ID: 1183515680

View in Genome Browser
Species Human (GRCh38)
Location 22:38264490-38264512
Sequence CATACCCTGCACAAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183515676_1183515680 5 Left 1183515676 22:38264462-38264484 CCAGATGAGTGGTGAGCACCTCT 0: 1
1: 0
2: 0
3: 5
4: 117
Right 1183515680 22:38264490-38264512 CATACCCTGCACAAGCTGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 117
1183515672_1183515680 29 Left 1183515672 22:38264438-38264460 CCAAGTGCTTCCAGTCTAGCCAT 0: 1
1: 0
2: 2
3: 12
4: 114
Right 1183515680 22:38264490-38264512 CATACCCTGCACAAGCTGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 117
1183515675_1183515680 10 Left 1183515675 22:38264457-38264479 CCATTCCAGATGAGTGGTGAGCA 0: 1
1: 0
2: 1
3: 8
4: 142
Right 1183515680 22:38264490-38264512 CATACCCTGCACAAGCTGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 117
1183515673_1183515680 19 Left 1183515673 22:38264448-38264470 CCAGTCTAGCCATTCCAGATGAG 0: 1
1: 0
2: 0
3: 11
4: 92
Right 1183515680 22:38264490-38264512 CATACCCTGCACAAGCTGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183515680 Original CRISPR CATACCCTGCACAAGCTGCA GGG Intronic
900484898 1:2917853-2917875 CAGAGCCTGCAGAAGCTGGAAGG - Intergenic
900986482 1:6076130-6076152 TGTACCCTGCACTATCTGCAGGG + Intronic
901478869 1:9510226-9510248 CAAACCCAGCTTAAGCTGCAGGG + Intergenic
902472273 1:16657218-16657240 CAGAGCCTGCTCCAGCTGCAGGG + Intergenic
902486530 1:16750228-16750250 CAGAGCCTGCTCCAGCTGCAGGG - Intronic
902504362 1:16929838-16929860 CAGAGCCTGCTCCAGCTGCAGGG - Exonic
904681395 1:32231920-32231942 CTGAGCCTGCAGAAGCTGCATGG - Intergenic
906343831 1:45003212-45003234 CAAGCCCAGCACAAGCTGCCAGG - Exonic
907727627 1:57034485-57034507 CAGACCCTCTACCAGCTGCAGGG - Intronic
910113738 1:83709958-83709980 ATTACCCTGCACAGGCTGGAAGG + Intergenic
911102336 1:94104588-94104610 CTTCCCCTGCCCCAGCTGCATGG - Intronic
913364256 1:118018188-118018210 CAGAACCTGCACAATCTGGATGG + Intronic
917014850 1:170518434-170518456 CAACCCCTGCACAGGCTGCTTGG + Intergenic
918103719 1:181398607-181398629 CACACCCTGCTCCAGCTGCCAGG - Intergenic
918744127 1:188177692-188177714 CAAACACTGTACAATCTGCAGGG - Intergenic
922500830 1:226095765-226095787 CATACCCTGGTCAAGCTTCAAGG - Intergenic
1063879612 10:10517643-10517665 CCTACCCTTCCCATGCTGCAGGG - Intergenic
1069085147 10:64130161-64130183 CATGCTCTTCACAAGCTGCAGGG - Intergenic
1069959950 10:72073719-72073741 CTCACCCTGCTCCAGCTGCAGGG + Intronic
1075621821 10:123933813-123933835 CATACCCTTCATAAGATGTAAGG + Intronic
1077250813 11:1559841-1559863 CCTGCCCTGCACCAGCTGGAAGG + Intronic
1077359944 11:2136459-2136481 CACCCCCTCCACAGGCTGCAGGG + Intronic
1080944823 11:36958894-36958916 CATACACTGCACCAGGTGCCAGG + Intergenic
1081477611 11:43450167-43450189 CATACCCTGGACCACTTGCATGG + Exonic
1082723406 11:56706366-56706388 CAGACCCTTCACAAGCACCAGGG - Intergenic
1084664243 11:70567861-70567883 CACACCCTGGAATAGCTGCAGGG + Intronic
1086341846 11:85855197-85855219 CATCCCCTCCACAGCCTGCAGGG - Exonic
1098235730 12:68416494-68416516 CAGGCCCCGCACAAGCTGGATGG + Intergenic
1098394410 12:70003046-70003068 CACACGCTGCACAGGCTGCGAGG - Intergenic
1106564302 13:30871556-30871578 CAAACCCTTCCCAGGCTGCAGGG + Intergenic
1107851033 13:44573954-44573976 CAGTCCCAGCACAACCTGCAGGG - Exonic
1109313874 13:60727197-60727219 AATATCCTGCATCAGCTGCAAGG - Intergenic
1113779922 13:112970551-112970573 CAAACCCTGCAAACCCTGCACGG - Intronic
1127226793 15:56939718-56939740 CTTTCCTAGCACAAGCTGCATGG + Intronic
1128392685 15:67193328-67193350 CAGTCTCAGCACAAGCTGCAAGG - Exonic
1129228029 15:74181117-74181139 CATCCACTGCACGTGCTGCAGGG + Intronic
1131214582 15:90526641-90526663 CCTACATTGCACAAGCTGAAAGG + Intergenic
1132637042 16:955838-955860 CACTCCCAGCACACGCTGCAGGG + Intronic
1134062545 16:11207847-11207869 CATGCCATGCCCTAGCTGCAAGG - Intergenic
1135540879 16:23329611-23329633 GTAACCCTGCACAAGCTACATGG - Intronic
1137575096 16:49594172-49594194 AACACCCTGCACAATCTGGAAGG - Intronic
1138806941 16:60100958-60100980 CATCCCCAGCAGCAGCTGCATGG - Intergenic
1141625897 16:85260922-85260944 CCTACCCTGGCCTAGCTGCAGGG + Intergenic
1142227676 16:88885477-88885499 CAACCCCTGCTCCAGCTGCATGG + Intronic
1142330593 16:89450101-89450123 CACACTCTGCTCCAGCTGCAGGG + Intronic
1144782785 17:17816296-17816318 CATCCCCTGCACACTCTGCCAGG + Exonic
1147403015 17:40192201-40192223 CAAACTCTGCAGAAGCTGCCAGG + Exonic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1156499687 18:37549752-37549774 GATACAGTGCACAAGATGCATGG + Intronic
1157283529 18:46361685-46361707 CCTACCCTACTCAAGGTGCAGGG + Intronic
1157459876 18:47881046-47881068 CCTACCCTGCACACTTTGCATGG + Intronic
1157538250 18:48477254-48477276 CATACCATGATCAAGTTGCAAGG + Intergenic
1157546679 18:48551375-48551397 CACTCCCTCCACAAGCTGCAGGG - Intronic
1162234587 19:9297985-9298007 GATACCCTGCACAAGCAGAAAGG + Exonic
1165710356 19:38006350-38006372 CACACCCTGCAAAGCCTGCAAGG - Intronic
1168164231 19:54535721-54535743 CATCCCCTGGTCAAGCTGCTGGG - Exonic
1202704670 1_KI270713v1_random:14012-14034 CAGAGCCTGCTCCAGCTGCAGGG + Intergenic
927509044 2:23632912-23632934 CATGCCATGCCCTAGCTGCAGGG + Intronic
934711977 2:96522363-96522385 CACACCCAGCAGAAGCTGGAGGG - Intergenic
937220744 2:120342002-120342024 CACACCTTGCAGGAGCTGCAGGG + Intergenic
937735263 2:125280231-125280253 AATGCCCTGCACATGGTGCAGGG - Intergenic
938312420 2:130301820-130301842 CAAACCCCGCACCAGCTGCAGGG - Intergenic
939303699 2:140381503-140381525 CATACCCTGCAAAAGCTTCTTGG - Intronic
940837384 2:158538244-158538266 AATACCCTGCACATGATGCTTGG - Intronic
1170873239 20:20227532-20227554 ACTTCCCTGCAGAAGCTGCAAGG - Intronic
1173735087 20:45354961-45354983 CAGACCTTGGACAAGGTGCAAGG - Intergenic
1174197506 20:48783994-48784016 CAAATCCTGCAAAAGATGCAGGG + Intronic
1175188208 20:57194049-57194071 CATCCCCAGCAGGAGCTGCAGGG - Intronic
1181566587 22:23742524-23742546 CATACACAGCCCAGGCTGCAAGG + Exonic
1183515680 22:38264490-38264512 CATACCCTGCACAAGCTGCAGGG + Intronic
1184358398 22:43997714-43997736 CATTACCTGCAGAAGCTGCAGGG + Intronic
1184876878 22:47281897-47281919 CATAACCCGCAGAAGCTGCCTGG - Intergenic
950074541 3:10177883-10177905 CACACCCTGCACCCGCTCCATGG - Exonic
950695776 3:14700104-14700126 CATCCCCAGCAGCAGCTGCAAGG - Intronic
950961157 3:17109346-17109368 TAGACCCTGCAGAACCTGCAAGG + Intergenic
954444738 3:50540591-50540613 CAGCCCCTGCACAGTCTGCAGGG - Intergenic
957169360 3:76718046-76718068 CATAACCTGCCCAAACTGGATGG + Intronic
960556932 3:119040163-119040185 CAGACCCTGCACAGGATGGATGG + Intronic
961211943 3:125132142-125132164 CATGCTCTGCACCAGCTCCAGGG - Intronic
961634146 3:128322296-128322318 CGGTCCCTCCACAAGCTGCAGGG - Intronic
962927509 3:140008484-140008506 CAGGCCCTGCACAAGCAGCATGG - Intronic
963087561 3:141452477-141452499 CATACCATGCAGAACCTTCAAGG + Intergenic
976384533 4:84440365-84440387 GATACCCAGCAAAATCTGCATGG - Intergenic
976680521 4:87750886-87750908 CATATCCTGCGCCAGCTGCATGG + Intergenic
977435175 4:96986202-96986224 CAAACCCTGGAGAAGCAGCAGGG - Intergenic
985727751 5:1524635-1524657 CAGCCCCTGCACAACCAGCACGG - Intergenic
987907112 5:24091250-24091272 CATACCCTGCACACGTGGTAAGG - Intronic
988342666 5:29994183-29994205 CTTACCCTTCACAAGATTCATGG - Intergenic
996321112 5:122218202-122218224 CACACGCTGCACAGGATGCATGG - Intergenic
999389454 5:151179703-151179725 CATTCCCTGCAGTGGCTGCAAGG + Intergenic
1000025225 5:157353007-157353029 CATTCCCTCCAGAAACTGCAGGG - Intronic
1000950674 5:167478472-167478494 CAAACAATGCACAAGCTACAAGG - Intronic
1003459796 6:6319474-6319496 CAGTGCCTGCACAAGCTCCAAGG - Intronic
1004223159 6:13764277-13764299 CAAACCATCCACAAGCTACAAGG - Intergenic
1009594534 6:65717225-65717247 CAGACCCTGCAAAAGCCACAAGG + Intergenic
1013313060 6:108915584-108915606 CAAATCCTGCACAATCTTCAGGG - Intronic
1013340149 6:109206087-109206109 CATACCACCCACAAGCAGCAGGG - Intergenic
1021012641 7:15490647-15490669 CATAAACTGAACAATCTGCAAGG + Intronic
1022496998 7:30859630-30859652 CATCCCCTGCACAAGTGCCAGGG - Intronic
1022814329 7:33899935-33899957 CATACACTGCACAAACTGGGGGG + Intergenic
1023038526 7:36153287-36153309 CAGACCCAGCACCAGCCGCACGG - Exonic
1024250852 7:47504714-47504736 CATACCCTGCAGGAGCAGCTGGG + Intronic
1024336993 7:48219035-48219057 CATGCCCTGCACACGGTGCCTGG - Intronic
1026985383 7:74552039-74552061 CTCACCCTGTACCAGCTGCAAGG - Intronic
1029218472 7:98969593-98969615 CAGGCCGTGCACAAGCTGCCTGG - Intronic
1029695929 7:102213206-102213228 AGTACCCTGCACCATCTGCAAGG - Intronic
1035625332 8:1066969-1066991 CATCCCCAGCCCAAGCTGCCTGG + Intergenic
1055739980 9:79377483-79377505 CATTCCCTCCCCCAGCTGCAGGG + Intergenic
1056249754 9:84735447-84735469 GATGCCCTGCAGAAGCTGGAGGG + Intronic
1057567952 9:96181544-96181566 CATCTCCTGCAGAGGCTGCAGGG - Intergenic
1057741901 9:97719354-97719376 CATCTCCTGCACAATCTGCCAGG - Intergenic
1059353378 9:113681792-113681814 CATCCCCTGCACTAACTGCACGG + Intergenic
1060081755 9:120654136-120654158 CATTACCTGCATGAGCTGCAGGG + Intronic
1060677065 9:125524877-125524899 CATATCCTGCTCCAGATGCAGGG + Intronic
1062569518 9:137178717-137178739 CAGACCCTCCACAAGCTGCAAGG + Intronic
1186762147 X:12734285-12734307 CAAACCAGGCAGAAGCTGCAAGG + Intergenic
1191787710 X:64934913-64934935 CAGACGCTGAACTAGCTGCAGGG + Intronic
1194172782 X:90608340-90608362 AATACCTAGCACAAGATGCAAGG + Intergenic
1194358779 X:92920612-92920634 CATACCATGCTGAAGCTGCAGGG + Intergenic
1200295789 X:154918557-154918579 CATCCCCTTCCCAAGCTGCCAGG - Intronic
1200666945 Y:6036306-6036328 CATACCATGCTGAAGCTGCAGGG + Intergenic
1200686991 Y:6266375-6266397 GCTACCCGGCACAAGCTCCAAGG + Intergenic
1200768080 Y:7097676-7097698 CATGCCTTGCTCTAGCTGCAAGG + Intergenic
1200989869 Y:9337292-9337314 GCTACCCGGCACAAGCTCCAAGG + Intergenic
1200992537 Y:9357625-9357647 GCTACCCGGCACAAGCTCCAAGG + Intergenic
1200995189 Y:9377903-9377925 GCTACCCGGCACAAGCTCCAAGG + Intronic
1200997854 Y:9398249-9398271 GCTACCCGGCACAAGCTCCAAGG + Intergenic
1201000363 Y:9466782-9466804 GCTACCCGGCACAAGCTCCAAGG + Intergenic
1201003025 Y:9487095-9487117 GCTACCCGGCACAAGCTCCAAGG + Intronic
1201005684 Y:9507378-9507400 GCTACCCGGCACAAGCTCCAAGG + Intergenic
1201008344 Y:9527708-9527730 GCTACCCGGCACAAGCTCCAAGG + Intergenic
1201010938 Y:9547890-9547912 GCTACCCGGCACAAGCTCCAAGG + Intergenic