ID: 1183522345

View in Genome Browser
Species Human (GRCh38)
Location 22:38302885-38302907
Sequence CGTCTTGAGGCTGAATTTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183522341_1183522345 -10 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1183522341 22:38302872-38302894 CCAAGAGCAGCACCGTCTTGAGG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1183522345 22:38302885-38302907 CGTCTTGAGGCTGAATTTGCGGG 0: 1
1: 0
2: 1
3: 6
4: 74
1183522340_1183522345 2 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1183522340 22:38302860-38302882 CCATCTGGTCGGCCAAGAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1183522345 22:38302885-38302907 CGTCTTGAGGCTGAATTTGCGGG 0: 1
1: 0
2: 1
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183522345 Original CRISPR CGTCTTGAGGCTGAATTTGC GGG Exonic