ID: 1183516514

View in Genome Browser
Species Human (GRCh38)
Location 22:38270015-38270037
Sequence AAGGCCTCCCTGTTGACATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183516512_1183516514 -7 Left 1183516512 22:38269999-38270021 CCTTCCAGAAACTTTCAAGGCCT No data
Right 1183516514 22:38270015-38270037 AAGGCCTCCCTGTTGACATCAGG No data
1183516509_1183516514 22 Left 1183516509 22:38269970-38269992 CCCATAACACATGGCTGAGCATG No data
Right 1183516514 22:38270015-38270037 AAGGCCTCCCTGTTGACATCAGG No data
1183516510_1183516514 21 Left 1183516510 22:38269971-38269993 CCATAACACATGGCTGAGCATGT No data
Right 1183516514 22:38270015-38270037 AAGGCCTCCCTGTTGACATCAGG No data
1183516508_1183516514 23 Left 1183516508 22:38269969-38269991 CCCCATAACACATGGCTGAGCAT No data
Right 1183516514 22:38270015-38270037 AAGGCCTCCCTGTTGACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183516514 Original CRISPR AAGGCCTCCCTGTTGACATC AGG Intronic