ID: 1183526830

View in Genome Browser
Species Human (GRCh38)
Location 22:38328040-38328062
Sequence AGGGCCTCAGAGGTCTGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183526822_1183526830 9 Left 1183526822 22:38328008-38328030 CCCACAAGCATTTCCTGATGCCA No data
Right 1183526830 22:38328040-38328062 AGGGCCTCAGAGGTCTGCGCCGG No data
1183526821_1183526830 25 Left 1183526821 22:38327992-38328014 CCACATCACACGTTCACCCACAA No data
Right 1183526830 22:38328040-38328062 AGGGCCTCAGAGGTCTGCGCCGG No data
1183526825_1183526830 -4 Left 1183526825 22:38328021-38328043 CCTGATGCCAACTCCTTGCAGGG No data
Right 1183526830 22:38328040-38328062 AGGGCCTCAGAGGTCTGCGCCGG No data
1183526823_1183526830 8 Left 1183526823 22:38328009-38328031 CCACAAGCATTTCCTGATGCCAA No data
Right 1183526830 22:38328040-38328062 AGGGCCTCAGAGGTCTGCGCCGG No data
1183526820_1183526830 29 Left 1183526820 22:38327988-38328010 CCTGCCACATCACACGTTCACCC No data
Right 1183526830 22:38328040-38328062 AGGGCCTCAGAGGTCTGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183526830 Original CRISPR AGGGCCTCAGAGGTCTGCGC CGG Intronic