ID: 1183516516

View in Genome Browser
Species Human (GRCh38)
Location 22:38270022-38270044
Sequence ACTTGATCCTGATGTCAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183516516_1183516524 13 Left 1183516516 22:38270022-38270044 CCCTGTTGACATCAGGATCAAGT No data
Right 1183516524 22:38270058-38270080 CGGGGCCTCCAAAGGTCTTCAGG No data
1183516516_1183516521 -5 Left 1183516516 22:38270022-38270044 CCCTGTTGACATCAGGATCAAGT No data
Right 1183516521 22:38270040-38270062 CAAGTTCAAACTCCTTGGCGGGG No data
1183516516_1183516520 -6 Left 1183516516 22:38270022-38270044 CCCTGTTGACATCAGGATCAAGT No data
Right 1183516520 22:38270039-38270061 TCAAGTTCAAACTCCTTGGCGGG No data
1183516516_1183516519 -7 Left 1183516516 22:38270022-38270044 CCCTGTTGACATCAGGATCAAGT No data
Right 1183516519 22:38270038-38270060 ATCAAGTTCAAACTCCTTGGCGG No data
1183516516_1183516522 5 Left 1183516516 22:38270022-38270044 CCCTGTTGACATCAGGATCAAGT No data
Right 1183516522 22:38270050-38270072 CTCCTTGGCGGGGCCTCCAAAGG No data
1183516516_1183516518 -10 Left 1183516516 22:38270022-38270044 CCCTGTTGACATCAGGATCAAGT No data
Right 1183516518 22:38270035-38270057 AGGATCAAGTTCAAACTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183516516 Original CRISPR ACTTGATCCTGATGTCAACA GGG (reversed) Intronic