ID: 1183529814

View in Genome Browser
Species Human (GRCh38)
Location 22:38347305-38347327
Sequence TGTGGCCACCTGTCACCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183529814_1183529820 -10 Left 1183529814 22:38347305-38347327 CCAGGAGGTGACAGGTGGCCACA 0: 1
1: 0
2: 4
3: 22
4: 239
Right 1183529820 22:38347318-38347340 GGTGGCCACAGGAGTGGGAGGGG No data
1183529814_1183529821 -9 Left 1183529814 22:38347305-38347327 CCAGGAGGTGACAGGTGGCCACA 0: 1
1: 0
2: 4
3: 22
4: 239
Right 1183529821 22:38347319-38347341 GTGGCCACAGGAGTGGGAGGGGG 0: 1
1: 0
2: 4
3: 73
4: 648
1183529814_1183529823 -3 Left 1183529814 22:38347305-38347327 CCAGGAGGTGACAGGTGGCCACA 0: 1
1: 0
2: 4
3: 22
4: 239
Right 1183529823 22:38347325-38347347 ACAGGAGTGGGAGGGGGAAACGG No data
1183529814_1183529824 3 Left 1183529814 22:38347305-38347327 CCAGGAGGTGACAGGTGGCCACA 0: 1
1: 0
2: 4
3: 22
4: 239
Right 1183529824 22:38347331-38347353 GTGGGAGGGGGAAACGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183529814 Original CRISPR TGTGGCCACCTGTCACCTCC TGG (reversed) Intronic
900171804 1:1273076-1273098 CCTGGCCAGGTGTCACCTCCTGG - Intronic
901200304 1:7463139-7463161 TGTGGCCCGCTGTGACCTTCAGG + Intronic
902630483 1:17701704-17701726 TGGGGCAACCTGTCACCAGCCGG - Intergenic
902867321 1:19288131-19288153 TGTCCCCACCTGTGCCCTCCAGG - Intronic
903037200 1:20500580-20500602 TGGGGGTAGCTGTCACCTCCAGG - Exonic
904986044 1:34549681-34549703 TGTGGCCCCAAGGCACCTCCTGG + Intergenic
905247384 1:36624583-36624605 TGTGGCCAGCCCTCCCCTCCAGG + Intergenic
905604162 1:39282276-39282298 TGTAACCAGCTGTCACCTTCTGG - Exonic
907405760 1:54252512-54252534 AGTGGCCACCTGTCCCGCCCCGG - Intronic
907776357 1:57519522-57519544 TGTGGCCACCTACCATGTCCAGG - Intronic
907917644 1:58885557-58885579 TGAGGCCCAATGTCACCTCCAGG + Intergenic
909477335 1:76095561-76095583 TCTGGGCATCTGTTACCTCCTGG + Intronic
912945129 1:114078374-114078396 TCTGGCCACCAGTCCCCTCCGGG - Intergenic
914980391 1:152410043-152410065 TGTGTCCTCCTGTCACAGCCTGG + Exonic
917076172 1:171207408-171207430 TGGGGCCTCCTGTCACCTTCAGG + Intronic
920506869 1:206521446-206521468 CCTGGCCTCCTGTGACCTCCTGG + Intronic
922404434 1:225298021-225298043 TGTGCCCACCTCCCACCACCAGG + Intronic
922608467 1:226906273-226906295 TGTGGCCACCTGCCTCCTATTGG - Intronic
923500361 1:234559327-234559349 TGTGGCCAGCTGGGACCTCAGGG + Intergenic
1063121170 10:3106490-3106512 TGTGGCCCCCAGTCAGCCCCAGG - Intronic
1063464045 10:6231841-6231863 GGTGGGCACCCATCACCTCCTGG + Intronic
1064112405 10:12550442-12550464 TGCAGCCACCTGTCTCCCCCTGG + Intronic
1066109239 10:32181723-32181745 TGTGGTCATCGGTCACCTCTTGG + Intergenic
1067242454 10:44508157-44508179 TTTGGCCTCCTGTGGCCTCCAGG - Intergenic
1067461652 10:46462614-46462636 TATGAACACCTCTCACCTCCTGG - Exonic
1067625542 10:47921987-47922009 TATGAACACCTCTCACCTCCTGG + Intergenic
1067710861 10:48650044-48650066 TCTCTCCACCTGCCACCTCCTGG - Intronic
1068222593 10:54063519-54063541 TTTGGCCAACTTCCACCTCCTGG + Intronic
1069015775 10:63427419-63427441 TCTGGTCAGCAGTCACCTCCCGG - Intronic
1072713592 10:97734785-97734807 AGTGGCCCCCTGTGACCTCCAGG - Intergenic
1072804322 10:98415081-98415103 TGTGGCCGCCTCTCCCTTCCCGG - Exonic
1074265659 10:111900640-111900662 AGTGGCCACCTGTCTCTTCTTGG - Intergenic
1075639616 10:124055538-124055560 TGTGGCCACCTGCCTTTTCCAGG - Intronic
1076169705 10:128309059-128309081 AGTGGCTTCCTGTCATCTCCAGG - Intergenic
1076383047 10:130038209-130038231 TCAGGCCACCTGTCACCTGCTGG - Intergenic
1077404679 11:2377728-2377750 TGGGGCCACCTGTGGGCTCCAGG + Intronic
1077934941 11:6773600-6773622 TGTGTTCACCAGTCACCTCCTGG - Intergenic
1078187649 11:9065942-9065964 TGTTGCTCTCTGTCACCTCCAGG + Exonic
1079882944 11:25949143-25949165 TGTGGAGATCTTTCACCTCCTGG - Intergenic
1081482754 11:43504718-43504740 TGTGTCCAGCTGCCACCTGCAGG - Intergenic
1084504752 11:69558468-69558490 TTTGGCCACCTGTCTCCTGTGGG + Intergenic
1084738197 11:71119629-71119651 AATGACCACCTGTCACCTCAGGG + Intronic
1085536757 11:77225777-77225799 TGTTGCCCCATGCCACCTCCAGG - Intronic
1087356327 11:97098434-97098456 TGTGGCCCCCACTGACCTCCTGG + Intergenic
1090276494 11:125423665-125423687 TGTAGCTACCTGTCACCCCAAGG - Intronic
1091390272 12:122041-122063 TGTGGCCACCTTCCACCACACGG + Intronic
1092057383 12:5519200-5519222 TGAGGCCACATGGCACCACCTGG + Intronic
1094215203 12:27933108-27933130 TGTGTCCACCTCACACTTCCAGG - Intergenic
1094513478 12:31111200-31111222 TGTAGCCAGTTGTCACCCCCGGG - Intergenic
1095944780 12:47747711-47747733 TGTGGCCACCAGCTTCCTCCAGG - Exonic
1096573366 12:52537607-52537629 TGTGCCCACCAGGAACCTCCAGG + Intergenic
1096573774 12:52540188-52540210 TGTGGCCTGTTGTCACTTCCAGG - Intergenic
1096743111 12:53709003-53709025 AATGGCCACCTGTTACCTACAGG - Intronic
1097403441 12:59158260-59158282 TGTGTCCAGCTGTGAACTCCAGG - Intergenic
1100980556 12:100159107-100159129 TGTGGCCACCTATCAGCAGCAGG - Intergenic
1101233283 12:102763770-102763792 TGAGGCTCCCTGTCACTTCCAGG - Intergenic
1101440778 12:104702971-104702993 TGTGGTCACCACTGACCTCCTGG + Intronic
1101498680 12:105280498-105280520 TGTGGCCACATCCCACCTCTGGG + Intronic
1103851444 12:123936159-123936181 TGAAGCCACCCCTCACCTCCAGG - Exonic
1104771878 12:131368876-131368898 TGTTCCCATCTGTCACCACCTGG - Intergenic
1105975031 13:25466120-25466142 TGTGGCCTCCTGTGACCTTCAGG + Intronic
1107886641 13:44879173-44879195 TGTGCACACTGGTCACCTCCCGG - Intergenic
1108251915 13:48576210-48576232 TCTGTCCACATGTCACCTACAGG + Intergenic
1109453124 13:62545111-62545133 TGAGACTACCTGTCACCCCCTGG + Intergenic
1111197562 13:84894797-84894819 TGTGGCCAGCCGGCACCTGCTGG - Intergenic
1113449272 13:110395104-110395126 AGTGGAGACCTGTCTCCTCCTGG + Intronic
1113454998 13:110442181-110442203 AGTGGCCACCTGGCAGCTCCAGG + Intronic
1118744357 14:68763120-68763142 TCTGGCCAGCTCCCACCTCCCGG - Intergenic
1119095365 14:71825021-71825043 TGTGGCCACTTCCGACCTCCAGG + Intergenic
1120040631 14:79748958-79748980 TGGTGCAACCTGTCAGCTCCTGG + Intronic
1120461283 14:84799476-84799498 TGTGACAACCTGTCATCTACAGG - Intergenic
1120997504 14:90427798-90427820 AGGTGGCACCTGTCACCTCCTGG + Intergenic
1122117678 14:99535880-99535902 CACTGCCACCTGTCACCTCCTGG - Intronic
1122763068 14:104044117-104044139 TGTGGCCAGCGGGTACCTCCCGG - Intronic
1122788775 14:104175773-104175795 TGGGGCCACCTGCCCCCGCCTGG + Exonic
1125422652 15:39519936-39519958 GGTGTCCACCTGTCACCACTGGG + Intergenic
1127667947 15:61167592-61167614 TGTGGCACACTGTCACCACCTGG - Intronic
1129678680 15:77645913-77645935 CGAGGCCACCTGGCACCCCCAGG - Intronic
1129724922 15:77896836-77896858 AGAGGCCTCTTGTCACCTCCAGG + Intergenic
1130995160 15:88899374-88899396 AGTGGCCACCTGCCACCCCCAGG - Exonic
1131095204 15:89650072-89650094 TCAGGCCACCTGTCCCATCCTGG - Intronic
1131518943 15:93099059-93099081 AGTGTCCACCTGACAGCTCCAGG + Intergenic
1132403817 15:101530298-101530320 TGTGGCCACTTGGCACCTCCAGG + Intergenic
1132432693 15:101773852-101773874 TGTGGCCACCTGTCAGGAGCAGG - Intergenic
1133743084 16:8666140-8666162 TCTGGCCACCTGTCCCTTTCAGG - Intergenic
1134592345 16:15464860-15464882 TGTGACCTCCTGTCTCATCCTGG + Intronic
1136230205 16:28881184-28881206 TGTGACCCACTGTCACTTCCTGG + Intronic
1137486964 16:48899651-48899673 TGTTGCCACCTGGCTCCTCTAGG + Intergenic
1137722840 16:50637927-50637949 TGGGGCCTGCTGTCATCTCCTGG + Exonic
1140128587 16:72137861-72137883 TCTCTCCAGCTGTCACCTCCTGG - Intronic
1141143804 16:81515058-81515080 CGTGGCCATGGGTCACCTCCTGG - Intronic
1141375019 16:83522727-83522749 TGATGCCACCTGTCACCACCTGG - Intronic
1141671825 16:85496174-85496196 AGTGGGCACCTCTCACCTCTGGG - Intergenic
1142051329 16:87960021-87960043 CGGGGACACCTGTCACCCCCAGG - Intronic
1142711408 17:1725769-1725791 TATGGACGCCTGTCACCGCCAGG + Exonic
1142770377 17:2092468-2092490 TGTCCCCACCTGTAACCACCAGG + Intronic
1143307593 17:5959862-5959884 TGTGGCCACCTCCCACCCCAGGG - Intronic
1144159527 17:12543991-12544013 TTTGGAAGCCTGTCACCTCCTGG + Intergenic
1145253753 17:21311465-21311487 TGTGGCCACATGTGCCCTGCTGG - Intronic
1146458662 17:33026271-33026293 TGAGCCCACCTGTCACCCACGGG - Intronic
1148220178 17:45855565-45855587 TGTGCCCACCTTTCCCCTGCAGG - Intergenic
1148854425 17:50570929-50570951 TATGGCCCCCTGGCCCCTCCAGG - Intronic
1148992398 17:51677715-51677737 TGTGGCCCTCTGTCTCCTCTTGG + Intronic
1151513198 17:74574872-74574894 TGTGGTCACCTGTCACTACCCGG - Intergenic
1152604442 17:81282076-81282098 TGTGGCCGCCTGCTGCCTCCTGG - Intronic
1153772370 18:8426126-8426148 TGGGCCCACCTGTCACTTCTAGG - Intergenic
1155326642 18:24671419-24671441 TGTGACAACCTGCAACCTCCAGG - Intergenic
1155963964 18:32019017-32019039 TGTGGCCACGTGTAAGTTCCAGG + Exonic
1156481136 18:37437119-37437141 TGTAGCCACCTGCCACCCACTGG - Intronic
1160237445 18:77097311-77097333 TGTGGACAACTTTCTCCTCCTGG + Intronic
1162222682 19:9191597-9191619 TGTGGCCATCTGTCACCCTCTGG + Intergenic
1162230443 19:9261509-9261531 TGTGGACATCTGTCACCCTCTGG - Intergenic
1163646703 19:18493652-18493674 TGTGTCCAGCTGTCTCCACCTGG + Intronic
1163746444 19:19051645-19051667 TGTGGCCAGCTCTCGCCCCCAGG + Exonic
1164417671 19:28060053-28060075 TGTGGACAGCTGTAACCACCTGG + Intergenic
1165024931 19:32953650-32953672 TGTGGCCTCCTCTGTCCTCCCGG + Exonic
1165706374 19:37979119-37979141 GGTGGCCACCTGTAGCCTGCGGG + Intronic
1168181349 19:54664668-54664690 TCTGTCCACCTGGCACCTTCTGG - Intronic
925464088 2:4090446-4090468 TGTGGCAATCTCTCATCTCCAGG + Intergenic
926105373 2:10146487-10146509 TGTCCCCACCTGCCACCTGCTGG + Intronic
927289679 2:21393351-21393373 TGTGACCCCCTGGCACCTCTAGG - Intergenic
927477698 2:23426385-23426407 GGCGGCCACTGGTCACCTCCAGG + Intronic
927838199 2:26418274-26418296 TGTGGCCATCTGTTAGCCCCAGG - Intronic
928097551 2:28413692-28413714 TGTGGTCATCTGCCACCTGCTGG + Exonic
928316210 2:30248601-30248623 ACTGGCCCCCTGTCACCTCCAGG - Intronic
929420392 2:41784385-41784407 TTTGGCCCCTTGTCACATCCAGG - Intergenic
930232326 2:48856003-48856025 TGTGTCCATCTGTGTCCTCCTGG + Intergenic
932759676 2:74430981-74431003 TGTGGGCACCTGTCCCCTCAAGG - Intronic
934761398 2:96858881-96858903 TGTGGCCACCTGCCCCTTGCTGG - Intergenic
935959377 2:108409598-108409620 TGTGGTCACTTGTCAGCTTCTGG - Intergenic
936246610 2:110833941-110833963 TGTGGACCCCTCTCACCCCCAGG - Intronic
936864256 2:117058642-117058664 TTTTGCTCCCTGTCACCTCCAGG - Intergenic
940549175 2:155130121-155130143 TGTGGATACCTGTTACCACCTGG - Intergenic
944298009 2:198089635-198089657 TGTGGCTATATGTCAACTCCAGG - Intronic
946306110 2:218857929-218857951 ACTGGCCACCTGTAGCCTCCAGG + Intergenic
948031469 2:234821226-234821248 TGAGGCTGCCTGTCCCCTCCAGG + Intergenic
948289802 2:236816608-236816630 TGTGGCCATCAGTGACCTCCTGG + Intergenic
948516987 2:238510219-238510241 TGTGCCCACCCTCCACCTCCCGG + Intergenic
948777856 2:240299198-240299220 TCTTGGCACCTGTGACCTCCTGG + Intergenic
1168997835 20:2146023-2146045 GCTGCCCACCTGTCACCTACAGG - Exonic
1169026296 20:2374506-2374528 TGAGGCCACCTCTTACCTCCAGG + Intergenic
1169027091 20:2380476-2380498 TGTGGCTCCCTCTCCCCTCCTGG - Intergenic
1169877075 20:10309721-10309743 TGGGGCCACCCTTCACCTTCTGG - Intergenic
1170780553 20:19421957-19421979 TGTGGACACCGGGAACCTCCGGG + Intronic
1170973024 20:21134142-21134164 TGTGCCCACCTCACGCCTCCTGG - Intronic
1172987400 20:39003236-39003258 TATGGCCACTTATCACCTCCAGG - Intronic
1173192061 20:40884318-40884340 AGTGGCTACTTCTCACCTCCTGG + Intergenic
1173609387 20:44355679-44355701 TGCGGCCAGCTGCCACCGCCCGG - Intronic
1173846819 20:46193558-46193580 GCTGGCTCCCTGTCACCTCCAGG + Intronic
1174116685 20:48231090-48231112 TCTGGACACCTGTCAACCCCAGG - Intergenic
1174949594 20:55029416-55029438 TTTGGCCAACTGCCTCCTCCTGG - Intergenic
1175993965 20:62804316-62804338 TGTGGACACGTGGCCCCTCCGGG + Intergenic
1178719741 21:34997974-34997996 TATGGTCACCTGGCACATCCAGG + Intronic
1181573654 22:23781021-23781043 CCTGGCCCACTGTCACCTCCAGG + Exonic
1182709306 22:32310640-32310662 TGGGTCCAGCTGTCTCCTCCAGG - Intergenic
1183529814 22:38347305-38347327 TGTGGCCACCTGTCACCTCCTGG - Intronic
1183583561 22:38739469-38739491 CGTGTCCCCCTGTCACCTCGTGG + Intronic
1184119245 22:42439778-42439800 TTTGGTCACCTGTGACCTGCTGG - Intergenic
1184250555 22:43257903-43257925 TGGGGCCACCCCTCACTTCCAGG + Intronic
1184396890 22:44247556-44247578 TGGGTCCAGCTGTCTCCTCCAGG - Exonic
1185001104 22:48246458-48246480 TAAGCACACCTGTCACCTCCAGG - Intergenic
1185294644 22:50047056-50047078 AGTGGCCACCAGTCACCTCCTGG - Intronic
952950890 3:38524140-38524162 TGTGGACACCTGTAAGCTCCTGG + Exonic
953438570 3:42898818-42898840 TGTGGCCACCTGTGTGCTACTGG - Intronic
954366553 3:50149444-50149466 GGTGGCCACTTTTCGCCTCCTGG - Intergenic
954592741 3:51797593-51797615 TTAGGCTACCTGACACCTCCAGG + Intergenic
954860050 3:53680400-53680422 TCTGGCCACATGTGCCCTCCTGG + Intronic
956080429 3:65550507-65550529 TGTTTGAACCTGTCACCTCCGGG + Intronic
956169219 3:66419550-66419572 TCTGCCTACCTGTCTCCTCCTGG - Intronic
958595623 3:96217826-96217848 TTTGGCCAACTGCCTCCTCCTGG - Intergenic
959242588 3:103816540-103816562 TGTGGCCCGCTGTCACGGCCCGG - Intergenic
960430434 3:117562162-117562184 TGTGAGCACCTGTCACCACAAGG + Intergenic
961163105 3:124746140-124746162 TGTGGGCTCCTGCCATCTCCAGG + Intergenic
961177261 3:124845970-124845992 TGTGGCCACCTGTCGCCAGGAGG + Intronic
961480508 3:127176474-127176496 AGTGGGCCCCTGTCAACTCCTGG - Intergenic
962329338 3:134463879-134463901 TGTTGCATCCTGTCACCTGCTGG + Intergenic
962943416 3:140146069-140146091 TGAGCCCACCTGTCACCCTCTGG + Intronic
967469281 3:189843413-189843435 TGTTGCCACCTGTCAGTTGCGGG - Intronic
968208111 3:196822759-196822781 TGTGTCCAAATGTCACCTCAGGG - Intronic
969414073 4:7047486-7047508 TCTGGCCTTCTGCCACCTCCTGG - Intronic
969448151 4:7257151-7257173 TCTGGCCACCTGCCCACTCCAGG - Intronic
970875670 4:20866949-20866971 TGTGGAGATCTTTCACCTCCTGG - Intronic
972591077 4:40487641-40487663 TGTGCTCACCTTTCACGTCCTGG + Intronic
977751699 4:100617186-100617208 TGTGGTGAGCTGTCTCCTCCTGG - Intronic
978554482 4:109964208-109964230 TCTGGCAATATGTCACCTCCTGG + Intronic
981454203 4:144934258-144934280 TTTGTCCTCCTGTGACCTCCAGG - Intergenic
982775349 4:159435878-159435900 TGTGGCAGCCAGTCACTTCCTGG + Intergenic
985306651 4:188549502-188549524 TGTAGCCACCTGTCACTTTTGGG + Intergenic
989343665 5:40405454-40405476 TGTGGCCACTTGTCAGATCTGGG + Intergenic
991630950 5:68655907-68655929 TATGGCCTCCTGCCACCACCGGG + Intergenic
997539308 5:134648649-134648671 CGAGGCCACCTGACAGCTCCTGG - Intronic
999682254 5:154071346-154071368 TGTGGTCTTCTGTGACCTCCAGG + Intronic
1001138917 5:169126773-169126795 TGTCTCCTCCTGTCACCTCTGGG - Intronic
1001985640 5:176072844-176072866 TGAGGACACCTGTCAACACCTGG - Intronic
1001990424 5:176111992-176112014 AGTGGGCTCCTTTCACCTCCTGG - Intronic
1002048254 5:176554104-176554126 TGTCCCCAGCTGTCATCTCCGGG + Intronic
1002226447 5:177726148-177726170 AGTGGGCTCCTTTCACCTCCTGG + Intronic
1002231231 5:177765280-177765302 TGAGGACACCTGTCAACACCTGG + Intronic
1002264106 5:178018468-178018490 TGAGGACACCTGTCAACACCTGG - Intronic
1002267400 5:178045065-178045087 AGTGGGCTCCTTTCACCTCCTGG - Intronic
1003382755 6:5639817-5639839 TGTTGCTGCCTGTCACATCCTGG + Intronic
1003811668 6:9789343-9789365 TGTGGCCCCCTGGCGCCTCTGGG - Intronic
1004591469 6:17055923-17055945 TATGGCCACCTGTCACTCCAAGG + Intergenic
1005998475 6:30947138-30947160 TGAGGCCACCAGCCACATCCTGG + Intronic
1006153598 6:32002229-32002251 TGGGGCCACCTATGACCTCGAGG + Exonic
1006155438 6:32010718-32010740 TGTGGACACCTATGACGTCCAGG - Intergenic
1006159906 6:32034966-32034988 TGGGGCCACCTATGACCTCGAGG + Exonic
1006161744 6:32043452-32043474 TGTGGACACCTATGACGTCCAGG - Exonic
1006285660 6:33092161-33092183 CGAGGACACCTGTGACCTCCAGG - Intergenic
1007577972 6:42938407-42938429 TGTGGCCACCAGGCCCCTCTGGG - Intronic
1009961565 6:70529056-70529078 TTTTGCCAGCTGTCACCTCCTGG + Intronic
1011002910 6:82611183-82611205 TGTGCCCACCTGGCTCATCCAGG - Intergenic
1011649908 6:89496032-89496054 GGTGGCCACCAGTTAGCTCCAGG - Intronic
1012402016 6:98848594-98848616 TGTGGCTGCCTGAGACCTCCAGG + Intergenic
1014888610 6:126814042-126814064 TGTGGCCACATTTGAGCTCCTGG - Intergenic
1018750534 6:166800363-166800385 TCTGGCCTCCTGCCACATCCAGG + Intronic
1019580022 7:1757131-1757153 TGTGGTCATCAGTCACCTCTTGG - Intergenic
1020124865 7:5527923-5527945 TGTGGGGAGCTGTCACATCCAGG - Intronic
1021809164 7:24386649-24386671 TGTGGCCACCCCCCTCCTCCAGG + Intergenic
1022466432 7:30655715-30655737 TGTGTCCACCTCTCGCCCCCAGG - Exonic
1025871016 7:65434307-65434329 TGTTGCCAACTGTCCCCTGCGGG - Intergenic
1026737808 7:72960146-72960168 TGTGACCCCCTATCCCCTCCAGG + Exonic
1026788843 7:73318947-73318969 TGTGACCCCCTATCCCCTCCAGG + Exonic
1027105926 7:75404922-75404944 TGTGACCCCCTATCCCCTCCAGG - Exonic
1029508629 7:100978670-100978692 TGTCTCCTCCTGCCACCTCCAGG - Intronic
1029606350 7:101601594-101601616 TGTCCCCACCTGTCACTGCCTGG - Intergenic
1034520317 7:151614393-151614415 TGTGGCTTCTGGTCACCTCCAGG - Intronic
1035023922 7:155814534-155814556 TGTGTGCACATGCCACCTCCCGG - Intergenic
1035225855 7:157431808-157431830 TGAGGTCACCTGTCACCTGATGG + Intergenic
1036097602 8:5741293-5741315 TGTGGGCACCTGTCTGCTGCAGG - Intergenic
1036604846 8:10295698-10295720 TGTGGTCACTTGGCACCCCCTGG + Intronic
1036656695 8:10681612-10681634 TGTGGCCACCTGGCACCTGCAGG + Intronic
1036750413 8:11440183-11440205 TGCGGCCACCTGACTCCTCCAGG - Intronic
1037458239 8:19084308-19084330 TGTGGCCTCCTTACAGCTCCTGG + Intronic
1037859628 8:22395895-22395917 TGTCCCCACCTCTCAGCTCCAGG + Intronic
1037992927 8:23333359-23333381 TGTGGCCACTTGGCACCTGGAGG - Intronic
1041310718 8:56513732-56513754 TGTGGCCTCCTGCCTCCTCTCGG + Intergenic
1042413105 8:68486949-68486971 TGTGGCCAGCTCTCACATTCAGG - Intronic
1043401858 8:79891948-79891970 TGTGGCCTCCCTTCCCCTCCCGG + Intergenic
1043401882 8:79892005-79892027 TGTGGCCTCCCTTCCCCTCCTGG + Intergenic
1044751722 8:95422843-95422865 CATGGCCCACTGTCACCTCCAGG - Intergenic
1044841227 8:96338758-96338780 GGTGGCCCCCGGGCACCTCCTGG - Intergenic
1047423741 8:124727759-124727781 TGTGGCCACCGGCCACCTGCGGG - Intronic
1048732865 8:137463051-137463073 TGAGGCCAACTGTGACCTGCTGG - Intergenic
1049027841 8:140008676-140008698 TGTGACCACCTGCCACCTCCTGG + Intronic
1049284073 8:141765120-141765142 TGTGGCCATCTGGTGCCTCCTGG + Intergenic
1049514925 8:143049158-143049180 CGGGGACACCTGTGACCTCCTGG + Intronic
1050584161 9:7092727-7092749 TGTGGTCTTCTATCACCTCCAGG - Intergenic
1051272897 9:15372355-15372377 TGTGGCCCCCTGTCACCCAGGGG - Intergenic
1054965868 9:71026330-71026352 TGCAGCCACCTGGTACCTCCTGG + Intronic
1058935278 9:109764217-109764239 AGTGGCTCCCTGTCACCTGCAGG + Intronic
1059872730 9:118596011-118596033 GGTGGCTGCCTGTCTCCTCCTGG + Intergenic
1060797561 9:126522864-126522886 TTGGCCCTCCTGTCACCTCCAGG - Intergenic
1060995968 9:127875079-127875101 CCTGGCCACCTCCCACCTCCTGG - Intronic
1062247124 9:135574976-135574998 TGTGGCCCTGTGTCAGCTCCGGG - Intergenic
1062396866 9:136356111-136356133 TGTCTCCTCCTGTCACCCCCTGG + Intronic
1062590838 9:137273912-137273934 AGGGGGCACCTCTCACCTCCTGG + Intergenic
1062625305 9:137439747-137439769 TGTAGCCACCTGAGACCCCCAGG + Intronic
1185623679 X:1468424-1468446 TGTGGCCACCGGACAGCCCCCGG + Intronic
1186349558 X:8728922-8728944 TGTGCACACCTGACACCTCCAGG - Intronic
1188435437 X:30153266-30153288 TGTGGCCTCATGCCACCTCCTGG + Intergenic
1189136987 X:38560947-38560969 TCTGGCCACCTGTCTGTTCCTGG + Intronic
1194435885 X:93868235-93868257 GGCGGCCACCTCTCCCCTCCAGG - Intergenic
1198272435 X:135067275-135067297 TTTGGCCACTTGCCTCCTCCTGG + Intergenic
1201142947 Y:11043543-11043565 AATGACCACCTGTCACCTCAGGG + Intergenic
1201586782 Y:15569805-15569827 TGAAGCCACCTGTGACCTGCAGG - Intergenic