ID: 1183529820

View in Genome Browser
Species Human (GRCh38)
Location 22:38347318-38347340
Sequence GGTGGCCACAGGAGTGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183529810_1183529820 -1 Left 1183529810 22:38347296-38347318 CCGGCACTCCCAGGAGGTGACAG 0: 1
1: 0
2: 2
3: 39
4: 338
Right 1183529820 22:38347318-38347340 GGTGGCCACAGGAGTGGGAGGGG No data
1183529813_1183529820 -9 Left 1183529813 22:38347304-38347326 CCCAGGAGGTGACAGGTGGCCAC No data
Right 1183529820 22:38347318-38347340 GGTGGCCACAGGAGTGGGAGGGG No data
1183529809_1183529820 0 Left 1183529809 22:38347295-38347317 CCCGGCACTCCCAGGAGGTGACA 0: 1
1: 0
2: 1
3: 16
4: 255
Right 1183529820 22:38347318-38347340 GGTGGCCACAGGAGTGGGAGGGG No data
1183529814_1183529820 -10 Left 1183529814 22:38347305-38347327 CCAGGAGGTGACAGGTGGCCACA 0: 1
1: 0
2: 4
3: 22
4: 239
Right 1183529820 22:38347318-38347340 GGTGGCCACAGGAGTGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183529820 Original CRISPR GGTGGCCACAGGAGTGGGAG GGG Intronic
No off target data available for this crispr