ID: 1183529809

View in Genome Browser
Species Human (GRCh38)
Location 22:38347295-38347317
Sequence TGTCACCTCCTGGGAGTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 255}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183529809_1183529819 -1 Left 1183529809 22:38347295-38347317 CCCGGCACTCCCAGGAGGTGACA 0: 1
1: 0
2: 1
3: 16
4: 255
Right 1183529819 22:38347317-38347339 AGGTGGCCACAGGAGTGGGAGGG 0: 1
1: 0
2: 3
3: 54
4: 423
1183529809_1183529824 13 Left 1183529809 22:38347295-38347317 CCCGGCACTCCCAGGAGGTGACA 0: 1
1: 0
2: 1
3: 16
4: 255
Right 1183529824 22:38347331-38347353 GTGGGAGGGGGAAACGGAAGAGG No data
1183529809_1183529818 -2 Left 1183529809 22:38347295-38347317 CCCGGCACTCCCAGGAGGTGACA 0: 1
1: 0
2: 1
3: 16
4: 255
Right 1183529818 22:38347316-38347338 CAGGTGGCCACAGGAGTGGGAGG 0: 1
1: 0
2: 5
3: 61
4: 453
1183529809_1183529823 7 Left 1183529809 22:38347295-38347317 CCCGGCACTCCCAGGAGGTGACA 0: 1
1: 0
2: 1
3: 16
4: 255
Right 1183529823 22:38347325-38347347 ACAGGAGTGGGAGGGGGAAACGG No data
1183529809_1183529817 -5 Left 1183529809 22:38347295-38347317 CCCGGCACTCCCAGGAGGTGACA 0: 1
1: 0
2: 1
3: 16
4: 255
Right 1183529817 22:38347313-38347335 TGACAGGTGGCCACAGGAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 232
1183529809_1183529820 0 Left 1183529809 22:38347295-38347317 CCCGGCACTCCCAGGAGGTGACA 0: 1
1: 0
2: 1
3: 16
4: 255
Right 1183529820 22:38347318-38347340 GGTGGCCACAGGAGTGGGAGGGG No data
1183529809_1183529821 1 Left 1183529809 22:38347295-38347317 CCCGGCACTCCCAGGAGGTGACA 0: 1
1: 0
2: 1
3: 16
4: 255
Right 1183529821 22:38347319-38347341 GTGGCCACAGGAGTGGGAGGGGG 0: 1
1: 0
2: 4
3: 73
4: 648
1183529809_1183529816 -6 Left 1183529809 22:38347295-38347317 CCCGGCACTCCCAGGAGGTGACA 0: 1
1: 0
2: 1
3: 16
4: 255
Right 1183529816 22:38347312-38347334 GTGACAGGTGGCCACAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183529809 Original CRISPR TGTCACCTCCTGGGAGTGCC GGG (reversed) Intronic
900627363 1:3614956-3614978 TGTCTCATCCTGGGAATGCAGGG - Intergenic
900676010 1:3886751-3886773 GGTCACCTGCTGGGAGGTCCTGG + Intergenic
901157351 1:7149555-7149577 TGCCACCTCCTGGGGCTGCTGGG + Intronic
901212816 1:7536113-7536135 TGTCACCTCTGGGGGCTGCCAGG - Intronic
901675268 1:10879811-10879833 GGCCACCTTCTAGGAGTGCCAGG + Intergenic
902397104 1:16138323-16138345 TGCCACCTCCTGCGAGTGTGAGG - Exonic
902936471 1:19768460-19768482 TGACAACTCCTGAGACTGCCTGG + Intronic
903663792 1:24994840-24994862 TTGCACCTTCTGGGAGTGCGTGG + Intergenic
904316486 1:29669527-29669549 TGGAACCTCCTGGGTCTGCCGGG - Intergenic
905318299 1:37097497-37097519 TGACACCTCCGGGCAGGGCCTGG - Intergenic
905465842 1:38152520-38152542 TGACAGCTCCTGGAAGTGCGTGG - Intergenic
906702742 1:47871799-47871821 AGTCACTTCCTGGGGGGGCCAGG - Intronic
908003117 1:59701103-59701125 TGTCATCCACTGGGAGTGCTGGG + Intronic
914933623 1:151958445-151958467 TGTCACTTCCTGGCAGGCCCAGG + Intergenic
915328339 1:155092787-155092809 TGTTCCCTCCTGTGGGTGCCTGG - Intergenic
916033008 1:160894884-160894906 TGTGGCCGGCTGGGAGTGCCAGG - Intergenic
916327615 1:163580925-163580947 TGTCAACTCCTCTGAGTCCCTGG + Intergenic
916533742 1:165683014-165683036 TGACATTTCCTGGCAGTGCCTGG - Exonic
918418318 1:184335784-184335806 GGTGACCTCCTGGGAGTGGGTGG + Intergenic
919664204 1:200276651-200276673 GGTCACCTGCTGGGGGTGCAGGG - Intergenic
919859144 1:201727589-201727611 GGTCAGCTTCTGGGGGTGCCCGG - Intronic
920078323 1:203353354-203353376 TGGCCCCTCCTGGAAGTGGCGGG - Intergenic
922193346 1:223339104-223339126 GGTCTCCTCCTGTGACTGCCAGG - Intronic
922252080 1:223858504-223858526 TGTCTCATCCTGGGAGGGTCAGG - Intergenic
922806392 1:228392199-228392221 TGTCACCTCCTCTGAGAGACTGG + Intergenic
924470216 1:244336687-244336709 GGTGACCAGCTGGGAGTGCCGGG + Intergenic
1065349822 10:24785415-24785437 AGCTACCTCCTGGGAGTGGCCGG + Intergenic
1067580816 10:47444327-47444349 TGCTTCCTCCTGGGAGTGTCAGG - Intergenic
1069798099 10:71066094-71066116 TGTCACCTACTGAGAGGCCCTGG + Intergenic
1069798542 10:71068469-71068491 TGTCACCTACTGAGAGGCCCTGG - Intergenic
1070547679 10:77465385-77465407 TGGCACCTCCTGGGGCTGCTGGG + Intronic
1071549696 10:86557154-86557176 TGTCACCTCCTGCTGGTGCCAGG + Intergenic
1072532686 10:96334387-96334409 TGTCCTCTCCTGTGAGTGACAGG - Intronic
1072624708 10:97103828-97103850 GGTCACCTGCTGGGAATGGCTGG - Intronic
1073603305 10:104867710-104867732 TGTCACCTCCTAGGCAGGCCTGG - Intronic
1074406035 10:113181042-113181064 AGTGTCCTCCTGGGAGGGCCTGG + Intergenic
1075152301 10:119944932-119944954 TGTTACCTCCTGGAAGAGGCTGG + Intergenic
1075454519 10:122576561-122576583 TGTCAGCTCCAGGAAATGCCTGG + Exonic
1075968968 10:126637147-126637169 TGTCTCCTCCTGGTGTTGCCTGG - Intronic
1076164822 10:128273245-128273267 GGTCAGCTCCCGGGAGTGCTGGG + Intergenic
1076286673 10:129306262-129306284 GGTCACCTCCTAGCACTGCCTGG + Intergenic
1076624888 10:131815764-131815786 GGGCACCTCCTGTGAATGCCTGG - Intergenic
1076998066 11:308763-308785 TCTCACTTTCTGGGAGAGCCTGG - Intronic
1076999287 11:314682-314704 TCTCACTTTCTGGGAGAGCCTGG - Intronic
1077000578 11:320218-320240 TCTCACTTTCTGGGAGAGCCTGG + Intronic
1077009257 11:372937-372959 TGTTCCCTCATGTGAGTGCCGGG + Exonic
1077148941 11:1059896-1059918 AGCCACCTCCTGGCAGTCCCAGG - Intergenic
1077148954 11:1059943-1059965 AGCCACCTCCTGGCAGTCCCAGG - Intergenic
1077198584 11:1293775-1293797 CGCCACCTCCTGGCAGGGCCTGG - Intronic
1077275097 11:1701349-1701371 TGTCTCCTTCTGGCAGTGGCTGG - Intergenic
1078921459 11:15834866-15834888 TGTCACCTCCTCAGAGTAGCAGG + Intergenic
1081164118 11:39786692-39786714 TGGCACCTCCTTGGAGGACCTGG - Intergenic
1082623725 11:55458148-55458170 TGTTACCTCCTGTGGGTTCCTGG - Intergenic
1083321761 11:61852052-61852074 TGCCACCTCATGGGGGTGCCGGG - Intronic
1083514131 11:63240807-63240829 TGTCATCTCCTGTGAGAGCAAGG + Intronic
1083601693 11:63952616-63952638 TGTCACCTGGCTGGAGTGCCTGG - Intronic
1084590115 11:70085526-70085548 GCTCACCACCTGGGAGGGCCTGG - Intronic
1084624855 11:70298546-70298568 TGTCACTTCCTGGCAGCACCTGG - Intronic
1084946290 11:72640574-72640596 TGGCACATCCTGGGATTGCTTGG - Intronic
1085624883 11:78064264-78064286 TGTCACCTCCTGGGCTTTCTCGG - Exonic
1085720666 11:78909853-78909875 GGTCACTTCCTGGAGGTGCCAGG + Intronic
1086263413 11:84969280-84969302 TGTCACCTCCAGCCAGGGCCAGG + Intronic
1086569282 11:88263773-88263795 TGTCAGCTACTGGGGGTGGCTGG + Intergenic
1089431241 11:118426338-118426360 TTTGACCTCCTTGGAGTTCCTGG - Intronic
1092189763 12:6510635-6510657 TGGAAGCTCCTGGGAGTGGCGGG - Exonic
1092324733 12:7518071-7518093 GGTCACTTCCTGGAAGGGCCAGG - Intergenic
1094698154 12:32842203-32842225 TTACACCTGCTGGGAGTCCCTGG - Intronic
1096103909 12:48985769-48985791 TGTCATCCCCTGGGAGGGGCAGG + Intergenic
1096535178 12:52267451-52267473 CATCACCTCCTGGTACTGCCTGG - Intronic
1098888630 12:75985033-75985055 TGTCACCTTCTGGGTGAGGCTGG + Intergenic
1099149537 12:79092120-79092142 TGTCACTTCCTGAGAGGCCCTGG - Intronic
1103562058 12:121797986-121798008 TGGCTCCTCCTGTGAGGGCCAGG - Intronic
1103778554 12:123384166-123384188 TGTCACCGCCTGGGATCTCCCGG - Exonic
1104097459 12:125570473-125570495 TGTCACCACCTGGGAGACACAGG + Intronic
1104168048 12:126252896-126252918 TTTCACCTCCTTTGGGTGCCTGG - Intergenic
1106472295 13:30067724-30067746 TGTCACTTCCTGGCAGGCCCAGG + Intergenic
1108001358 13:45908289-45908311 TGTCACCTCCTCAGAGACCCTGG - Intergenic
1109284973 13:60398008-60398030 TGTCAACTCGTGGGGGTGCTCGG + Intronic
1113413470 13:110110092-110110114 TGGCAGCTTCTGGGAGTGCATGG - Intergenic
1113480776 13:110619010-110619032 TGTGCCCTCCTGGGAGTGCTGGG + Intronic
1113781362 13:112979427-112979449 AGCCACCTCCTCAGAGTGCCCGG - Intronic
1114630789 14:24158183-24158205 ACTCACCTCCAGGGACTGCCCGG - Exonic
1117875946 14:60249781-60249803 CGTCTCCTCCCGGGAGCGCCCGG - Intronic
1119540974 14:75438066-75438088 TTTCACCTCCAGGAAGTGCAAGG - Exonic
1121884406 14:97530029-97530051 GGTGACCTCCAGGGAGTGACTGG - Intergenic
1122889641 14:104726347-104726369 TGTCCCCACCTGCGAGTGCGGGG + Intronic
1123183359 14:106490463-106490485 TTTCAACTCATGAGAGTGCCAGG - Intergenic
1124203426 15:27697760-27697782 TGTCAGCTCCCTGGAGTGCTGGG - Intergenic
1127541652 15:59945012-59945034 TTTCACCTTCTGGGAAAGCCTGG + Intergenic
1128742677 15:70095182-70095204 AGTGACCTCCTGGGAGTGTTTGG - Intronic
1129378274 15:75148768-75148790 TGTCACTTTCTGAGAGTCCCAGG + Intergenic
1129829540 15:78659539-78659561 TGTCACCTCCTCAGAGAGCTAGG - Intronic
1130990845 15:88874868-88874890 TTTCACCTCCAGGGAGAGCTAGG + Exonic
1132399944 15:101498949-101498971 AGTCGTCTCATGGGAGTGCCTGG - Intronic
1133317187 16:4892120-4892142 TGCCACTGCCTGGGAGGGCCTGG + Exonic
1134123533 16:11600982-11601004 TGTCGCCTACTGGGGGTCCCTGG + Intronic
1134354377 16:13467407-13467429 AGCCACCTCCTGGGAGTTCTAGG + Intergenic
1134829557 16:17312200-17312222 AGTCACCCCCTGGGCGTGCCTGG - Intronic
1135414773 16:22260633-22260655 TGTGCCCTCCTGGCAGTGCCTGG - Intronic
1136749811 16:32624157-32624179 TGTCAACTGCAGGGAGTGTCAGG + Intergenic
1137330721 16:47492714-47492736 TCTCAACACCTGGGAGTGACAGG + Intronic
1137722843 16:50637937-50637959 TGTCATCTCCTGGGAGTACCCGG + Exonic
1137779331 16:51084514-51084536 TGCCACATCCTGGGAAAGCCTGG + Intergenic
1138351667 16:56349237-56349259 TGGCTGCTCCTGGCAGTGCCTGG + Intronic
1139650776 16:68361124-68361146 TGTCCCCTCCATCGAGTGCCCGG - Exonic
1140711225 16:77679180-77679202 TTTCACCTCCTAGGAGAGCTGGG - Intergenic
1141433254 16:83981734-83981756 AGTTGCCTCCTGGGTGTGCCTGG - Intronic
1141461057 16:84179154-84179176 AGTCAACTCCTGGGAGGGCGGGG + Exonic
1141594018 16:85086623-85086645 TGTCACCTCCTGTGCTTGCAGGG + Exonic
1142326340 16:89417535-89417557 TGCCTCCTCCTGGGAGTCACTGG - Intronic
1203051945 16_KI270728v1_random:883355-883377 TGTCAACTGCAGGGAGTGTCAGG + Intergenic
1142686559 17:1580472-1580494 AGCCACCTGCTGGGAGGGCCGGG - Intronic
1142743121 17:1942070-1942092 CGTCCCCTCCTGGGTGGGCCAGG + Intronic
1142887601 17:2922462-2922484 TGCCCTCTCCTGGGAGTTCCTGG + Intronic
1143058257 17:4178644-4178666 TGTCAGCGCCTGACAGTGCCCGG - Intronic
1143323010 17:6080301-6080323 TGTCCCAGCCTGGGAGTGCCAGG + Intronic
1144487971 17:15683446-15683468 AGTGCCCTGCTGGGAGTGCCTGG + Intronic
1144913051 17:18698843-18698865 AGTGCCCTGCTGGGAGTGCCTGG - Exonic
1145001169 17:19305736-19305758 TGTCTGCTCCAGGGACTGCCCGG - Intronic
1146066478 17:29639691-29639713 TGTCTCCTCCTAGGGGTGGCTGG - Intronic
1146664870 17:34692704-34692726 TGTGACCTCCTGCAAGTGCCTGG - Intergenic
1147333335 17:39711973-39711995 TGTCACCTCTTGGTTGTGCAGGG - Exonic
1148812129 17:50300075-50300097 TGTCAGCTCCTGGGGAGGCCTGG + Intergenic
1152868066 17:82735904-82735926 TGGCACCTGCTGGGTGAGCCCGG + Intronic
1153771023 18:8416478-8416500 TGCCACCTCCTGGGGTTGCAAGG + Intergenic
1153878276 18:9396368-9396390 TATCTCCTTCTGTGAGTGCCCGG - Exonic
1154299111 18:13177224-13177246 TCTCACCTACGGGCAGTGCCTGG + Intergenic
1156337341 18:36183403-36183425 AGTCTCCTCCTGAGAGTGGCTGG - Intergenic
1156553913 18:38046186-38046208 GGTCACCTTATAGGAGTGCCAGG + Intergenic
1157583108 18:48784649-48784671 TGGAGCCTCCTGGGAGAGCCAGG + Intronic
1157606511 18:48929325-48929347 TGTGTCTTCCTGGGGGTGCCAGG - Intronic
1158602597 18:58867564-58867586 TGTTCCTTCCTGGGAGAGCCAGG + Intronic
1159925064 18:74261956-74261978 TGTCCACCTCTGGGAGTGCCTGG - Intronic
1160706529 19:532539-532561 TGTCTCCTCCGGGGAGGGCGGGG - Intronic
1160936131 19:1595996-1596018 TGTCACCTCCTGGGCTGGCGAGG + Intergenic
1161046308 19:2136662-2136684 TCTCCCCTCATGGTAGTGCCTGG - Intronic
1163033829 19:14560658-14560680 TGTCAACTCCAGGCACTGCCTGG - Intronic
1163552680 19:17974308-17974330 TGGAACCTCCCTGGAGTGCCTGG - Intronic
1164425943 19:28142021-28142043 AGTCATTTCCTGGGAGTGTCTGG - Intergenic
1164507753 19:28873501-28873523 TGTCAGCACCTAGAAGTGCCTGG + Intergenic
1165347626 19:35258847-35258869 TGCCCCCTCCTGGGTGTGCTGGG + Intronic
1165992909 19:39826278-39826300 TGGAGCCTCCTGGAAGTGCCAGG + Exonic
925006496 2:447151-447173 TGTGACCTCCTAGGAGCGGCAGG + Intergenic
925263145 2:2545533-2545555 GGTCAGCTCCTGGGTCTGCCGGG - Intergenic
925292107 2:2754978-2755000 TGTCACCACCTGCGAGTACCTGG - Intergenic
926071281 2:9894712-9894734 TCTCTCCTCCTGGGAGGGACAGG - Intronic
928320386 2:30278598-30278620 TGTCATCTCCTGGGATTGAGGGG - Intronic
929146257 2:38709208-38709230 GCTCCCCTCCTGGGACTGCCAGG - Intronic
929619780 2:43342733-43342755 TCTCACTTCCTGGAAGTCCCTGG + Intronic
932172571 2:69570839-69570861 AGTGAACTCCTGAGAGTGCCTGG + Intronic
932638136 2:73411259-73411281 TGCCACATCCAGGGAATGCCTGG + Intronic
934774374 2:96927790-96927812 TGTGTCCTCCTGGGAGTGGGAGG - Intronic
935689022 2:105713703-105713725 TCTCACCTCCTCGGACTGTCAGG + Intergenic
936369357 2:111890655-111890677 TGTCATTTCCTGGGAATGGCTGG - Intergenic
938278899 2:130051093-130051115 GGTCAGCTCCTGCTAGTGCCAGG - Intergenic
938317363 2:130339431-130339453 TGTCACCTCCTTAGACTTCCTGG + Intronic
938329881 2:130441968-130441990 GGTCAGCTCCTGCTAGTGCCAGG - Intergenic
938360064 2:130679535-130679557 GGTCAGCTCCTGCTAGTGCCAGG + Intergenic
938436472 2:131286256-131286278 GGTCAGCTCCTGCTAGTGCCAGG + Intronic
945218296 2:207458815-207458837 TGTCACCTCCTGGCAGGACCAGG + Intergenic
947730885 2:232430969-232430991 TGTCACTTCCTGGCAGGCCCAGG + Intergenic
948660894 2:239505852-239505874 TGACACCCCCTGCCAGTGCCGGG - Intergenic
948694705 2:239727364-239727386 TCGCACCTGCTGGGAGGGCCAGG + Intergenic
948702266 2:239767752-239767774 TCGCTCCTCCTGGGAGTGACTGG + Intronic
948948978 2:241236673-241236695 TCACACCTCCTTGGAGAGCCGGG + Exonic
1169474910 20:5922809-5922831 TGTCTTCTCCTGAGAATGCCCGG - Exonic
1170592894 20:17784619-17784641 TGTCAGCTCCTAGGACGGCCTGG - Intergenic
1173021257 20:39269568-39269590 TGTATCCTCCTGGGCCTGCCTGG + Intergenic
1173210801 20:41029646-41029668 TGTCCCCTCTTGGGAGGGCCGGG - Intronic
1173955721 20:47031175-47031197 TGTCACTTCCTCAGAGAGCCTGG - Intronic
1174129440 20:48332068-48332090 TGTCACCTCCTTGTTTTGCCAGG - Intergenic
1175549290 20:59806261-59806283 TCCCACATCCTGGGTGTGCCAGG + Intronic
1176066869 20:63202404-63202426 GGGCACCTCCTGGGTGTCCCGGG + Exonic
1176872598 21:14095692-14095714 GCTCCCCTCCTGGGACTGCCAGG - Intergenic
1178591607 21:33915722-33915744 TCTCACCTGCCGGGAGAGCCCGG + Exonic
1178853683 21:36233436-36233458 TTGCACCTCCTGGGAGGGGCAGG - Intronic
1179786308 21:43732157-43732179 TGGTACCTCCTGGTGGTGCCTGG + Intronic
1179843122 21:44090446-44090468 TGGCATCTCATGGGAGAGCCTGG - Intronic
1180732280 22:17991111-17991133 TGGCACGTCCTGGCAGGGCCTGG - Intronic
1182667883 22:31972466-31972488 TGGCACCTCCTGGAAGGGCCCGG - Intergenic
1183529809 22:38347295-38347317 TGTCACCTCCTGGGAGTGCCGGG - Intronic
1183670313 22:39269017-39269039 TGTCAGGTCCTGGGAGACCCTGG + Intergenic
1183709884 22:39496770-39496792 TGTCTCCTAGTGGGAGGGCCAGG + Intergenic
1184018599 22:41804632-41804654 TGTCACTTCCTGGCAGGCCCAGG - Intronic
1184600533 22:45540786-45540808 TGGCACCTCCCGGGTGGGCCTGG + Intronic
1185218401 22:49616581-49616603 TGTCCCCGCCTGTCAGTGCCCGG - Intronic
950376231 3:12574558-12574580 TGTCACCTCCTAGGAAAGCAAGG + Intronic
952644461 3:35639239-35639261 TGGCACCTGCTGGGTGCGCCGGG - Intronic
953770333 3:45774736-45774758 TGTCACCTGCTGAGAGTCCTAGG - Intronic
954521849 3:51234855-51234877 TTTCACCACCAGGAAGTGCCTGG - Intronic
954583471 3:51716116-51716138 TGTCACCTCCAGTGACTACCGGG + Exonic
954698165 3:52438441-52438463 GGTCAGCACCTGGGAGGGCCTGG - Intronic
956530823 3:70216712-70216734 TGTCACCTCCTGGGTGAGGCAGG + Intergenic
959435510 3:106310228-106310250 TGTCACTTCCTGGCAGGCCCAGG - Intergenic
961590701 3:127978657-127978679 TGCTACCACCTGGGAATGCCTGG - Intronic
962290782 3:134134704-134134726 TGTCAGCTCCAGGGAGGGCTGGG + Intronic
962356217 3:134696337-134696359 TGTCACCAGCAGGGAGTGCTGGG + Intronic
962939091 3:140109299-140109321 AGTCACCTCCTGGAAGAGCCGGG + Intronic
964982861 3:162708242-162708264 TGTCACTTGCTTAGAGTGCCTGG - Intergenic
967363263 3:188656247-188656269 TGGCAGCACCTGGGAGCGCCTGG - Intronic
967959919 3:194912232-194912254 TGGCAGCTCCTGGGAGGGTCTGG - Intergenic
969290151 4:6233632-6233654 GAGCACCTACTGGGAGTGCCAGG - Intergenic
969312404 4:6361670-6361692 TGTCACCCCCTGGGAGGACTAGG + Intronic
969408711 4:7013688-7013710 TGTAGCCCCCTGGAAGTGCCAGG + Intronic
969992216 4:11276393-11276415 TGTCACCTCCTTGGAATTCTAGG + Intergenic
974188698 4:58475011-58475033 TGTCTGCTCCTGGCAGTTCCAGG + Intergenic
977138510 4:93337374-93337396 TGTCACCTCCTGGTGGTGATGGG - Intronic
979508789 4:121528055-121528077 GGTCATTTCCTGGGAGTGCTGGG - Intergenic
981094220 4:140761633-140761655 TGACCACTCCTGGGACTGCCGGG - Intergenic
981993548 4:150953476-150953498 TGCCTCAGCCTGGGAGTGCCTGG + Intronic
982368954 4:154612684-154612706 TGTAAGCTCCTGGGATAGCCAGG + Intronic
983560732 4:169098945-169098967 CTTCACCTCCTTGAAGTGCCAGG - Intronic
983813321 4:172091436-172091458 TGTCACTTCCTGGCAGGCCCAGG - Intronic
984866000 4:184281317-184281339 TGTTTCCTGCTGGGTGTGCCGGG + Intergenic
985534914 5:458936-458958 GGTCAGCTCCTGGCAGGGCCTGG + Intronic
985639697 5:1057905-1057927 TGTCACCTCCTGTCAGTACGGGG - Intronic
985926353 5:3022707-3022729 TATGAGCTCCTGGGTGTGCCTGG + Intergenic
986435760 5:7728802-7728824 TGTCACCTACTGGGAGGTGCTGG + Intronic
988047054 5:25970044-25970066 TGTGACCTCTTGGAAGTCCCAGG + Intergenic
989157639 5:38359329-38359351 TGTCACCTTCTGGAAGGGGCAGG + Intronic
990312127 5:54550192-54550214 TATAACCTCCTGAGAGTGTCAGG + Intergenic
992211656 5:74485657-74485679 TGTCACTTCCTGGCAGGCCCAGG + Intergenic
992420573 5:76600449-76600471 TGTCACTGACTGAGAGTGCCAGG - Intronic
992459194 5:76944317-76944339 AGGCACCTCCCAGGAGTGCCAGG + Intergenic
994780961 5:104089336-104089358 TGTCAGCCCTTGGGGGTGCCTGG - Intergenic
995281956 5:110345749-110345771 TGTAAATTCCTGGTAGTGCCAGG + Intronic
995843351 5:116466529-116466551 TCTCATCTCCTGAGAGTGCTGGG - Intronic
995879205 5:116825091-116825113 TGTCACCTCATAGGAAAGCCTGG + Intergenic
997295273 5:132764942-132764964 TGTGTCCTTCTGGGAGTCCCAGG + Intronic
997779992 5:136647320-136647342 GGTCACCACCTGTAAGTGCCTGG - Intergenic
998835935 5:146203287-146203309 TGTCTGCTGCTGGGAGTGCCTGG - Intergenic
999773649 5:154793875-154793897 TGTCTCATCCTGGTCGTGCCAGG - Exonic
1000694432 5:164362388-164362410 TCTCACCAGCTGGGAATGCCAGG - Intergenic
1001438044 5:171715681-171715703 CTTCAGCTGCTGGGAGTGCCGGG + Intergenic
1002997420 6:2299714-2299736 TGTCACTTCCTGGCAGGCCCAGG + Intergenic
1003905435 6:10694935-10694957 TGTCACCTCCAGGCTGAGCCGGG + Exonic
1007242889 6:40439637-40439659 TGTCACTTCCTGAGAGTGTATGG - Intronic
1007335829 6:41154304-41154326 TGTCAACTCCTGGGCTTGCCTGG + Exonic
1012909740 6:105105273-105105295 TGTCACTTCCAGGGACTACCTGG + Intronic
1013584269 6:111564863-111564885 TGTCAGCTTCTGGGACTGGCAGG + Intronic
1017723143 6:157258411-157258433 TGTCACAGCCTTGGAGTGTCAGG + Intergenic
1018764310 6:166920627-166920649 TGTCACTTCCTGGCAGGCCCAGG + Intronic
1019411569 7:908992-909014 TGTCACCTGCTGGGCGCGGCGGG - Intronic
1020268502 7:6577704-6577726 AGGCACCTCCTGGGCGGGCCTGG - Exonic
1023621183 7:42074703-42074725 TGTGGCCTCCTGGGACTGCCTGG - Intronic
1024203232 7:47127066-47127088 TGTCACCTCCTGGGAAGGTGGGG - Intergenic
1031914844 7:127553359-127553381 TGTCTCCATCTAGGAGTGCCAGG - Intergenic
1035573525 8:689525-689547 TGTCTCCTCCTGGAGGTGTCTGG + Intronic
1036395717 8:8369303-8369325 TATAAACTCCTGGGAGTGCAGGG - Intronic
1037920683 8:22803323-22803345 TGGCCTCTCCTGGGAGTTCCAGG + Intronic
1038540195 8:28385435-28385457 TGCCACCGCCGGGGAGGGCCAGG + Intronic
1044817862 8:96131360-96131382 TGTCACTTGCTGTGTGTGCCAGG - Intergenic
1047629975 8:126695996-126696018 TGTCAGCAACTGGGAGAGCCTGG + Intergenic
1049426916 8:142541819-142541841 CGCCACCTCCTGGGAGACCCTGG - Intronic
1049557655 8:143291135-143291157 TGACACGTCCTGCGGGTGCCCGG + Intronic
1052512290 9:29437310-29437332 TGTAAACTACTTGGAGTGCCTGG + Intergenic
1056722861 9:89086492-89086514 CGTCACATCCTGGGAGGGCATGG - Intronic
1057830103 9:98399624-98399646 GGTCACCTGCTAGGAGTGACAGG + Intronic
1058384214 9:104414658-104414680 TGTCACTTTCTGGGAGGCCCAGG + Intergenic
1058970089 9:110073314-110073336 TGTTCTCTCCTGGGAGTTCCTGG + Intronic
1060018833 9:120110947-120110969 TCTCCACTCCTGAGAGTGCCTGG + Intergenic
1061534907 9:131241556-131241578 TGTCACCACCTGGTACTTCCAGG - Intergenic
1062450717 9:136614641-136614663 AGTCACAGCCTGGGAGCGCCTGG - Intergenic
1062605304 9:137345131-137345153 TGTCACATCCAGGTAGTGGCGGG - Intronic
1185554520 X:1009959-1009981 TGTCTCCTCCTTTGAGTGCACGG + Intergenic
1185726396 X:2425528-2425550 TGTCATCCCCTGTGAGTCCCTGG + Intronic
1189292440 X:39895793-39895815 TGTCACCTCCTGAGGGCCCCAGG - Intergenic
1193515597 X:82458446-82458468 TGTGAATTTCTGGGAGTGCCTGG + Intergenic
1195689786 X:107615057-107615079 AGTCACCTCCTGGCAGGGCATGG + Intergenic
1195851409 X:109285808-109285830 TGTCACCTCTGAGGATTGCCCGG - Intergenic
1199623370 X:149718397-149718419 TTTCACCTCCTGGGAGACTCTGG - Intergenic
1200001936 X:153066608-153066630 TGTGTCCTCCAGGGAGAGCCTGG - Intergenic
1200005796 X:153083417-153083439 TGTGTCCTCCAGGGAGAGCCTGG + Intergenic