ID: 1183529813

View in Genome Browser
Species Human (GRCh38)
Location 22:38347304-38347326
Sequence GTGGCCACCTGTCACCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183529813_1183529823 -2 Left 1183529813 22:38347304-38347326 CCCAGGAGGTGACAGGTGGCCAC No data
Right 1183529823 22:38347325-38347347 ACAGGAGTGGGAGGGGGAAACGG No data
1183529813_1183529819 -10 Left 1183529813 22:38347304-38347326 CCCAGGAGGTGACAGGTGGCCAC No data
Right 1183529819 22:38347317-38347339 AGGTGGCCACAGGAGTGGGAGGG 0: 1
1: 0
2: 3
3: 54
4: 423
1183529813_1183529820 -9 Left 1183529813 22:38347304-38347326 CCCAGGAGGTGACAGGTGGCCAC No data
Right 1183529820 22:38347318-38347340 GGTGGCCACAGGAGTGGGAGGGG No data
1183529813_1183529821 -8 Left 1183529813 22:38347304-38347326 CCCAGGAGGTGACAGGTGGCCAC No data
Right 1183529821 22:38347319-38347341 GTGGCCACAGGAGTGGGAGGGGG 0: 1
1: 0
2: 4
3: 73
4: 648
1183529813_1183529824 4 Left 1183529813 22:38347304-38347326 CCCAGGAGGTGACAGGTGGCCAC No data
Right 1183529824 22:38347331-38347353 GTGGGAGGGGGAAACGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183529813 Original CRISPR GTGGCCACCTGTCACCTCCT GGG (reversed) Intronic
No off target data available for this crispr