ID: 1183522343

View in Genome Browser
Species Human (GRCh38)
Location 22:38302884-38302906
Sequence CCGCAAATTCAGCCTCAAGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183522343_1183522346 -5 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1183522343 22:38302884-38302906 CCGTCTTGAGGCTGAATTTGCGG 0: 1
1: 0
2: 0
3: 0
4: 67
Right 1183522346 22:38302902-38302924 TGCGGGAACAGAAGTTGAACAGG 0: 1
1: 0
2: 0
3: 8
4: 121
1183522343_1183522347 4 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1183522343 22:38302884-38302906 CCGTCTTGAGGCTGAATTTGCGG 0: 1
1: 0
2: 0
3: 0
4: 67
Right 1183522347 22:38302911-38302933 AGAAGTTGAACAGGTCCTCGAGG 0: 1
1: 0
2: 2
3: 5
4: 76
1183522343_1183522348 9 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1183522343 22:38302884-38302906 CCGTCTTGAGGCTGAATTTGCGG 0: 1
1: 0
2: 0
3: 0
4: 67
Right 1183522348 22:38302916-38302938 TTGAACAGGTCCTCGAGGCTAGG 0: 1
1: 0
2: 5
3: 7
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183522343 Original CRISPR CCGCAAATTCAGCCTCAAGA CGG (reversed) Exonic