ID: 1183529810

View in Genome Browser
Species Human (GRCh38)
Location 22:38347296-38347318
Sequence CTGTCACCTCCTGGGAGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 338}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183529810_1183529820 -1 Left 1183529810 22:38347296-38347318 CCGGCACTCCCAGGAGGTGACAG 0: 1
1: 0
2: 2
3: 39
4: 338
Right 1183529820 22:38347318-38347340 GGTGGCCACAGGAGTGGGAGGGG No data
1183529810_1183529821 0 Left 1183529810 22:38347296-38347318 CCGGCACTCCCAGGAGGTGACAG 0: 1
1: 0
2: 2
3: 39
4: 338
Right 1183529821 22:38347319-38347341 GTGGCCACAGGAGTGGGAGGGGG 0: 1
1: 0
2: 4
3: 73
4: 648
1183529810_1183529823 6 Left 1183529810 22:38347296-38347318 CCGGCACTCCCAGGAGGTGACAG 0: 1
1: 0
2: 2
3: 39
4: 338
Right 1183529823 22:38347325-38347347 ACAGGAGTGGGAGGGGGAAACGG No data
1183529810_1183529816 -7 Left 1183529810 22:38347296-38347318 CCGGCACTCCCAGGAGGTGACAG 0: 1
1: 0
2: 2
3: 39
4: 338
Right 1183529816 22:38347312-38347334 GTGACAGGTGGCCACAGGAGTGG No data
1183529810_1183529819 -2 Left 1183529810 22:38347296-38347318 CCGGCACTCCCAGGAGGTGACAG 0: 1
1: 0
2: 2
3: 39
4: 338
Right 1183529819 22:38347317-38347339 AGGTGGCCACAGGAGTGGGAGGG 0: 1
1: 0
2: 3
3: 54
4: 423
1183529810_1183529817 -6 Left 1183529810 22:38347296-38347318 CCGGCACTCCCAGGAGGTGACAG 0: 1
1: 0
2: 2
3: 39
4: 338
Right 1183529817 22:38347313-38347335 TGACAGGTGGCCACAGGAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 232
1183529810_1183529818 -3 Left 1183529810 22:38347296-38347318 CCGGCACTCCCAGGAGGTGACAG 0: 1
1: 0
2: 2
3: 39
4: 338
Right 1183529818 22:38347316-38347338 CAGGTGGCCACAGGAGTGGGAGG 0: 1
1: 0
2: 5
3: 61
4: 453
1183529810_1183529824 12 Left 1183529810 22:38347296-38347318 CCGGCACTCCCAGGAGGTGACAG 0: 1
1: 0
2: 2
3: 39
4: 338
Right 1183529824 22:38347331-38347353 GTGGGAGGGGGAAACGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183529810 Original CRISPR CTGTCACCTCCTGGGAGTGC CGG (reversed) Intronic
900009078 1:89864-89886 CTATCTCCTCCTGGGAGAGGAGG - Intergenic
900025231 1:266677-266699 CTATCTCCTCCTGGGAGAGGAGG - Intergenic
900028833 1:356059-356081 CTATCTCCTCCTGGGAGAGGAGG - Intergenic
900483554 1:2910806-2910828 CTGTCTCCTCCTGAGAGTTCTGG + Intergenic
900493614 1:2965917-2965939 CCAGCACCTCCAGGGAGTGCAGG + Intergenic
900600668 1:3501455-3501477 CGGGCACCTCCTGGGGCTGCAGG + Intronic
900617458 1:3571795-3571817 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617486 1:3571890-3571912 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617497 1:3571928-3571950 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617503 1:3571947-3571969 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617557 1:3572161-3572183 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617563 1:3572180-3572202 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617580 1:3572258-3572280 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617586 1:3572277-3572299 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617598 1:3572316-3572338 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617607 1:3572354-3572376 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617616 1:3572392-3572414 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617625 1:3572430-3572452 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900617666 1:3572605-3572627 CTGGGTCCTCCTGGGTGTGCTGG + Intronic
900627364 1:3614957-3614979 CTGTCTCATCCTGGGAATGCAGG - Intergenic
900880452 1:5377690-5377712 ATGCCACCTCCTGTGAGTGCTGG + Intergenic
901157350 1:7149554-7149576 ATGCCACCTCCTGGGGCTGCTGG + Intronic
901391610 1:8949703-8949725 CTGTCACCTGCTGGGTGGGTTGG - Intronic
901537315 1:9890953-9890975 GGGTCACCTCCAGAGAGTGCGGG + Intronic
901653543 1:10756345-10756367 CTGTCACCTCCATGGAGGTCAGG + Intronic
901929944 1:12590755-12590777 CTGTCACCCATTGAGAGTGCTGG + Intronic
903322639 1:22552118-22552140 ATGTCACCTCCTGGTGGTCCTGG - Intergenic
904282986 1:29434322-29434344 CTCTCACTTCCTGGGAATGGGGG - Intergenic
904809080 1:33151566-33151588 CTGTCACCTCCTGGGGATGAGGG - Intronic
905026101 1:34850811-34850833 CTGTGACCTCCTGGGCATTCTGG + Intronic
906748712 1:48239899-48239921 CAGTCACCTCCTGGGGGCCCAGG + Intronic
908003116 1:59701102-59701124 ATGTCATCCACTGGGAGTGCTGG + Intronic
908249939 1:62257440-62257462 CTGTCACCTCCAGGGAGAGTTGG - Intronic
909185089 1:72477365-72477387 GTCTCACCTCCTAGGACTGCAGG - Intergenic
910272977 1:85417261-85417283 CAGCCACCTCCTGGCAGGGCTGG + Intronic
911150330 1:94592136-94592158 GTGTCCCCTCCAGAGAGTGCGGG + Intergenic
913149026 1:116021927-116021949 ATGTCACCTCATGTGAGTGCTGG + Intronic
915691452 1:157695192-157695214 CTGACTCCACCTGGGAGTTCTGG - Intronic
915776310 1:158491545-158491567 CTGTCTGCTTCTGGGAGTGATGG + Intergenic
918053455 1:180995892-180995914 CAGGCACCTTCTGGGGGTGCTGG + Intronic
918239833 1:182611575-182611597 TTGTCATCTCCTGGGAGTTAAGG + Intergenic
919008290 1:191928175-191928197 CTGTCTGCTCCTGGGGGTGAGGG - Intergenic
919339307 1:196283209-196283231 CTGGGACCTCCCAGGAGTGCTGG - Intronic
919664205 1:200276652-200276674 TGGTCACCTGCTGGGGGTGCAGG - Intergenic
919995294 1:202742553-202742575 CTGTGACCACCTGGGTGTGGTGG - Intronic
920078324 1:203353355-203353377 CTGGCCCCTCCTGGAAGTGGCGG - Intergenic
921165480 1:212503845-212503867 GTGTCACCCCAGGGGAGTGCTGG - Intergenic
921448789 1:215278411-215278433 CTGTCACATGGTGGGAGTGTGGG + Intergenic
921912928 1:220571882-220571904 TGGTGACCTCCTGGGAGTGGGGG - Intronic
922456567 1:225778092-225778114 CCAGCACCTCCTGGGAGCGCTGG - Intronic
922754930 1:228090429-228090451 CTGTCACCTGCAGGGAGAGGTGG + Intronic
922811621 1:228418334-228418356 CTGCAATCTCCTGGGTGTGCGGG + Intergenic
924590121 1:245395781-245395803 CTGTGAGCTCCAGGGAGTCCAGG + Intronic
1063880499 10:10526831-10526853 CTGTGACCTCCAGGGAGAGAAGG - Intergenic
1066659073 10:37721652-37721674 CTGTGAGCTCCTGGGGGTGGCGG - Intergenic
1067485838 10:46649074-46649096 TAGTGACCTCCTGGGAGTGGAGG + Intergenic
1067608918 10:47692579-47692601 TAGTGACCTCCTGGGAGTGGAGG - Intergenic
1068948142 10:62750047-62750069 CTGGCATCTCCTGGGACTGCAGG + Intergenic
1069864648 10:71494511-71494533 CAGTCTCCTCATTGGAGTGCGGG + Intronic
1070547678 10:77465384-77465406 ATGGCACCTCCTGGGGCTGCTGG + Intronic
1070549997 10:77483490-77483512 CTGTCGCCTCCTGGGAAAACTGG + Intronic
1070767766 10:79066580-79066602 CTGCCACCTACAGGGAGGGCGGG + Intergenic
1071624505 10:87154221-87154243 TAGTGACCTCCTGGGAGTGGAGG - Intronic
1073009941 10:100351242-100351264 CTGGCACCTCCTGAGCCTGCAGG + Intronic
1073586084 10:104711582-104711604 CACTCACTTTCTGGGAGTGCAGG + Intronic
1074052146 10:109889507-109889529 CTGTCTCATCCTGGGAGTTGGGG - Intronic
1074115724 10:110456451-110456473 CTTTCACCTGCTGGGGGGGCAGG - Intergenic
1074351063 10:112737552-112737574 CTGCCGCCCCCTGGGAATGCAGG - Intronic
1074419716 10:113298293-113298315 CTGGGCCCTCCTGGTAGTGCTGG - Intergenic
1074945456 10:118276744-118276766 CTGTCTGCTCCAGGGAGTGCAGG - Intergenic
1076164821 10:128273244-128273266 TGGTCAGCTCCCGGGAGTGCTGG + Intergenic
1076440342 10:130477053-130477075 CGGTCAGCTCCTGGGAGGGAGGG + Intergenic
1077009256 11:372936-372958 CTGTTCCCTCATGTGAGTGCCGG + Exonic
1077232077 11:1462267-1462289 CTGTGCCCGCCTGGGAGGGCTGG - Intronic
1077331686 11:1986769-1986791 CTCCCACCGCATGGGAGTGCAGG + Intergenic
1077864198 11:6209912-6209934 CTATGACCTACTGGGTGTGCTGG + Exonic
1079583150 11:22091288-22091310 CTGTCACTTCCTGGCAGGCCCGG - Intergenic
1080630038 11:34066097-34066119 CCTGCACCTCCTGGGACTGCAGG + Intronic
1081673413 11:44954500-44954522 CTGTTATCACCTGGGACTGCAGG + Intergenic
1082788595 11:57331631-57331653 CTGTCACTTCCTGGGCATCCTGG - Intronic
1082836938 11:57657889-57657911 CTGTCACCTCCTTGGGGTCTGGG + Intronic
1083252040 11:61474804-61474826 CTGTCTAGTCCTGGGAGTGGGGG - Intronic
1083321762 11:61852053-61852075 ATGCCACCTCATGGGGGTGCCGG - Intronic
1083367420 11:62149988-62150010 CTCTCACCACCGAGGAGTGCTGG - Intronic
1084413172 11:69015515-69015537 ATGTCCCCTCCTGAGGGTGCAGG + Intergenic
1084501918 11:69540142-69540164 CTGGCCCCTCCTGGGAAGGCAGG + Intergenic
1085157876 11:74312467-74312489 CTGTCTCCTCCTTTGAGTCCAGG - Intergenic
1086279737 11:85171773-85171795 CTGCCAGCTCCAGGGAGTCCAGG + Intronic
1089579343 11:119471630-119471652 CTGAGACCTGCTGGGTGTGCTGG - Intergenic
1089630097 11:119779115-119779137 CTCTCAGCTCCTGGAAGGGCTGG + Intergenic
1090224644 11:125062858-125062880 CTCTCACCTTCTGGGAGCGCAGG - Intergenic
1202814667 11_KI270721v1_random:41945-41967 CTCCCACCGCATGGGAGTGCAGG + Intergenic
1092189764 12:6510636-6510658 CTGGAAGCTCCTGGGAGTGGCGG - Exonic
1095260089 12:40087700-40087722 ATGTAACCTCCTGGTAGTGTTGG - Intronic
1101913970 12:108882139-108882161 CTCTCACCACCTGGGTGTCCAGG + Intronic
1101961385 12:109253226-109253248 CTGTCACCTCCTGGGTGGTGTGG + Intronic
1101964532 12:109273490-109273512 CTGCCACCGCCTGGGTCTGCGGG - Intergenic
1102148539 12:110672527-110672549 CTCTCTCCTCCTGGGAGTTGGGG - Intronic
1102247974 12:111367231-111367253 CTGTCACCTCCTCAGAGAGGTGG + Intronic
1102480935 12:113222494-113222516 CTGTCACAACTTGGGAGTGGGGG - Intronic
1102799342 12:115717850-115717872 TGGTGACCTCCTGGGAGTGGGGG + Intergenic
1102891129 12:116559391-116559413 CAGCCACCTCTCGGGAGTGCAGG + Intergenic
1103922785 12:124407836-124407858 CTTCCACCTCCTGGCAGTGTAGG + Intronic
1104261493 12:127187293-127187315 TTGTAGCCTCCGGGGAGTGCTGG + Intergenic
1104887408 12:132118785-132118807 CTGTCAGATACTGGGAGAGCTGG + Intronic
1105497712 13:20945319-20945341 CTTTCCCCTCCTGTGAGTCCTGG + Intergenic
1105651800 13:22386862-22386884 CTGTGACCTTCTTGGAGTTCTGG + Intergenic
1106580031 13:31009877-31009899 CTGGCATCTCCTGGCAGGGCAGG + Intergenic
1109441282 13:62379034-62379056 CTGTCACCTCTCAGGATTGCAGG - Intergenic
1111934436 13:94545126-94545148 CTGTCACTTCCCGGGAGTGAAGG - Intergenic
1112317327 13:98374917-98374939 CTGTTACTTCCTGTGAGAGCTGG - Intronic
1112948627 13:104962030-104962052 CTGTCATCTGGAGGGAGTGCAGG + Intergenic
1112966909 13:105208482-105208504 CTGGCATCTCCTGTAAGTGCAGG - Intergenic
1113113662 13:106851379-106851401 ATGTCACCATCTGGGAGTGAAGG + Intergenic
1113326122 13:109282974-109282996 CTGGCCTCTCCTGGGTGTGCAGG + Intergenic
1113449276 13:110395113-110395135 CTGTCTCCTCCTGGGAGGACTGG + Intronic
1113480775 13:110619009-110619031 CTGTGCCCTCCTGGGAGTGCTGG + Intronic
1119214408 14:72857622-72857644 CTGTCACCAGGTTGGAGTGCAGG + Intronic
1120038675 14:79727896-79727918 CTGTCACCTCCTCAGAGCCCTGG + Intronic
1120752734 14:88212955-88212977 CTGTCACCTCCCAGGGGAGCTGG + Intronic
1120997507 14:90427807-90427829 CTGTCACCTCCTGGCCTGGCTGG + Intergenic
1121657892 14:95611446-95611468 CTTTCACCTCCTGGGGTTGCTGG + Intergenic
1121964361 14:98290307-98290329 CCATCTCCTCCTGTGAGTGCTGG - Intergenic
1122889640 14:104726346-104726368 TTGTCCCCACCTGCGAGTGCGGG + Intronic
1123109952 14:105862232-105862254 CTGCCACCTGCTGTGGGTGCCGG + Intergenic
1124203427 15:27697761-27697783 ATGTCAGCTCCCTGGAGTGCTGG - Intergenic
1124253547 15:28122787-28122809 CTGGCACCTGCTGGGGCTGCAGG - Intronic
1125170695 15:36763459-36763481 CTTGCACCTCATGGGAGTTCAGG + Intronic
1125905828 15:43391568-43391590 CGGTGACCACCTGGGAGTGGGGG - Intronic
1126784218 15:52163545-52163567 CTGCCAGCTCCTGGGAGTCAGGG + Intronic
1127604415 15:60572018-60572040 CTGTCCTCATCTGGGAGTGCTGG - Intronic
1128222500 15:65979223-65979245 CTGTGACCTCCTGGGACTGGGGG - Intronic
1129464855 15:75718361-75718383 CTGCCACCTCCTGAGAGACCTGG + Intergenic
1130094782 15:80847842-80847864 CTGGCTCCTCCTGGGTGGGCAGG - Intronic
1131230626 15:90656305-90656327 CTGCCACCTCCTGGCAGTAGGGG - Intergenic
1131894026 15:97006504-97006526 CTGTCACCACGCTGGAGTGCAGG + Intergenic
1132288742 15:100684851-100684873 ATGTCACCTCCCTGGAATGCTGG + Intergenic
1132832981 16:1938552-1938574 CTGTGACCTGCTGGGAAGGCAGG - Exonic
1133114202 16:3567013-3567035 CTGGGGTCTCCTGGGAGTGCAGG + Intronic
1133745495 16:8683386-8683408 TGGTGACCTCCTGGGAGTGGAGG + Intronic
1134080855 16:11323922-11323944 CTGTCACCTGCTAGGTTTGCTGG + Intronic
1135712439 16:24729498-24729520 CTGTGACCTCCAGGGAGGTCCGG + Intergenic
1136068188 16:27772466-27772488 CGGCCTGCTCCTGGGAGTGCGGG + Intronic
1138109330 16:54311173-54311195 CTGCCTCCTTCTGGGAGTGGGGG + Intergenic
1138124338 16:54426483-54426505 CTGGCACCCCGGGGGAGTGCTGG - Intergenic
1138614860 16:58157270-58157292 GAGTCACCTCCTGTGAATGCAGG - Intergenic
1138677467 16:58662190-58662212 CTGCCACCTCCTGGGAGTCAGGG - Intergenic
1139285779 16:65812629-65812651 CTGTCCCCTCCTTGAACTGCAGG - Intergenic
1140137970 16:72224833-72224855 CTGTCACCTCCCGAGATTCCAGG + Intergenic
1140486633 16:75298795-75298817 CTATCACCTCCAGGTTGTGCTGG + Intronic
1140711226 16:77679181-77679203 CTTTCACCTCCTAGGAGAGCTGG - Intergenic
1140784275 16:78325086-78325108 CTGTAACAGCCTGGGAGTGTTGG + Intronic
1141461056 16:84179153-84179175 GAGTCAACTCCTGGGAGGGCGGG + Exonic
1141594017 16:85086622-85086644 CTGTCACCTCCTGTGCTTGCAGG + Exonic
1141700315 16:85639293-85639315 CTGTCCCCTCCTCGGAATGGCGG + Intronic
1142455257 16:90217097-90217119 CTATCTCCTCCTGGGAGAGGAGG + Intergenic
1142686560 17:1580473-1580495 CAGCCACCTGCTGGGAGGGCCGG - Intronic
1142970268 17:3606599-3606621 CTGGCACCTCCTGGGAAGGAGGG + Intergenic
1143013165 17:3877405-3877427 CTGTCACTTCGTGGTGGTGCTGG - Intronic
1147333336 17:39711974-39711996 CTGTCACCTCTTGGTTGTGCAGG - Exonic
1147587577 17:41661090-41661112 CTGTGAGCTCCTGGGTGGGCTGG + Intergenic
1148180782 17:45603172-45603194 CTCTCACCTCCTGGGAGGTTGGG - Intergenic
1148268121 17:46242754-46242776 CTCTCACCTCCTGGGAGGTTGGG + Intergenic
1148606142 17:48930504-48930526 CTGTAATCTCCTGGGAGTAGAGG + Exonic
1148744603 17:49911360-49911382 CTGTCACCCCTGGGGAGTGTGGG + Intergenic
1151703172 17:75753959-75753981 CTGTCACCTCCGGGGGGCCCGGG - Exonic
1152083049 17:78200413-78200435 CTGTAACCAGCTGGGATTGCAGG + Intronic
1152241956 17:79165542-79165564 CCGTCACCTCCCGGGATGGCTGG - Intronic
1152950925 17:83230498-83230520 CTATCTCCTCCTGGGAGAGGAGG + Intergenic
1153565425 18:6414115-6414137 CTGCCACCGCCTGGAACTGCGGG - Intronic
1153741020 18:8127792-8127814 CTTTCACCCCCTAGGAGAGCTGG + Intronic
1154083059 18:11276861-11276883 CTGACACCTGCTGTGAGTGCTGG - Intergenic
1154948529 18:21185496-21185518 CTAGCACCTCCTGGAAGTCCAGG + Intergenic
1155227228 18:23739114-23739136 CTGTGACCTTCTTAGAGTGCAGG + Intronic
1155240166 18:23857081-23857103 CTGCTGCCTCCTGGGATTGCTGG - Intronic
1156327161 18:36085188-36085210 CTGTCACCTACTGCCATTGCAGG + Intergenic
1157069526 18:44389918-44389940 CTGTCACCTCCTTGTAGCACTGG + Intergenic
1157294571 18:46433389-46433411 CTGTGACGTCCTGGAACTGCAGG - Exonic
1158235036 18:55302821-55302843 CTGTGACCTCCTGGGAATAGAGG + Intronic
1158453230 18:57585639-57585661 CTGACACCTACTTGGAGTGGAGG - Intronic
1158628550 18:59092355-59092377 CTCTCACTTCCTTGGAGTCCTGG + Intergenic
1160706530 19:532540-532562 TTGTCTCCTCCGGGGAGGGCGGG - Intronic
1160905246 19:1448983-1449005 CTCTCAGCCCCTGGCAGTGCTGG + Intronic
1161558631 19:4958262-4958284 CTGTCACCTCTCAGGCGTGCAGG + Intronic
1161580047 19:5075803-5075825 CTGCCACTTCCTGGTGGTGCTGG + Intronic
1161648190 19:5467370-5467392 CTGCCCCCTCCTGGGATTTCTGG + Intergenic
1163796097 19:19338880-19338902 CTGTGACCTCCTGGGTGTAGGGG + Exonic
1164839994 19:31385965-31385987 CTGGCACCTGCTGGGTGTGCTGG - Intergenic
1164875945 19:31689060-31689082 CAGTCATCTCCAGGCAGTGCAGG + Intergenic
1165012641 19:32859843-32859865 CAGCCACCGCCTGGGACTGCAGG + Exonic
1165347625 19:35258846-35258868 TTGCCCCCTCCTGGGTGTGCTGG + Intronic
1165745663 19:38228622-38228644 CTGTCACCGCCTGGGAACGGGGG + Intronic
1167609481 19:50500406-50500428 CTGTCACCACCAGGGGGTGTGGG + Intergenic
1168115458 19:54219657-54219679 CTGTGACCTCCTGGGAGAGGAGG - Intronic
1168124773 19:54277338-54277360 CTGTGACCTCCTGGGAGAGGAGG - Intronic
1168132805 19:54331964-54331986 CTGTGACCTCCTGGGAGAGGAGG - Intergenic
1168177210 19:54634211-54634233 CTGTGACCTCCTGGGAGAGGAGG + Intronic
1168181516 19:54665370-54665392 CTGTGCCCTCCTGGGAGAGGAGG + Intronic
1168531879 19:57136765-57136787 CTGTGACTTCCTGGGAGTGCTGG - Intronic
925177186 2:1793959-1793981 CTGCCACCAGCTGTGAGTGCAGG - Intronic
925278311 2:2665875-2665897 CTGGCACCTCCCGGGAGTCCAGG - Intergenic
926273448 2:11385592-11385614 CAGTCACATTCTGAGAGTGCTGG + Intergenic
926363761 2:12114553-12114575 ATGTCAGCTCCTGGTAGAGCTGG + Intergenic
928320387 2:30278599-30278621 ATGTCATCTCCTGGGATTGAGGG - Intronic
928406155 2:31016572-31016594 CTCTCAGCTGCTAGGAGTGCTGG + Intronic
929588465 2:43130583-43130605 CCCTCACCTCCTGGGAGCCCAGG - Intergenic
930067169 2:47336500-47336522 CTGTCACCATCAGGGAGAGCTGG - Intergenic
930720173 2:54630842-54630864 CTGGCTCCACCTGTGAGTGCAGG - Exonic
932226890 2:70048468-70048490 CCATCACCTCCTGGCAGTGCTGG - Intergenic
932438322 2:71716261-71716283 CTGGGACCTCCAGGGAGTGTAGG + Intergenic
934220139 2:90074948-90074970 CTGTCACCTGCAGGGCCTGCTGG + Intergenic
934783927 2:96990949-96990971 CTGGGCCCTTCTGGGAGTGCTGG + Intronic
935175639 2:100646346-100646368 CTGTCACCTTCTAGCAGAGCTGG + Intergenic
937058795 2:118966045-118966067 CTGCCACCTCCTGGGGTAGCAGG - Intronic
937058809 2:118966097-118966119 CTGCCACCTCCTGGGGTAGCAGG - Intronic
937150764 2:119684031-119684053 CTCCCAGCTCCTGGAAGTGCAGG + Intronic
937268769 2:120633735-120633757 CTTTCATCTCCTGTGAGAGCTGG - Intergenic
937299636 2:120831371-120831393 CTGTAACCTCCAGGGAGGCCTGG - Intronic
937820289 2:126302817-126302839 CTGTCACCATGTGGGAGTGATGG - Intergenic
942155325 2:173121760-173121782 CCATCACCTCCTGGGAATGGGGG + Intronic
943858686 2:192831954-192831976 CTCTCACCGCCAGCGAGTGCTGG - Intergenic
944502522 2:200376851-200376873 CTGTCACCTGATGGGAGAGGTGG - Intronic
946603318 2:221374814-221374836 CTGTCTCCTCCTGGGGGTTTGGG - Intergenic
947209574 2:227696019-227696041 CTGGGACCTTCTGGGAGAGCTGG - Exonic
947272423 2:228352146-228352168 CTGTAATCTCCTGGGAGTAGAGG + Intergenic
948022244 2:234744388-234744410 CTGTGACCTCCTGGGCATGGTGG + Intergenic
948377282 2:237529851-237529873 CTCCCTCCTCCTGGGAGAGCTGG + Intronic
948445975 2:238033092-238033114 CTGTCACCTCCCAGGTGTTCTGG + Intronic
949086738 2:242161823-242161845 CTATCTCCTCCTGGGAGAGGAGG + Intergenic
1170639294 20:18137716-18137738 CTGTCGCCTGCGGGGTGTGCAGG + Intergenic
1170927476 20:20738576-20738598 TGGTGACCTCCTGGGAGTGTGGG - Intergenic
1172605492 20:36210801-36210823 CTGCCACCTGGTGGGAGAGCAGG - Intronic
1172710780 20:36921609-36921631 CTGTCACCTCCTGGGCTCCCGGG + Intronic
1172755716 20:37282816-37282838 CTGTCTCCCTCTGGGAGCGCTGG + Intergenic
1173210802 20:41029647-41029669 TTGTCCCCTCTTGGGAGGGCCGG - Intronic
1173845985 20:46189096-46189118 CAGCCACCTCCTGGGGGGGCGGG + Intronic
1175125420 20:56747809-56747831 CTGTCACCTCCAAGGAGACCTGG + Intergenic
1175242505 20:57560212-57560234 CTGTGTCCTCCAGGGAGTTCTGG - Intergenic
1175418148 20:58815336-58815358 CTGTGACTTCCCGGGAGTCCTGG - Intergenic
1176128114 20:63485041-63485063 CTGTCAGCTCTGGGGAGGGCAGG - Intergenic
1177707122 21:24720730-24720752 CATTCACCTGCTGGGAGTGAGGG + Intergenic
1178975253 21:37215738-37215760 TGGTGACCTCCTGGGAGTGGGGG + Intergenic
1179170524 21:38969492-38969514 CTGTCACTTCCTGGGAGACCAGG + Intergenic
1181155286 22:20916507-20916529 CTGTCACCAGGTTGGAGTGCAGG - Intergenic
1181264745 22:21624383-21624405 CTGTGACCTCTTGGGACCGCAGG - Intergenic
1181895864 22:26106872-26106894 CTGTCAGCCCAGGGGAGTGCAGG - Intergenic
1181967275 22:26666110-26666132 CTGTCAGCACCCGGGAGTGGGGG - Intergenic
1183017345 22:34999953-34999975 CTGTCTCCTCTTGGGAGCTCTGG - Intergenic
1183510504 22:38231847-38231869 CGGTGACCTCCTGGGAGTGGGGG + Intronic
1183529810 22:38347296-38347318 CTGTCACCTCCTGGGAGTGCCGG - Intronic
1183740392 22:39665603-39665625 CTTTGGCATCCTGGGAGTGCAGG + Exonic
1184057073 22:42059819-42059841 CTGATACCACCTGGGAGTGAGGG - Exonic
1184095304 22:42313102-42313124 CCTTCCCCACCTGGGAGTGCAGG + Intronic
1184492068 22:44815487-44815509 CTCTCAGCTCCTGGGAGAGTCGG - Intronic
1184984106 22:48117697-48117719 CTGTGCCACCCTGGGAGTGCAGG + Intergenic
1185021167 22:48377043-48377065 CTGTCTCCTCTGGGGAGGGCAGG + Intergenic
1185348226 22:50319851-50319873 CTGTCCACTCCTGGGGGTGCAGG - Intronic
949566842 3:5253068-5253090 CGGTGACCTCCTGGGAGTGGGGG - Intergenic
950428060 3:12935251-12935273 CTAGCCCCTCCTGGGACTGCTGG - Intronic
950515129 3:13460175-13460197 GTGTCACTGGCTGGGAGTGCTGG + Intergenic
951356076 3:21668139-21668161 CTCTCAGCTGCTTGGAGTGCTGG + Intronic
953553721 3:43925217-43925239 CTGCCACCTCCAGGGAGGGCTGG - Intergenic
954389286 3:50260408-50260430 CTTTCATCTCCTGCCAGTGCCGG - Intergenic
955104022 3:55878663-55878685 CTGTCACCTCCTGTGAGGCGGGG - Intronic
955590206 3:60526748-60526770 CTGTCATGATCTGGGAGTGCAGG - Intronic
956459203 3:69454519-69454541 CGGCCAGCTGCTGGGAGTGCAGG - Intronic
957057304 3:75453490-75453512 CTGCCAGCTCCTTGGAGAGCTGG + Intergenic
959520489 3:107318290-107318312 TTGTGAGCTTCTGGGAGTGCTGG + Intergenic
960667244 3:120122042-120122064 TGGTGACCTCCTGGGAGTGGGGG + Intergenic
961514829 3:127426017-127426039 CTGCCACCTCCAGTGAGTCCTGG + Intergenic
962290781 3:134134703-134134725 GTGTCAGCTCCAGGGAGGGCTGG + Intronic
962356216 3:134696336-134696358 GTGTCACCAGCAGGGAGTGCTGG + Intronic
962884317 3:139609812-139609834 TGGTGACCTCCTGGGAGTGGGGG - Intronic
962939090 3:140109298-140109320 TAGTCACCTCCTGGAAGAGCCGG + Intronic
966258536 3:177948077-177948099 CTGTCATCACCAGGGAATGCTGG - Intergenic
966806952 3:183815294-183815316 CTGCCCCTTCCTGGCAGTGCTGG - Intergenic
968439994 4:618477-618499 CTCTCACCTCCTGTGAGCTCAGG - Intergenic
968964200 4:3761346-3761368 CTGTGAGCTCCTGGGGGTGGGGG - Intergenic
969000141 4:3973850-3973872 CTGCCAGCTCCTTGGAGAGCTGG + Intergenic
969091540 4:4697471-4697493 CTGTTATCTCATGGGAGTGGTGG + Intergenic
969482960 4:7456615-7456637 CTGTCCCCACCTGGGAGAGAGGG + Intronic
969692044 4:8709162-8709184 CTGTCACCTCCAGGCATTCCTGG - Intergenic
970577260 4:17439467-17439489 CTGTTAGCTCCTGAGAGAGCTGG - Intergenic
975407792 4:74011711-74011733 TGGTCACCTCCTGGGAGTGGGGG + Intergenic
975767937 4:77688588-77688610 CTGGTACCTCCTGGCAGTCCAGG - Intergenic
976162494 4:82218509-82218531 CTGCCACCTACTGGGAGGCCTGG + Intergenic
977138511 4:93337375-93337397 GTGTCACCTCCTGGTGGTGATGG - Intronic
979508790 4:121528056-121528078 TGGTCATTTCCTGGGAGTGCTGG - Intergenic
983941354 4:173537515-173537537 ATGTCACCTCCTGTGACTGTGGG + Intergenic
984865999 4:184281316-184281338 CTGTTTCCTGCTGGGTGTGCCGG + Intergenic
985604389 5:850632-850654 CCGTCAGATCCTGGGAGGGCCGG + Exonic
985639698 5:1057906-1057928 GTGTCACCTCCTGTCAGTACGGG - Intronic
985931142 5:3058694-3058716 CTGGCCCCTCCTGGGACAGCTGG + Intergenic
985961201 5:3304619-3304641 CTGCCACCTTCAGGGAGGGCTGG + Intergenic
986957804 5:13175962-13175984 ATGTCACCTCCCTGGAGTGCTGG - Intergenic
987237258 5:15955423-15955445 CTGCCACCTCCTGAGAGGGCTGG + Intergenic
989540374 5:42610991-42611013 CTGAAACCTTCTGGGAGTGATGG + Intronic
990130884 5:52581563-52581585 CTGTCTTCTCCTGGCAGTCCAGG + Intergenic
990961071 5:61394207-61394229 CTAGCACTTCCTGGGAGTACTGG - Intronic
991973392 5:72162642-72162664 CTGTCACCTCGGTGGAGTCCAGG + Intronic
992586441 5:78244955-78244977 CTGTCACCACGCTGGAGTGCAGG - Intronic
992697778 5:79307561-79307583 CTTTAACCTCCTGGGACTACAGG + Intronic
995843352 5:116466530-116466552 TTCTCATCTCCTGAGAGTGCTGG - Intronic
996330023 5:122318110-122318132 CTGCCTCCTCCTGTGGGTGCAGG + Intronic
998347780 5:141479460-141479482 CAGTGACCTCTTGGGAGGGCAGG + Intronic
999690515 5:154142147-154142169 CTGTCATCTCCTGGAAGGCCAGG - Intronic
999696535 5:154191983-154192005 CTAGCACCTCCTGGGAGGGTGGG - Intronic
1000036143 5:157449605-157449627 CTGTCACCTCCTGGGAGCTTTGG + Intronic
1000117051 5:158163241-158163263 CTGTCAGCTCTTGGAAGGGCTGG + Intergenic
1000862752 5:166476266-166476288 CTGTCCCCTTTTGGGAGGGCAGG - Intergenic
1001278293 5:170366765-170366787 CTGGCCCCTCCTGGAAGTGGTGG + Intronic
1001956821 5:175853466-175853488 CTGTCACCTGCTGAAAGAGCTGG + Intronic
1002745157 5:181464312-181464334 CTATCTCCTCCTGGGAGAGGAGG + Intergenic
1003905434 6:10694934-10694956 CTGTCACCTCCAGGCTGAGCCGG + Exonic
1004427859 6:15518203-15518225 CTGGCACCTTGTGGGGGTGCAGG + Intronic
1005496128 6:26389437-26389459 GCATCACCTCCTGGGAGTCCTGG - Intronic
1010821315 6:80419134-80419156 CTGTCAGCACGTGAGAGTGCAGG - Intergenic
1012625779 6:101402093-101402115 CTGTCACCTCCTGCGAGGTGAGG + Intronic
1013593977 6:111644881-111644903 GTGGCACCTCCTTGAAGTGCTGG + Intergenic
1015270604 6:131334137-131334159 CTGTCACCTGGCTGGAGTGCAGG + Intergenic
1018372995 6:163185952-163185974 CACTCACTGCCTGGGAGTGCTGG - Intronic
1019250065 6:170737858-170737880 CTATCTCCTCCTGGGAGAGGAGG + Intergenic
1019411570 7:908993-909015 CTGTCACCTGCTGGGCGCGGCGG - Intronic
1023410929 7:39888500-39888522 TGGTGACCTCCTGGGAGTGGGGG + Intergenic
1024063871 7:45717327-45717349 CAGCCACTTCCTGGGAGTTCAGG + Exonic
1024203233 7:47127067-47127089 ATGTCACCTCCTGGGAAGGTGGG - Intergenic
1024683251 7:51716770-51716792 CAGTGACCTCCTGGGAGTGAGGG + Intergenic
1024916607 7:54507357-54507379 CTGTAAGCTCCTGGGAGAGCTGG + Intergenic
1028526944 7:91797344-91797366 CTGTCACCAGCCTGGAGTGCAGG + Intronic
1029125893 7:98295074-98295096 CTGAGACCCCCTGGGGGTGCTGG - Intronic
1029168601 7:98615697-98615719 CTGACACCTCCTGGGGATGCAGG + Intergenic
1032192013 7:129770825-129770847 CTGTCAGGTGCTGGGAGTGGAGG - Intergenic
1032267751 7:130380700-130380722 CTGGCACCACCTGGGACAGCTGG + Intronic
1033645389 7:143298649-143298671 TGGTAACCTCCTGGGAGTGGCGG + Intronic
1034456575 7:151174160-151174182 ATGTCACCTCCTCAGAGAGCAGG + Intronic
1034959289 7:155355105-155355127 CTGTCTCCTGCTGGGAAGGCAGG + Intergenic
1034983135 7:155491013-155491035 CTTTCATCCCCTGGGAGTCCTGG + Intronic
1035064800 7:156096688-156096710 CTGTCACTCCGTGGGAGTCCTGG - Intergenic
1035497971 8:69446-69468 CTATCTCCTCCTGGGAGAGGAGG - Intergenic
1035647151 8:1233385-1233407 CTGTAACCTCCTGGGAGCAAGGG + Intergenic
1036395718 8:8369304-8369326 TTATAAACTCCTGGGAGTGCAGG - Intronic
1036589622 8:10157004-10157026 CTGTCTCCTCCTGGTAATGTGGG - Intronic
1036737434 8:11331020-11331042 TTGTGACCTCATTGGAGTGCGGG - Exonic
1037038484 8:14200074-14200096 CTGACATCTCCTGGCAGTGTTGG + Intronic
1038011484 8:23479997-23480019 TTGTCACATGCTGTGAGTGCAGG - Intergenic
1038785633 8:30612668-30612690 CTCTCAGCACCTGGGACTGCAGG + Intronic
1039024630 8:33244378-33244400 CTGCCACCCTCTGGGAGTCCTGG + Intergenic
1042854673 8:73254502-73254524 CTGTGACCTCCTGGGAATAGAGG - Intronic
1042961585 8:74309187-74309209 CTGACACTTCCTGGTAGTACGGG + Intronic
1043521623 8:81052330-81052352 CTGCCTTCTGCTGGGAGTGCAGG - Intronic
1046986853 8:120397787-120397809 CTGCCAGCTCCAGGGAGTCCAGG + Intronic
1048863810 8:138744142-138744164 CTGTTACCACCTGGTAGAGCAGG + Intronic
1049161964 8:141103540-141103562 CTGGGACATGCTGGGAGTGCAGG - Intergenic
1049807089 8:144546017-144546039 CTGCCACACCCTGGGAGTACAGG - Intronic
1050191869 9:3034730-3034752 CCGTCACCTCCTGTGACTACTGG - Intergenic
1052863506 9:33451166-33451188 CTGTCCCATCCTGGGTCTGCTGG + Intergenic
1054972138 9:71100387-71100409 CTGTCACTTCCTGAGAGTGAAGG - Intronic
1056373999 9:85989183-85989205 CTGTGACCTGCTGGGCGTGGTGG + Intronic
1056388512 9:86119057-86119079 CTGTCACATCCTGGAAGGGTTGG + Intergenic
1057076671 9:92141666-92141688 CTGTCTCCACCTGGTACTGCGGG + Intergenic
1057900514 9:98944399-98944421 CGGCTACCTCCTGGCAGTGCAGG + Intronic
1060200500 9:121649492-121649514 CCGTCCCCTCCAGGGAGGGCTGG + Intronic
1060493697 9:124102669-124102691 CTGTCACCTGCCAGGAGAGCAGG - Intergenic
1060518831 9:124282535-124282557 CTGTCTCCTCCTGGGAATGAGGG - Intronic
1060797557 9:126522855-126522877 CTGTCACCTCCAGGCTGCGCAGG - Intergenic
1061245373 9:129398814-129398836 CTCTCACATCCTGAGAGTGTGGG - Intergenic
1061259888 9:129474427-129474449 CTCTCAGCTCCTGGGTGAGCTGG + Intergenic
1061609438 9:131736609-131736631 CTGATACCTCCTTGGTGTGCAGG - Intronic
1062252950 9:135607553-135607575 CTGTCACCACGTGGGTGAGCTGG - Intergenic
1062605305 9:137345132-137345154 CTGTCACATCCAGGTAGTGGCGG - Intronic
1203792729 EBV:160293-160315 CTGTAACCACCTGGCGGTGCCGG - Intergenic
1203579627 Un_KI270745v1:30443-30465 CTATCTCCTCCTGGGAGAGGAGG + Intergenic
1186879441 X:13850244-13850266 CTGTTAGCTCCTGAGAGAGCTGG + Intronic
1189001203 X:36949146-36949168 ATGAGACCTCCTGGGAGTACGGG + Intergenic
1189644460 X:43112195-43112217 CTTCTACCTGCTGGGAGTGCTGG + Intergenic
1191997423 X:67110569-67110591 TTGCTACCTCCTGGGAGTCCTGG - Intergenic
1195321908 X:103727611-103727633 CAGTCACTTCCTGGGCTTGCAGG - Intronic
1199517389 X:148693359-148693381 CTTTCATCTTCTGGGAGAGCGGG - Intronic
1199615447 X:149651948-149651970 CTGGGAGGTCCTGGGAGTGCTGG - Intergenic
1199766010 X:150942088-150942110 CAGTGACCTGCTGGGATTGCTGG + Intergenic