ID: 1183522345 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:38302885-38302907 |
Sequence | CGTCTTGAGGCTGAATTTGC GGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 82 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 6, 4: 74} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1183522341_1183522345 | -10 | Complete | closest: None total_pairs: 1 max_distance: 1000 |
Left | 1183522341 | 22:38302872-38302894 | CCAAGAGCAGCACCGTCTTGAGG | 0: 1 1: 0 2: 0 3: 9 4: 108 |
Right | 1183522345 | 22:38302885-38302907 | CGTCTTGAGGCTGAATTTGCGGG | 0: 1 1: 0 2: 1 3: 6 4: 74 |
||||
1183522340_1183522345 | 2 | Complete | closest: None total_pairs: 1 max_distance: 1000 |
Left | 1183522340 | 22:38302860-38302882 | CCATCTGGTCGGCCAAGAGCAGC | 0: 1 1: 0 2: 0 3: 7 4: 102 |
Right | 1183522345 | 22:38302885-38302907 | CGTCTTGAGGCTGAATTTGCGGG | 0: 1 1: 0 2: 1 3: 6 4: 74 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1183522345 | Original CRISPR | CGTCTTGAGGCTGAATTTGC GGG | Exonic | ||