ID: 1183522348

View in Genome Browser
Species Human (GRCh38)
Location 22:38302916-38302938
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 5, 3: 7, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183522341_1183522348 21 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1183522341 22:38302872-38302894 CCAAGAGCAGCACCGTCTTGAGG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1183522348 22:38302916-38302938 TTGAACAGGTCCTCGAGGCTAGG 0: 1
1: 0
2: 5
3: 7
4: 141
1183522343_1183522348 9 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1183522343 22:38302884-38302906 CCGTCTTGAGGCTGAATTTGCGG 0: 1
1: 0
2: 0
3: 0
4: 67
Right 1183522348 22:38302916-38302938 TTGAACAGGTCCTCGAGGCTAGG 0: 1
1: 0
2: 5
3: 7
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type