACTCCTAGG - Intronic
1124727770 15:32169184-32169206 GTGGATCCCAGATAACTCCTAGG + Intronic
1125077649 15:35638300-35638322 GAGTATCTCTGAGAACTAAGAGG + Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1127811072 15:62566142-62566164 TTATATCCCTGAGAACACACAGG + Intronic
1141533538 16:84663119-84663141 GTGGATCCCTGAGAAGGCAGTGG + Intronic
1142878125 17:2864631-2864653 GTGTAACCCTGTGAACACAGAGG + Intronic
1144256803 17:13476333-13476355 TAGTCTCCCTGAGAACTCAGAGG - Intergenic
1146424263 17:32721293-32721315 GTGTATGCCTGAGAAATTAGAGG - Intronic
1152166686 17:78712859-78712881 CTGCGTCCCTGAGAACTCAAGGG + Intronic
1164510423 19:28892032-28892054 CTGTATCACTGAGAAGTGATTGG - Intergenic
1166621880 19:44308695-44308717 CTGTTTCCCTGAGAATTCAAAGG + Intergenic
925217314 2:2108307-2108329 GTCCATTCCTAAGAACTCATCGG - Intronic
934178474 2:89598424-89598446 GTTAATGCCTGAGAACTCTTTGG + Intergenic
934288768 2:91672709-91672731 GTTAATGCCTGAGAACTCTTTGG + Intergenic
934935140 2:98459923-98459945 GTTTCTCCCTGAGAACTTACTGG - Intronic
935145791 2:100394468-100394490 CTGTTGCCCTGAGCACTCATGGG - Intronic
938242860 2:129756647-129756669 CTGTCTCCCTGAGAATTCAGAGG + Intergenic
940589326 2:155701131-155701153 GTGTTTCCCTGAGAAGTGAAGGG + Intergenic
941641332 2:167991896-167991918 CTGTCTTCCTGATAACTCATTGG - Intronic
942789443 2:179742242-179742264 GTTTATGCCTGAAAACTCCTAGG - Intronic
942898125 2:181083006-181083028 GAGTAGCCCTGAGAACCCACAGG + Intergenic
944949618 2:204732683-204732705 ATTTAAGCCTGAGAACTCATTGG + Intronic
947236368 2:227945524-227945546 CAGTCTCCCTGAGAACTCAGAGG + Intergenic
1171342478 20:24441296-24441318 GTGTCTCCCTGAAAATTCACAGG + Intergenic
1172455120 20:35065237-35065259 GTGTTTCCCTGAGAGGTTATGGG - Intronic
1173521754 20:43705151-43705173 GAGTATCCCTGAGACCTCAGGGG - Intronic
1175542341 20:59755651-59755673 GTGTTTCCCTGGGAACTTCTAGG + Intronic
1179486790 21:41715741-41715763 GTGGATCCCTGGGAACGCAGAGG - Intergenic
1180248565 21:46564408-46564430 GGGTCTCCCTGAGAACACAGAGG + Intronic
1183512482 22:38244177-38244199 GTGTATCCCTGAGAACTCATAGG - Intronic
949355095 3:3171931-3171953 GTGTATCTGTGAGACCTCACGGG + Intronic
950258668 3:11527494-11527516 TTGCATTCCTGGGAACTCATGGG + Intronic
963341206 3:144035789-144035811 GTGGATCCCTCAGAACCCTTGGG - Intronic
963371144 3:144401996-144402018 GTGTTTCCCTTGTAACTCATTGG - Intergenic
968682565 4:1931253-1931275 TTGTTTGCCTGAGAGCTCATAGG + Intronic
969830787 4:9794979-9795001 GTTAATGCCTGAGAACTCTTTGG - Intronic
970866834 4:20768950-20768972 GGGTGACCCTGAGAACTCGTGGG - Intronic
981026729 4:140084234-140084256 GTAAATCCCTGAGTAGTCATCGG - Intronic
982087743 4:151853565-151853587 ATGTGGCCCAGAGAACTCATGGG + Intergenic
992816446 5:80445132-80445154 TTGTAGCCCTGAGAATTCAGGGG + Intronic
993336609 5:86667245-86667267 GTGTGTCCAGGAGAACTCATTGG + Intergenic
993700972 5:91118857-91118879 TTGTATCTCTGTGAACTCATAGG + Intronic
999174703 5:149623902-149623924 GAGTATCACTCAGAACTCCTTGG + Intronic
1000507481 5:162139353-162139375 TTGTATTCCTGAAAACTCTTGGG - Intronic
1005407849 6:25510311-25510333 GTTTATCCCTGTGAAATAATAGG + Intronic
1005802964 6:29445640-29445662 GTGAATCCCAGAGAGCTCAGTGG - Intronic
1007564519 6:42839250-42839272 GAGTAGCACTGTGAACTCATAGG + Intronic
1008697648 6:54059333-54059355 GTAGATCCCTCAGAACTCCTTGG + Intronic
1009619389 6:66053122-66053144 GTGTCTCACTGACAACTCCTTGG - Intergenic
1016409611 6:143768151-143768173 ATGTGTCCCTCAGAATTCATGGG - Intronic
1017450636 6:154551703-154551725 GTGTCTCCCTGAAACCTCACAGG - Intergenic
1018008650 6:159647822-159647844 GTGGTTCCCTGAGGACTTATTGG - Intergenic
1020533482 7:9364256-9364278 GTAGCTCCCTGAGGACTCATTGG - Intergenic
1030546247 7:110899734-110899756 TTGTAGCCCAGAGAATTCATAGG - Intronic
1040955011 8:52970609-52970631 GTTTATCACTGAGATCCCATGGG + Intergenic
1048570990 8:135655900-135655922 GTGGACCCCTAGGAACTCATAGG + Intronic
1061019399 9:128004340-128004362 GAGAACCCCTGAGAACTCCTTGG + Intergenic
1061417831 9:130457499-130457521 GTGTCTCCCTGAAAAGTCATTGG + Intronic
1187091269 X:16099304-16099326 TTGTCTCCCTGAGAATTCAAAGG - Intergenic
1188441400 X:30217705-30217727 GAACATCCCTGAGAACCCATAGG - Intronic
1193910480 X:87300385-87300407 CTCTCTCCCTGAGAACTCAGAGG + Intergenic
1194403617 X:93467820-93467842 TTGGATCCCTGAGAACCCCTGGG + Intergenic
1195943394 X:110183294-110183316 GCCTATCCCTGAAAACTGATTGG - Intergenic
1197425002 X:126285665-126285687 TTGCATACCTGAGAACTAATAGG - Intergenic
1198328228 X:135595771-135595793 GTGTATGCCAGAGAACTTGTTGG + Intergenic
1200467523 Y:3538102-3538124 GTGTATCCCTTAAAATTAATTGG - Intergenic