ID: 1183516519

View in Genome Browser
Species Human (GRCh38)
Location 22:38270038-38270060
Sequence ATCAAGTTCAAACTCCTTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183516515_1183516519 -4 Left 1183516515 22:38270019-38270041 CCTCCCTGTTGACATCAGGATCA No data
Right 1183516519 22:38270038-38270060 ATCAAGTTCAAACTCCTTGGCGG No data
1183516513_1183516519 12 Left 1183516513 22:38270003-38270025 CCAGAAACTTTCAAGGCCTCCCT No data
Right 1183516519 22:38270038-38270060 ATCAAGTTCAAACTCCTTGGCGG No data
1183516517_1183516519 -8 Left 1183516517 22:38270023-38270045 CCTGTTGACATCAGGATCAAGTT No data
Right 1183516519 22:38270038-38270060 ATCAAGTTCAAACTCCTTGGCGG No data
1183516516_1183516519 -7 Left 1183516516 22:38270022-38270044 CCCTGTTGACATCAGGATCAAGT 0: 1
1: 1
2: 1
3: 20
4: 168
Right 1183516519 22:38270038-38270060 ATCAAGTTCAAACTCCTTGGCGG No data
1183516512_1183516519 16 Left 1183516512 22:38269999-38270021 CCTTCCAGAAACTTTCAAGGCCT No data
Right 1183516519 22:38270038-38270060 ATCAAGTTCAAACTCCTTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183516519 Original CRISPR ATCAAGTTCAAACTCCTTGG CGG Intronic