ID: 1183522347

View in Genome Browser
Species Human (GRCh38)
Location 22:38302911-38302933
Sequence AGAAGTTGAACAGGTCCTCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183522343_1183522347 4 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1183522343 22:38302884-38302906 CCGTCTTGAGGCTGAATTTGCGG 0: 1
1: 0
2: 0
3: 0
4: 67
Right 1183522347 22:38302911-38302933 AGAAGTTGAACAGGTCCTCGAGG 0: 1
1: 0
2: 2
3: 5
4: 76
1183522341_1183522347 16 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1183522341 22:38302872-38302894 CCAAGAGCAGCACCGTCTTGAGG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1183522347 22:38302911-38302933 AGAAGTTGAACAGGTCCTCGAGG 0: 1
1: 0
2: 2
3: 5
4: 76
1183522340_1183522347 28 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1183522340 22:38302860-38302882 CCATCTGGTCGGCCAAGAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1183522347 22:38302911-38302933 AGAAGTTGAACAGGTCCTCGAGG 0: 1
1: 0
2: 2
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183522347 Original CRISPR AGAAGTTGAACAGGTCCTCG AGG Exonic