ID: 1183516512

View in Genome Browser
Species Human (GRCh38)
Location 22:38269999-38270021
Sequence AGGCCTTGAAAGTTTCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183516512_1183516519 16 Left 1183516512 22:38269999-38270021 CCTTCCAGAAACTTTCAAGGCCT No data
Right 1183516519 22:38270038-38270060 ATCAAGTTCAAACTCCTTGGCGG No data
1183516512_1183516514 -7 Left 1183516512 22:38269999-38270021 CCTTCCAGAAACTTTCAAGGCCT No data
Right 1183516514 22:38270015-38270037 AAGGCCTCCCTGTTGACATCAGG No data
1183516512_1183516521 18 Left 1183516512 22:38269999-38270021 CCTTCCAGAAACTTTCAAGGCCT No data
Right 1183516521 22:38270040-38270062 CAAGTTCAAACTCCTTGGCGGGG No data
1183516512_1183516520 17 Left 1183516512 22:38269999-38270021 CCTTCCAGAAACTTTCAAGGCCT No data
Right 1183516520 22:38270039-38270061 TCAAGTTCAAACTCCTTGGCGGG No data
1183516512_1183516522 28 Left 1183516512 22:38269999-38270021 CCTTCCAGAAACTTTCAAGGCCT No data
Right 1183516522 22:38270050-38270072 CTCCTTGGCGGGGCCTCCAAAGG No data
1183516512_1183516518 13 Left 1183516512 22:38269999-38270021 CCTTCCAGAAACTTTCAAGGCCT No data
Right 1183516518 22:38270035-38270057 AGGATCAAGTTCAAACTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183516512 Original CRISPR AGGCCTTGAAAGTTTCTGGA AGG (reversed) Intronic