ID: 1183529821

View in Genome Browser
Species Human (GRCh38)
Location 22:38347319-38347341
Sequence GTGGCCACAGGAGTGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 726
Summary {0: 1, 1: 0, 2: 4, 3: 73, 4: 648}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183529814_1183529821 -9 Left 1183529814 22:38347305-38347327 CCAGGAGGTGACAGGTGGCCACA 0: 1
1: 0
2: 4
3: 22
4: 239
Right 1183529821 22:38347319-38347341 GTGGCCACAGGAGTGGGAGGGGG 0: 1
1: 0
2: 4
3: 73
4: 648
1183529813_1183529821 -8 Left 1183529813 22:38347304-38347326 CCCAGGAGGTGACAGGTGGCCAC No data
Right 1183529821 22:38347319-38347341 GTGGCCACAGGAGTGGGAGGGGG 0: 1
1: 0
2: 4
3: 73
4: 648
1183529809_1183529821 1 Left 1183529809 22:38347295-38347317 CCCGGCACTCCCAGGAGGTGACA 0: 1
1: 0
2: 1
3: 16
4: 255
Right 1183529821 22:38347319-38347341 GTGGCCACAGGAGTGGGAGGGGG 0: 1
1: 0
2: 4
3: 73
4: 648
1183529810_1183529821 0 Left 1183529810 22:38347296-38347318 CCGGCACTCCCAGGAGGTGACAG 0: 1
1: 0
2: 2
3: 39
4: 338
Right 1183529821 22:38347319-38347341 GTGGCCACAGGAGTGGGAGGGGG 0: 1
1: 0
2: 4
3: 73
4: 648

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183529821 Original CRISPR GTGGCCACAGGAGTGGGAGG GGG Intronic
900122230 1:1053694-1053716 GTGGCAACAGGACAGGGTGGGGG - Intronic
900137055 1:1122132-1122154 GAGGCCACAGGGGAGGGCGGAGG - Intergenic
900270937 1:1788311-1788333 GTGGCTGCAGGAGGTGGAGGAGG - Intronic
900349962 1:2229740-2229762 GTGGCCCCAGGCCTGGGAGCTGG + Intronic
900392200 1:2438565-2438587 GTGCCCACAGGAAGGGGAGGGGG + Intronic
900612772 1:3551349-3551371 GGGGCCAAAGGGGTGGGATGTGG + Intronic
900638579 1:3677322-3677344 GTGCCCACAGCAGTGGGAGCAGG - Intronic
900638636 1:3677578-3677600 GTGGCCACAGCATTTGGGGGTGG - Intronic
900738195 1:4313416-4313438 GTGGCCACAGGAGAGATAGAGGG + Intergenic
900742675 1:4340206-4340228 GAGGCCACAGGGGAGGGAGTTGG + Intergenic
901072945 1:6532128-6532150 GTGATGACAGGTGTGGGAGGTGG - Intronic
901365844 1:8747362-8747384 GTGGGCATGGAAGTGGGAGGTGG + Intronic
901631435 1:10649981-10650003 GAGGCCAAAGGAAGGGGAGGGGG + Intronic
901786663 1:11629404-11629426 GTGGGGACGGGAGTGGGAGAGGG + Intergenic
901809653 1:11760341-11760363 GTGGGCAAAGGTTTGGGAGGTGG + Intergenic
901874915 1:12161905-12161927 GTGGCCCCAGGGAAGGGAGGAGG + Intergenic
902364942 1:15966793-15966815 GTGGCCACGGGAGGCTGAGGTGG + Intronic
902395330 1:16129377-16129399 GCAGCCTCTGGAGTGGGAGGCGG + Intronic
902395929 1:16132537-16132559 GTGGGCACAGGTGTGGGGAGAGG + Intronic
902899241 1:19502749-19502771 GGGGCCACAGGAGTGGGGTTGGG - Intergenic
903101568 1:21035144-21035166 GTGGCCTCAGGCCTGGGAGTGGG - Intronic
903291332 1:22316038-22316060 CTGGGCACAGGAGTCAGAGGGGG + Intergenic
903645502 1:24893487-24893509 GGGGTCACTGGAGTGGGAGAAGG + Intergenic
904410700 1:30323065-30323087 GGGGCCACCGGAGAGGGAGGGGG + Intergenic
904705118 1:32384135-32384157 GGGGCTGCAGGAGAGGGAGGAGG + Intronic
904908590 1:33917051-33917073 GAGGGCATAGGGGTGGGAGGAGG - Intronic
905388581 1:37621588-37621610 GGGACCACAGGAGGAGGAGGGGG + Intronic
905775101 1:40663345-40663367 GGTGCCCCTGGAGTGGGAGGAGG + Intronic
905875109 1:41427388-41427410 GTGGGCACAAGGGTGGGAGCTGG - Intergenic
905899494 1:41571934-41571956 GTGGCCAGAGCAGTGGCAGAGGG + Intronic
905916756 1:41689899-41689921 GTGACCACGGGACTGGGAGGCGG - Intronic
906099859 1:43253362-43253384 GAAGCCACAGGAGTGGGTGCTGG + Intronic
906287218 1:44595286-44595308 GTGGCTCCAGCACTGGGAGGGGG - Intronic
906706966 1:47902001-47902023 GTGGGCAGAAGAGTGGGTGGAGG - Intronic
908158112 1:61377374-61377396 GTGGCCTCAAGAGAGGCAGGAGG - Intronic
908789909 1:67770845-67770867 GAGGCCACTGGAGGGGGAAGTGG + Intronic
908834090 1:68210996-68211018 TAGGCCAAAGCAGTGGGAGGTGG - Intronic
909122698 1:71624524-71624546 GTGGTCACAGAAGTGGCAAGAGG - Intronic
909431399 1:75591042-75591064 GTGGCCACAGGAGCTTTAGGTGG + Intronic
909673437 1:78213746-78213768 CTGGACAGAGTAGTGGGAGGTGG + Intergenic
910253511 1:85222704-85222726 GTGACCAGCGTAGTGGGAGGGGG - Intergenic
910366852 1:86475135-86475157 GTGGGCTCAGGAGTGGGATGAGG - Intronic
910759440 1:90719758-90719780 GTGGCCAGAGGGGTGCGGGGAGG + Intergenic
912485467 1:110024065-110024087 ATGGATACAGGTGTGGGAGGAGG - Intergenic
912616228 1:111102497-111102519 GTGGCCAGAGGAGTGGGGCGAGG - Intergenic
914747319 1:150509927-150509949 GTGGCCTCCTGAGAGGGAGGGGG - Exonic
915530245 1:156499062-156499084 GTTGGGAGAGGAGTGGGAGGTGG + Intronic
915560039 1:156681720-156681742 GGGGCCACAGGGGTGGGGGTGGG + Intergenic
916031923 1:160884544-160884566 AAGGCCACAGGAGTGGGCAGTGG + Intronic
916759601 1:167804397-167804419 GTTGCCAGTGGGGTGGGAGGAGG - Intergenic
917284160 1:173407112-173407134 GTGGCCACTGGGGAGGCAGGTGG + Intergenic
917853982 1:179087136-179087158 GTGGGCTCTGGAGTGGGAGCTGG + Intronic
917906795 1:179592693-179592715 GAGCCCACAGGAGTTGGAGAAGG + Exonic
918249018 1:182685191-182685213 CTGGCCACAGGATGGGCAGGTGG - Intergenic
918371173 1:183863062-183863084 CTTGGCACAGGTGTGGGAGGAGG + Intronic
919795762 1:201320524-201320546 GTGGCTACAGGAGTGGGCTCTGG + Intronic
919920076 1:202162220-202162242 GACACCACAGGGGTGGGAGGAGG + Intergenic
920676093 1:208039755-208039777 GTGCCCACAGGAGTGCGCAGGGG - Exonic
920859617 1:209694859-209694881 GTGGCCAGAGAAATGTGAGGAGG + Intronic
921153324 1:212418717-212418739 GGGGCCACAGGAGTGATTGGTGG + Intergenic
921328555 1:214012606-214012628 GAGGCAACAGTAGTTGGAGGTGG + Intronic
922551431 1:226497364-226497386 GTACCCACAGGAGTGGGGAGGGG + Intergenic
922901320 1:229138908-229138930 GTGCCCAGAGGAGAGGGAAGGGG - Intergenic
922952464 1:229570492-229570514 GTGGCGACGGCAGTGGGACGTGG - Intergenic
923306567 1:232694055-232694077 ATGGCCACAGGATGGGGAGCGGG - Intergenic
923423481 1:233844171-233844193 GTGGCCAGAGGTGATGGAGGAGG + Intergenic
923957903 1:239043171-239043193 CTTGTGACAGGAGTGGGAGGGGG - Intergenic
1062907257 10:1187343-1187365 CTGGTGACGGGAGTGGGAGGAGG - Intronic
1063264064 10:4426260-4426282 GTGGCAGCAGGAGAGGGAGGAGG - Intergenic
1063946367 10:11180247-11180269 GCGGCAACAAGAGTGGAAGGTGG + Intronic
1064385471 10:14887284-14887306 GTGGTCACAGGGTTGGGTGGGGG + Intronic
1064422550 10:15203226-15203248 GTGGCCCCAGGACTGGTTGGTGG - Intergenic
1064962198 10:20977554-20977576 GAGCCCACAGGAGGAGGAGGAGG + Intronic
1065523485 10:26594219-26594241 TTGGCGACAGCAGGGGGAGGGGG - Intergenic
1065673190 10:28144639-28144661 GGGGACAAAGGAGTGGGAGATGG - Intronic
1065871699 10:29961262-29961284 GTGTGCATAGGACTGGGAGGAGG - Intergenic
1066212768 10:33256242-33256264 GTGGCCGCAGGTGTGTGAGCAGG + Intronic
1066320554 10:34299152-34299174 GTGGCCAACAGAGTGCGAGGAGG + Intronic
1066707900 10:38201308-38201330 GTAGCCACTAGAGTGGGAAGAGG + Intergenic
1066752722 10:38675625-38675647 GTGCCGGCAGGAGTGGGATGGGG - Intergenic
1066964308 10:42247400-42247422 GTGCCAGCAGGAGTGGGATGGGG + Intergenic
1067044874 10:42979917-42979939 GAGGGGACAGGAGTGGGAAGAGG + Intergenic
1067282412 10:44882310-44882332 CTGGCCACAGGCAGGGGAGGGGG - Intergenic
1067373058 10:45702591-45702613 GTGGCTACTAGAGTGGGAGGAGG + Intergenic
1067386717 10:45823531-45823553 GTGGCTACTAGAGTGGGAGGAGG - Intergenic
1067447551 10:46361080-46361102 GTGGCTACTAGAGTGGGAGGAGG + Intergenic
1067589829 10:47499688-47499710 GTGGCTACTAGAGTGGGAGGAGG - Intergenic
1067636953 10:48007787-48007809 GTGGCTACTAGAGTGGGAGGAGG - Intergenic
1067699832 10:48562627-48562649 GGGGCAAAGGGAGTGGGAGGAGG + Intronic
1067876538 10:50012544-50012566 GTGGCTACTAGAGTGGGAGGAGG + Intergenic
1067904025 10:50272083-50272105 GTGGTCACAGGGGTGGGTGAAGG + Intergenic
1068425796 10:56862087-56862109 GTGGGCACAGGAGGTGGAGGTGG - Intergenic
1068679408 10:59803584-59803606 GTGGCCAGTGGAGTAGGGGGAGG - Intronic
1068800136 10:61131544-61131566 TAGGCCACAGGACTGGGAGGGGG - Intergenic
1070133503 10:73671807-73671829 GTGGCTACTAGAGTGGGAGGAGG - Intergenic
1070168012 10:73912479-73912501 GTGGCCACACAAATGTGAGGTGG + Intronic
1070395868 10:76010803-76010825 CTGGCCACAGGAACGGGAGGAGG + Intronic
1070549072 10:77476362-77476384 GGGCTCACAGGAGTGGGAGGTGG - Intronic
1070757651 10:79003440-79003462 GAGCCCACAGGCTTGGGAGGAGG - Intergenic
1071608166 10:87012272-87012294 GTGGCTACTAGAGTGGGAGGAGG + Intergenic
1071755156 10:88529144-88529166 GAGGACTGAGGAGTGGGAGGAGG - Intronic
1072279189 10:93850724-93850746 ATGGGCACAGGATTGGGGGGTGG - Intergenic
1072556179 10:96515391-96515413 ATAGGCAAAGGAGTGGGAGGGGG + Intergenic
1072624891 10:97104924-97104946 GTGGTGACAGGGGTGGGAGGTGG - Intronic
1072757564 10:98030848-98030870 GCGGCCACTGGGGTGGGCGGCGG + Intergenic
1072791825 10:98323428-98323450 CTGGCCACAGGCGGGGGTGGAGG - Intergenic
1072970006 10:100009607-100009629 GGGACTACAGGAGTGCGAGGGGG + Intronic
1073285578 10:102385618-102385640 GTGGGAACAGGAGTGGGGTGGGG + Intergenic
1073327511 10:102651152-102651174 GTGGCCTCAGCAGCAGGAGGGGG + Intronic
1074161576 10:110840615-110840637 ATGGCCACAGGAGGTGGGGGTGG - Intergenic
1074912662 10:117925598-117925620 GTGGCCCAGAGAGTGGGAGGGGG - Intergenic
1075335441 10:121605918-121605940 GTGGCCACAGGGGTGGCACAAGG - Intergenic
1075442343 10:122489930-122489952 GTTGCCACAGGATTGGGAATGGG - Intronic
1075717556 10:124565859-124565881 GTGGGGACAGGAGGGGGAAGGGG + Intronic
1075728086 10:124620831-124620853 GTGGGCACAGGACAGGCAGGCGG + Exonic
1075993528 10:126858168-126858190 ATGGCAACAGCAGTGGGATGTGG + Intergenic
1076302684 10:129440013-129440035 GTGGCCACACAAGAGGCAGGAGG - Intergenic
1076452300 10:130565139-130565161 GTGGCCACAGCAGGGTGAGGAGG - Intergenic
1076500156 10:130930553-130930575 GGAGCCACAGGAGAAGGAGGAGG - Intergenic
1076500163 10:130930589-130930611 GGAGCCACAGGAGAAGGAGGAGG - Intergenic
1076500179 10:130930661-130930683 GGAGCCACAGGAGAAGGAGGAGG - Intergenic
1076500186 10:130930697-130930719 GGAGCCACAGGAGAAGGAGGAGG - Intergenic
1076500193 10:130930733-130930755 GGAGCCACAGGAGAAGGAGGAGG - Intergenic
1076500207 10:130930805-130930827 GGAGCCACAGGAGGAGGAGGAGG - Intergenic
1076500215 10:130930841-130930863 GGAGCCACAGGAGAAGGAGGAGG - Intergenic
1076804223 10:132847153-132847175 GAGGCCACACGAGGGGCAGGAGG + Intronic
1076879859 10:133234817-133234839 GAGGCCACAGGGGTGGGTGTTGG + Intergenic
1077139231 11:1016342-1016364 CTGGGGAGAGGAGTGGGAGGAGG + Exonic
1077173398 11:1178311-1178333 TTGGCCACCTGGGTGGGAGGAGG + Intronic
1077280259 11:1741429-1741451 GTGGGTAGAGGAGAGGGAGGAGG + Intronic
1077287279 11:1773147-1773169 CTGGGCACAGGTGGGGGAGGGGG + Intergenic
1077391232 11:2301516-2301538 GGGGCCACAGGGGTGGGCTGGGG - Intronic
1077537276 11:3130442-3130464 GTGGCTTCAGGAGTGGGCTGGGG + Intronic
1078638624 11:13075436-13075458 GGGGCAGTAGGAGTGGGAGGTGG + Intergenic
1078802330 11:14659650-14659672 GGGCCTACCGGAGTGGGAGGAGG - Intronic
1079306366 11:19327088-19327110 GTGGCCACAGCACTGGGTTGAGG - Intergenic
1079995841 11:27294165-27294187 GTGGCCTCCGGTGTTGGAGGTGG + Intergenic
1080350988 11:31385888-31385910 GTGGCCACTGCAGGGGGATGGGG - Intronic
1081297020 11:41403749-41403771 GTTCCCAAAGGAGGGGGAGGAGG - Intronic
1081530514 11:43955594-43955616 GGGGCCACAGGACTGGTGGGTGG + Intergenic
1081741063 11:45440996-45441018 GTGCCCACAGGGGTGGGGGCAGG - Intergenic
1081867427 11:46367331-46367353 GGGGCCCCAGGGGTGGGCGGAGG - Exonic
1083214252 11:61208518-61208540 GTGACCTCTGGAGGGGGAGGTGG - Intronic
1083217136 11:61227347-61227369 GTGACCTCTGGAGGGGGAGGTGG - Intronic
1083220018 11:61246173-61246195 GTGACCTCTGGAGGGGGAGGTGG - Intronic
1083257022 11:61502889-61502911 GAGGCCACAGGAGTGTGAGGAGG - Intergenic
1083328660 11:61886543-61886565 GAGGCCACAGGAGTTGGTTGGGG - Intronic
1083961592 11:66017623-66017645 GTGGGCAGATGAGTGGGTGGAGG - Intronic
1084013098 11:66363519-66363541 GCTGCCACACGAGAGGGAGGTGG - Exonic
1084220424 11:67674407-67674429 GGGGCCACAGGGGTGAGGGGCGG - Intronic
1084795241 11:71500941-71500963 CTGGCCTCTGTAGTGGGAGGTGG + Intronic
1084921620 11:72475413-72475435 GAGGCCATAGGAGTGGGTGAAGG - Intergenic
1085059367 11:73430645-73430667 GTGGCGAATGGAGTGGGAAGGGG - Intronic
1085475036 11:76784026-76784048 GGGACCTCAGGAGGGGGAGGGGG - Intronic
1086065338 11:82737761-82737783 CTGCCCACAGGAGTTGGAGAAGG + Intergenic
1086405737 11:86497738-86497760 GGGGGCCCAGGAGTGGGAGAGGG + Intronic
1087046819 11:93850067-93850089 GCGGCCACAGGGCTGGGAGCCGG + Intronic
1087077742 11:94141444-94141466 GTGGGCACTGGGGAGGGAGGGGG - Intronic
1088579139 11:111299363-111299385 GTGGCCGCAGGAGTCCGGGGCGG - Exonic
1089017185 11:115175533-115175555 GTTGCCACAGGAGGGGAAGTAGG - Exonic
1089304720 11:117519273-117519295 GGGGCCTCAGGAGGGGGTGGTGG + Intronic
1089350586 11:117819606-117819628 GTGGCCCCAAGAGTGGAAAGAGG + Intronic
1089633684 11:119798845-119798867 GTGACCACAGGAGAGGGATATGG - Intergenic
1089705791 11:120276542-120276564 GTGGACACAGGATTTGGGGGTGG + Intronic
1089977553 11:122745702-122745724 GTGGTCACAGGAGTGAGAGAGGG - Intronic
1090445647 11:126762599-126762621 CTGGTCACAGCAGTGGGAGCTGG + Intronic
1090470631 11:126978073-126978095 GTGGCCACAGGCTTGGAAGGAGG - Intronic
1090917083 11:131174944-131174966 GAGGGCACAGGAGAGGAAGGAGG - Intergenic
1091224790 11:133950879-133950901 GTGCCCAGAGGAGGAGGAGGAGG - Intronic
1091784451 12:3234417-3234439 GTGGCCGGAGCAGAGGGAGGGGG - Intronic
1091930602 12:4392451-4392473 GTGTCCACAGGGAAGGGAGGAGG - Intergenic
1093184642 12:16005970-16005992 ATGGCCACAGGAATGGGGAGGGG - Intronic
1093736543 12:22625872-22625894 GTGGACTGGGGAGTGGGAGGAGG - Intronic
1093757699 12:22870886-22870908 GGGGCCACTGGAGTGGGGAGAGG + Intergenic
1095051062 12:37554655-37554677 GTGGGGAGAGGAGTGGGTGGAGG + Intergenic
1095680390 12:44967860-44967882 CTGGCAACAGGTTTGGGAGGTGG + Intergenic
1096148168 12:49293424-49293446 GTTGCCAGGGGAGTGGGAAGCGG - Intronic
1096843302 12:54391634-54391656 GTGGGCAGGGGAGTGGGGGGGGG + Intergenic
1096995073 12:55833276-55833298 GTGGCCACCGAAGTGTGAGCAGG - Intergenic
1097188738 12:57209536-57209558 GTGGCCACAGGAGGAGGAACCGG + Intronic
1097785593 12:63755412-63755434 TGGGCCATAGAAGTGGGAGGAGG - Intergenic
1097800188 12:63905289-63905311 TTGGGCACAGGAGTGGGTAGTGG + Intronic
1098878846 12:75895680-75895702 GTGGCCACAGTCGTGTAAGGGGG - Intergenic
1099844116 12:88006879-88006901 GTGGTGAAAGGAGTGGGTGGTGG + Intronic
1099904323 12:88754023-88754045 GAGGCCACAGGAGGAGGATGGGG + Intergenic
1101761048 12:107659453-107659475 GAGGATACAGAAGTGGGAGGAGG - Exonic
1102240206 12:111320432-111320454 GTAGCCAGAGGAGGAGGAGGAGG - Exonic
1102532779 12:113558915-113558937 GTGGCCGGAGGAGTGGGGAGGGG + Intergenic
1102811965 12:115832171-115832193 GTTGCCAGAGGGTTGGGAGGAGG - Intergenic
1103330401 12:120150129-120150151 GTTTCCAGAGGGGTGGGAGGTGG - Intronic
1103723206 12:122985663-122985685 GTGGCCAGTGGATGGGGAGGTGG + Exonic
1103739011 12:123078710-123078732 CTGGGCACAGCAGGGGGAGGGGG + Intronic
1103907529 12:124335230-124335252 GCGGCCGCAGGTGTGGGAGGTGG + Exonic
1103908669 12:124340128-124340150 GTGGGCATGGGAGTGGGAGGCGG + Exonic
1103944794 12:124520034-124520056 GTGGCCACTGGACTGGCAGGGGG + Intronic
1103954376 12:124568006-124568028 GTGGCCGCTGGATGGGGAGGGGG + Intergenic
1105726238 13:23164973-23164995 AGGGCCACAGGAGAGGGAGAGGG - Intergenic
1106165917 13:27246261-27246283 GTGGCCACAGAGATGGGAAGAGG + Intergenic
1106170071 13:27281037-27281059 GAGGGGGCAGGAGTGGGAGGGGG - Intergenic
1106207593 13:27614367-27614389 GAGGCCACAGGAGTGGTCAGTGG - Intronic
1106253596 13:28002170-28002192 GTGCCACCAGGAGTGGGAAGAGG + Intergenic
1106384403 13:29270043-29270065 GGGGCTACAGGAAGGGGAGGTGG + Intronic
1106668455 13:31878545-31878567 GTGGCCAGAAGAGAGAGAGGAGG + Intergenic
1107075113 13:36315246-36315268 GTGGGGAAAGGAGTGGGAGAGGG + Intronic
1107229501 13:38091148-38091170 GTGGGCAGAGGAGAGGGTGGAGG + Intergenic
1107798499 13:44080044-44080066 ATGGCCTCAAGAGTGGGATGAGG - Intergenic
1107837402 13:44422995-44423017 GTAGCCAGAGGCGAGGGAGGAGG - Intergenic
1107938364 13:45363667-45363689 GAGGCCACAGGAGAGAGATGAGG - Intergenic
1108007769 13:45969218-45969240 GTAGCCACAGGCGGTGGAGGAGG + Exonic
1108172099 13:47752094-47752116 GTAGCCACAGGATGGAGAGGAGG - Intergenic
1111243116 13:85501786-85501808 GGGGCCACAGGAGTGGTTGGTGG - Intergenic
1111808615 13:93069291-93069313 GCTGTCCCAGGAGTGGGAGGTGG + Intergenic
1112008531 13:95274737-95274759 GTGGCCACAGGAGGAGGCAGAGG - Intronic
1112054528 13:95677570-95677592 CGGGCCGCAGGAGTCGGAGGAGG + Intronic
1113797181 13:113065368-113065390 GTGGCTTCAGGAGTGGGACCAGG + Intronic
1114550865 14:23532158-23532180 GTGGCCATAGGAGGGAAAGGGGG - Intronic
1114557665 14:23571227-23571249 TTGGCCTGAGGAGTGGGGGGGGG - Exonic
1114631766 14:24163868-24163890 GTGTCCGCAGGAGGAGGAGGGGG + Exonic
1114697772 14:24643738-24643760 GTGCCCACAGGTGTAGGAGCTGG + Intergenic
1117951663 14:61089335-61089357 GCTGCCACAGGAGGAGGAGGAGG - Intergenic
1118321411 14:64755343-64755365 GTGGCCTTAGGAATGGGAAGGGG + Intronic
1119065875 14:71525942-71525964 GCGTACACAGGAGTGGCAGGAGG - Intronic
1119173803 14:72554658-72554680 GTGGCTTCAGGAGTGGAATGAGG - Intronic
1120727651 14:87962921-87962943 GTGGACAGAGGCATGGGAGGAGG - Intronic
1120817123 14:88872799-88872821 GTGGGCGCAGGTGTGGCAGGGGG - Intronic
1121828546 14:97030324-97030346 GTGTAGACAGGATTGGGAGGAGG + Intergenic
1122005112 14:98697017-98697039 GGGGCCACAGGTGGGGGTGGGGG + Intergenic
1122088070 14:99320701-99320723 GAGGCCACACGGGTGGGTGGAGG - Intergenic
1122575417 14:102738806-102738828 GTGGCCAGAGGAATGAGGGGTGG - Intergenic
1123063996 14:105606966-105606988 AGGGCCACAGGAGTGGCAGCTGG - Intergenic
1123073310 14:105652609-105652631 AGGGCCACAGGAGTGGCAGCTGG - Intergenic
1123093235 14:105751376-105751398 GGGGCCACAGGAGTGGCAGCTGG - Intergenic
1123627577 15:22238376-22238398 GTGGCCACAGCAAAGAGAGGAGG + Intergenic
1124007848 15:25809042-25809064 GGGGCCACAGGGTTGGGAGAGGG + Intronic
1124121647 15:26893702-26893724 GGGGGCACAGGAGTGGGCGAGGG + Intronic
1124656659 15:31514740-31514762 GTGGCATCTGGAGTGGGTGGGGG - Intronic
1124950337 15:34313010-34313032 GAGGCCAGAGGAGAGGGAGAGGG - Intronic
1125753348 15:42045363-42045385 GGGGCCCCTGGAGTGGGCGGAGG + Intronic
1126099550 15:45111359-45111381 GAGGCCACAGGGGCGGGACGGGG - Intronic
1126103977 15:45135678-45135700 GAGGCCACAGGGGCGGGACGGGG + Intronic
1127698558 15:61475009-61475031 GAAGCCACAGGAATGGGAAGTGG + Intergenic
1127963460 15:63907149-63907171 GAAGGCCCAGGAGTGGGAGGGGG - Exonic
1128033146 15:64499597-64499619 GTGGCCACAGCATTGGGAGCCGG - Exonic
1128449874 15:67799319-67799341 GAGGGCACAGGGGTGAGAGGAGG - Intronic
1128739244 15:70072359-70072381 GTGGCCACCGCAGGGGTAGGAGG + Intronic
1129108452 15:73324056-73324078 GGGGCCACAGGCGGGGCAGGTGG - Intronic
1129219440 15:74122899-74122921 GAGGCCACAGGAGGTGGTGGGGG + Intronic
1129222302 15:74138114-74138136 CTGGCCACAGGAGTGGAGTGGGG + Intronic
1129265752 15:74392317-74392339 GTGGCCCCAGGAGGAGGAAGTGG - Intergenic
1129456831 15:75680564-75680586 GAGCCCCCAGGAGTGGGAGTGGG + Intronic
1129683601 15:77672022-77672044 TTGGCCTCAGGAGGAGGAGGAGG - Intronic
1130274468 15:82469264-82469286 GTGTCCCCAGATGTGGGAGGGGG + Intergenic
1130421251 15:83749163-83749185 GTGTCCACAGGTGTGAGAGAAGG + Intronic
1130466815 15:84196638-84196660 GTGTCCCCAGACGTGGGAGGGGG + Intergenic
1130497449 15:84476898-84476920 GTGTCCCCAGACGTGGGAGGGGG - Intergenic
1130589110 15:85201231-85201253 GTGTCCCCAGATGTGGGAGGGGG + Intergenic
1130719248 15:86370760-86370782 GTGGAAAGAGGAGTGGAAGGAGG - Intronic
1132478335 16:153576-153598 GTGGCCAGAGGAGACGGTGGAGG + Intronic
1132480420 16:164166-164188 GTGGCCAGAGGAGACGGTGGAGG + Intronic
1132496165 16:264467-264489 GTGGCCACAGAACTGGGGGCTGG + Intronic
1132556455 16:574875-574897 CGGGCTGCAGGAGTGGGAGGGGG - Intronic
1132599971 16:769007-769029 GTGGCCCCAGGAGCCGGTGGTGG + Intergenic
1132694469 16:1195724-1195746 CTGGGCACAGGTGAGGGAGGTGG + Intronic
1132731439 16:1364441-1364463 GAGGGCACACGAGTGGGAAGCGG - Intronic
1132833491 16:1941230-1941252 GAGGCCACAGGGGTGGGGGAGGG - Intronic
1133050309 16:3113689-3113711 GTGGCCACAGGAGATGGAAGAGG + Intronic
1133055106 16:3141888-3141910 CTGGAAACGGGAGTGGGAGGGGG - Exonic
1133277976 16:4649444-4649466 GGGGCCCCAGGAGTGGGGAGAGG - Intronic
1133379971 16:5321706-5321728 GTAGCCCCAGGTGTGGAAGGAGG - Intergenic
1133916594 16:10114499-10114521 GTAAACACAGGAGAGGGAGGAGG + Intronic
1134134709 16:11670791-11670813 GTGGCCTCTGGAGTGGGATCAGG + Intronic
1135041322 16:19119372-19119394 GTAGAAACAGGGGTGGGAGGTGG + Exonic
1136233831 16:28902933-28902955 GTGGCCTCAGGGGAGGGTGGTGG - Intronic
1136729988 16:32401397-32401419 GTGCCGACAGGAGTGGGATGGGG + Intergenic
1137547669 16:49415688-49415710 GTGGCCAGAGCAGAGGGAGCAGG + Intergenic
1138380522 16:56598628-56598650 GTGGCCCCAGGGCTGGGCGGTGG - Intergenic
1138589048 16:57989726-57989748 GTGGCCAGAGGCGGGGGATGGGG - Intergenic
1139662015 16:68427716-68427738 TGGGTCACAGGAGTGGGATGGGG + Intronic
1140221535 16:73047898-73047920 CTGGCCCCAGGACTCGGAGGTGG + Exonic
1140507474 16:75482826-75482848 GAGGCAACAGGGGTGGGTGGAGG + Intronic
1141042167 16:80681975-80681997 GTGGCCAAATGTGTGGGGGGTGG - Intronic
1141469402 16:84228466-84228488 GTGGCTAAAGGAGTGGGCAGAGG - Intronic
1141628518 16:85274542-85274564 ATGGCCTCAGGAGTGTGAAGAGG + Intergenic
1141739917 16:85884282-85884304 GTCGCCCCAGGACTGAGAGGAGG - Intergenic
1142196255 16:88740592-88740614 GTGGCGACAGGACAGGCAGGAGG + Intronic
1142431243 16:90029087-90029109 GTCTCCACAGGAATGGGAAGCGG - Exonic
1202996405 16_KI270728v1_random:115908-115930 GTGCCGGCAGGAGTGGGATGGGG - Intergenic
1203023092 16_KI270728v1_random:428250-428272 GTGCCGGCAGGAGTGGGATGGGG - Intergenic
1142480764 17:216855-216877 ATGGTCACAGGAGAGGGGGGTGG + Intronic
1142532209 17:587985-588007 GTAACAACAGGGGTGGGAGGAGG - Intronic
1142682905 17:1561055-1561077 GAAGCCCCAGGAGTGGGAGATGG - Intronic
1142761255 17:2043016-2043038 GTGGCCACCAGAGTGGGTGAGGG - Exonic
1142928540 17:3262066-3262088 GTGACCTCTGGGGTGGGAGGAGG + Intergenic
1143101224 17:4505867-4505889 GTGGCTCTAGGAGTGGGAGTGGG - Intronic
1143949719 17:10623013-10623035 GTGGACACAGGAGAAGGAGCGGG + Intergenic
1143996524 17:11011262-11011284 GGGGCCAGAGAAGTGGGTGGGGG + Intergenic
1144740894 17:17581698-17581720 CTGGGCACAGGAGGGAGAGGGGG - Intronic
1144887911 17:18476604-18476626 TTGAGCACAGGAGAGGGAGGAGG + Intergenic
1145144297 17:20467697-20467719 TTGAGCACAGGAGAGGGAGGAGG - Intergenic
1145175748 17:20699100-20699122 TTGAGCACAGGAGAGGGAGGAGG - Intergenic
1145371674 17:22311479-22311501 GTGGTGAGAGGAGTGGGTGGAGG + Intergenic
1145791566 17:27631015-27631037 TTGAGCACAGGAGAGGGAGGAGG + Exonic
1145882754 17:28364221-28364243 TGGGCCACAGGAGTCAGAGGAGG + Intergenic
1145913680 17:28557634-28557656 GTGGCCCAAGGATTGTGAGGGGG - Intronic
1146317969 17:31823553-31823575 GTGACCACAGGACTGTGGGGAGG + Intergenic
1146457942 17:33021708-33021730 GGGGCCTCAGGAGTGGGCAGGGG - Intronic
1147188413 17:38725307-38725329 GTGCCCTCAGGAGAGGGAGAGGG - Intronic
1147523054 17:41193050-41193072 GTGGCCACAGTTGTGGGGTGGGG - Intronic
1147536920 17:41327458-41327480 GTGCACACAGGAGGGGGATGTGG + Intergenic
1147895258 17:43746407-43746429 CAGGCCAGAGGAGTTGGAGGAGG + Intergenic
1148082317 17:44974189-44974211 ATGGCCACTGGAGGTGGAGGAGG + Intergenic
1148104968 17:45114220-45114242 GGGGCCACAGGAATGAGAGCAGG - Intronic
1148676889 17:49451020-49451042 GGGGGCACAGGCCTGGGAGGGGG - Intronic
1148805668 17:50262649-50262671 GTGGCCAGAGGGGTGGGAGGCGG + Intergenic
1148836813 17:50469793-50469815 GTGGCCCCAGGACTGTGAGGAGG + Intronic
1150484101 17:65532241-65532263 GTGGCCACAGCAGCTGAAGGAGG + Intronic
1150603993 17:66675739-66675761 GTGGCCGCAGGAGAGGGGGTTGG - Intronic
1151169933 17:72237397-72237419 GGGGGCACAGGTGTGGGAAGGGG + Intergenic
1151305939 17:73262697-73262719 GGGGCCAGAGCAGGGGGAGGGGG - Intergenic
1151420051 17:73991137-73991159 GGAGCAACAGGGGTGGGAGGTGG + Intergenic
1151434840 17:74088763-74088785 CTGGGAGCAGGAGTGGGAGGTGG - Intergenic
1151741266 17:75983821-75983843 GGGGCCGCAGGAGTGGTGGGTGG + Intronic
1151791291 17:76307539-76307561 GTGGCCGGAGGAGCAGGAGGTGG - Exonic
1151917399 17:77128311-77128333 GAGGCCACAGGGGTGGGCGGGGG + Intronic
1152094216 17:78263708-78263730 GTGGCTGCAGAAGTGGGAGGAGG - Intergenic
1152148715 17:78585401-78585423 GTGGCCCTAGGTGTGAGAGGCGG - Intergenic
1152222918 17:79078998-79079020 GTGGCTACAGGAGTGGCAGCTGG + Intronic
1152534485 17:80942581-80942603 GAGGACAGAGGACTGGGAGGAGG - Intronic
1152741605 17:82020850-82020872 GTGAACACAGGAGTGGTGGGTGG + Intronic
1153228017 18:2912541-2912563 GTGGCCAAAGGTGAGGAAGGTGG - Intronic
1153672831 18:7428794-7428816 GTGACCCAAGGAGTGGGATGGGG - Intergenic
1153997411 18:10454453-10454475 GGGGCGCCCGGAGTGGGAGGAGG + Intergenic
1156470957 18:37376979-37377001 GTGGGCACAGGGGAGGGTGGAGG + Intronic
1156528791 18:37795152-37795174 GATGCCACAGGAGAGGGAGGGGG + Intergenic
1157095286 18:44680822-44680844 GTGGACTCGGGAGGGGGAGGGGG + Intronic
1157208252 18:45718890-45718912 GAGGCCAGGGGAATGGGAGGAGG + Intergenic
1157273609 18:46294756-46294778 TTGGCTCCAGGAGTGGGGGGTGG - Intergenic
1157394979 18:47333870-47333892 GTGGCCAAGGGAGTGGGTGCAGG - Intergenic
1158609221 18:58923580-58923602 GCAGCCATGGGAGTGGGAGGTGG + Intronic
1159133520 18:64309087-64309109 ATGACCACAGGTGAGGGAGGTGG - Intergenic
1159923772 18:74248758-74248780 GTGGGGACAGGTGTGTGAGGCGG + Intergenic
1160389292 18:78518132-78518154 GTGGCGCCAGGAGCTGGAGGAGG + Intergenic
1160427855 18:78790601-78790623 GAGGCCACAGGAGAGGGTGGAGG + Intergenic
1160845508 19:1164380-1164402 GTGGAGACAGGAGGAGGAGGAGG + Intronic
1160845539 19:1164496-1164518 GTGGAGACAGGAGGAGGAGGAGG + Intronic
1160845566 19:1164596-1164618 GTGGAGACAGGAGGAGGAGGAGG + Intronic
1160845617 19:1164787-1164809 GTGGAGACAGGAGGAGGAGGAGG + Intronic
1161021491 19:2013598-2013620 GTGGTCACTGAAGTGGGAGGTGG + Intronic
1161266683 19:3367484-3367506 GAGGCTACGGGAGGGGGAGGGGG - Intronic
1161324353 19:3656193-3656215 GTGGCCACAGGAGGAAGAGAGGG + Intronic
1161520530 19:4721171-4721193 CTTGGCAGAGGAGTGGGAGGGGG - Intronic
1161848263 19:6724787-6724809 GTGTCCAGAGGTTTGGGAGGGGG + Intronic
1162016410 19:7848898-7848920 CTGGCCACGGGAGCGGGAAGCGG - Intronic
1162021590 19:7870638-7870660 GTGGCCAAAGGAGACAGAGGGGG + Exonic
1162021624 19:7870731-7870753 GTGGCCAAAGGAGACAGAGGGGG + Exonic
1162054019 19:8052261-8052283 GTGGCCACAGGATGGGGGGAGGG - Intronic
1162397260 19:10424336-10424358 GTGGCCCCAGGAGCAGGTGGAGG + Intronic
1162905307 19:13819503-13819525 GTGGCCAAGGCAGTGGCAGGGGG + Intronic
1163191121 19:15677495-15677517 GTGGGTAAAGGAATGGGAGGAGG - Intronic
1163203821 19:15787760-15787782 GTGGCAAGAGTACTGGGAGGTGG + Intergenic
1163527580 19:17830860-17830882 GGGGCCAGAGCCGTGGGAGGGGG + Intronic
1164179309 19:22806051-22806073 GTAGGCACAGGGGTGGGATGGGG + Intergenic
1164846775 19:31439209-31439231 GTGGCCACATGGGAGGGACGTGG + Intergenic
1164925207 19:32124805-32124827 CTGGCCACCAGTGTGGGAGGGGG - Intergenic
1165312998 19:35039914-35039936 GGAGCCACTGGGGTGGGAGGGGG + Intronic
1167374140 19:49102264-49102286 GGGGCGACTGGGGTGGGAGGAGG - Intronic
1167521722 19:49959475-49959497 GGGGCCCCAGGGGTGGGACGAGG + Exonic
1167523661 19:49971247-49971269 GGGGCCCCAGGGGTGGGACGAGG - Intergenic
1167641924 19:50686990-50687012 GTGGGCACAGGACTGGCGGGAGG - Intronic
1167772190 19:51528321-51528343 GTGGTCACATTAGTGGAAGGTGG - Intronic
925122119 2:1427460-1427482 GTGGCCCCATGAGTGTGTGGGGG + Intronic
925148341 2:1598229-1598251 ACTGCCCCAGGAGTGGGAGGAGG + Intergenic
926811094 2:16756150-16756172 GTGGCCACAGGATAGAAAGGAGG - Intergenic
926904269 2:17791339-17791361 GTGGTGGTAGGAGTGGGAGGTGG - Intronic
926926782 2:17995622-17995644 GTGGCCACTGAAGTGGGAGTAGG - Intronic
927653127 2:24924229-24924251 TTGGCCACTGGTGTGGGAGGGGG + Intergenic
927708259 2:25310353-25310375 GTTGCCGCAGCAGAGGGAGGGGG - Intronic
928100808 2:28436537-28436559 GAGGCCCCAGGAGTGGGCAGAGG + Intergenic
928388431 2:30889354-30889376 GTCCCCACAGCAATGGGAGGAGG - Intergenic
928446984 2:31341258-31341280 GTGGCCCCAGGAGGGGAATGGGG + Intronic
929798812 2:45082327-45082349 GTGGCTGCAGGAATGGGATGGGG + Intergenic
929884371 2:45865288-45865310 GTGGCAAAAGGAGGAGGAGGAGG + Intronic
931735199 2:65187285-65187307 GTGATCACGGGAGTGGGTGGTGG + Intergenic
932522281 2:72427160-72427182 GTGGCCACAGCAGTGGGGCCTGG + Intronic
934186298 2:89679451-89679473 GTGCCGGCAGGAGTGGGATGGGG + Intergenic
934614689 2:95763871-95763893 GTGGCCATGGGAGTTTGAGGAGG + Intergenic
935163471 2:100549210-100549232 GCGGGCACAGGAATGGGAGGAGG + Intergenic
936657596 2:114506174-114506196 ATGGGCACAGGATTGGGAGTGGG - Intronic
937175952 2:119935451-119935473 GTGGGCCCAAGAGTGGTAGGTGG + Intronic
937895612 2:126974817-126974839 CTGGCCACTGAAGCGGGAGGAGG + Intergenic
938389191 2:130891823-130891845 TTTGACACAGGAGTTGGAGGAGG + Intronic
938962530 2:136356192-136356214 CTGGGCACAGGAGAGGGAGGAGG + Intergenic
940109332 2:150134240-150134262 ATGGCCTGGGGAGTGGGAGGAGG - Intergenic
940285247 2:152027249-152027271 GTGGCCAGAAAAATGGGAGGAGG - Intronic
940509404 2:154593511-154593533 GTGGCCACAGGATTTGTTGGCGG - Intergenic
940787849 2:158001416-158001438 GTGGCCCAAGGAGAGGGAGCTGG + Intronic
940875453 2:158893210-158893232 GCCGGCTCAGGAGTGGGAGGAGG + Intergenic
941918621 2:170828384-170828406 GTGGGGACAGCAGAGGGAGGAGG - Intronic
941934872 2:170974470-170974492 GTTGCCACAGAAGGGGGAGCGGG + Intergenic
942447580 2:176088324-176088346 ATTGCGACGGGAGTGGGAGGAGG - Intergenic
942524289 2:176837145-176837167 GAGGCCCCAGAAGTGGGAGATGG + Intergenic
945770811 2:214040005-214040027 GGGGCCACAGGAGTGGTTAGTGG + Intronic
946323669 2:218970639-218970661 GGGGATATAGGAGTGGGAGGTGG + Intergenic
947370474 2:229440461-229440483 GTGGCCACAGGAGAGGGCAGAGG - Intronic
947533504 2:230927287-230927309 ATACCCACAGGAGAGGGAGGTGG - Intronic
947572163 2:231244772-231244794 GTGGCCACAGCAATGGCAGCGGG - Intronic
948005399 2:234603955-234603977 GTGGCCACAGTGGTGGTGGGAGG + Intergenic
948124745 2:235556357-235556379 GTGGCTACAGAAGAGAGAGGAGG + Intronic
948379565 2:237542886-237542908 GTGGGCACAGTAGTGAGTGGGGG + Intronic
948379937 2:237544280-237544302 GTGGGCACAGTAGTGAGTGGGGG + Intronic
948380110 2:237544922-237544944 GTGGGCACAGTAGTGAGTGGGGG + Intronic
948566452 2:238890235-238890257 GTGGCCACAAGCATGGCAGGTGG - Intronic
948830771 2:240597304-240597326 ATGGACTCAGGAGTGAGAGGAGG + Intronic
948850306 2:240702397-240702419 GAGGTCAGAGGGGTGGGAGGAGG - Intergenic
948853881 2:240721202-240721224 GGGGCCACAGGGGCTGGAGGGGG - Intronic
948858825 2:240743154-240743176 GTGGCCTCTGGGGTGGGAGCTGG - Intronic
948903764 2:240968338-240968360 GAGGCCACAGGGCCGGGAGGTGG + Intronic
1168854172 20:997269-997291 CCGTCCACAGGAGAGGGAGGTGG + Intronic
1169491270 20:6073210-6073232 GGGGTGACAGGAGTGGAAGGGGG + Intergenic
1169705671 20:8501506-8501528 GTGGCCACAGGAGGTGGGAGAGG - Intronic
1170266897 20:14477075-14477097 GTGTCCAGAGAATTGGGAGGCGG + Intronic
1170291180 20:14770321-14770343 GGGACTACAGGAGAGGGAGGTGG + Intronic
1170532995 20:17313379-17313401 GGAGCAGCAGGAGTGGGAGGGGG - Intronic
1170614319 20:17936762-17936784 GTCGCCATAGGAGGGGGCGGGGG - Intergenic
1170708459 20:18767252-18767274 GCTGCCACAGGTGTGAGAGGAGG + Intergenic
1170769188 20:19317549-19317571 GGGGTCACAGGAGTGAGGGGTGG - Intronic
1172362782 20:34325788-34325810 GTGGCCATTGCAGTGGGTGGCGG - Intergenic
1172786536 20:37472400-37472422 GTGGCCTCTGGGGAGGGAGGGGG + Intergenic
1173253525 20:41377000-41377022 GTGGTCAGAGGAGCTGGAGGAGG + Intergenic
1174022351 20:47541320-47541342 GTGGGGAAAGGAGGGGGAGGGGG - Intronic
1174067365 20:47875169-47875191 GTGGACACAGGGGTGAGTGGTGG + Intergenic
1174128974 20:48328468-48328490 GTGGGAAGAGGAGTGGGAGCAGG + Intergenic
1174156936 20:48521705-48521727 GTGGACACAGGAGTGAGTGGTGG - Intergenic
1175075439 20:56368488-56368510 CTGGCCACAGGAGTGGAGTGGGG - Exonic
1175204498 20:57301429-57301451 GTGGGGACAGGAGCGGGAGAAGG - Intergenic
1175257972 20:57658294-57658316 GTGGGCGCGGGAGTGTGAGGAGG - Intronic
1175379669 20:58554043-58554065 TCGGTCACAGGAGTGGGATGAGG + Intergenic
1175488217 20:59360721-59360743 GGGGCAATAGGAGTGGAAGGAGG - Intergenic
1175955050 20:62604906-62604928 GTGGCCACACGAGTGACTGGAGG - Intergenic
1176058566 20:63161625-63161647 ATGGCCACTGGAGGCGGAGGAGG - Intergenic
1176085345 20:63293254-63293276 GGGGTCCCAGGAGTAGGAGGAGG + Exonic
1176092535 20:63325514-63325536 GGGGCCACAGGGGTTGGTGGGGG + Intronic
1176101780 20:63367734-63367756 GTGTCCTCTGGATTGGGAGGGGG - Intronic
1176149968 20:63585772-63585794 GAGGACACAGGAGTGGGGAGTGG - Intergenic
1176169159 20:63689317-63689339 CTGGCCACAAGAGTTGGAGGTGG + Intronic
1176381022 21:6111946-6111968 GGGGCGACAGGCGTGGGAGCAGG + Intronic
1177912414 21:27049350-27049372 GTGGGCACAGGCCTGGGAGATGG - Intergenic
1179042452 21:37816028-37816050 GTGGCCACAGGAAAGGGTGTTGG + Intronic
1179411006 21:41163269-41163291 GTGGCGATGGGCGTGGGAGGGGG - Intergenic
1179481589 21:41682005-41682027 GGGGCCCCAGCTGTGGGAGGTGG - Intergenic
1179622889 21:42630439-42630461 GTGGCCACAGGTGTGGTGGAGGG + Intergenic
1179644251 21:42765943-42765965 GTGGCCAGAGAAGGGGTAGGGGG + Intronic
1179720387 21:43313227-43313249 GTGGGCACTGGGGTGGGGGGTGG - Intergenic
1179742450 21:43426294-43426316 GGGGCGACAGGCGTGGGAGCAGG - Intronic
1180032288 21:45220726-45220748 ATGGCCACAGAAGTGCGTGGTGG - Intronic
1180035275 21:45245090-45245112 GAGGACACAGAAGTGGCAGGTGG + Intergenic
1180051858 21:45335227-45335249 GGGGGCACAGGCCTGGGAGGGGG - Intergenic
1180051957 21:45335471-45335493 GGGGGCACAGGTCTGGGAGGGGG - Intergenic
1180060377 21:45381988-45382010 GGGGCCACAGCAGCGTGAGGGGG - Intergenic
1180160821 21:45997986-45998008 GTGGCCCCAGGGGAGGGAGCCGG + Intronic
1180168163 21:46040702-46040724 GTGGAAACAGGCGTGGGAGGAGG - Intergenic
1180956947 22:19745492-19745514 TAGGCCACAGGGGTGGGAGCTGG + Intergenic
1181811616 22:25406639-25406661 GTGGTCAATGGACTGGGAGGAGG + Intergenic
1183102881 22:35594546-35594568 GTGGCCTCAGGGGTGGACGGTGG - Intergenic
1183178948 22:36245533-36245555 GAGGACACATGAGTGGGAGAGGG + Intergenic
1183316829 22:37141625-37141647 GTGGGCACTGGAGCAGGAGGAGG - Intronic
1183352666 22:37342804-37342826 GTGGGCACAGGAAAGGGAAGCGG + Intergenic
1183418427 22:37696309-37696331 GTGGCGACTGGGATGGGAGGAGG - Intronic
1183516979 22:38272569-38272591 GCGGCCCCGGGAGAGGGAGGCGG - Intronic
1183529821 22:38347319-38347341 GTGGCCACAGGAGTGGGAGGGGG + Intronic
1183666442 22:39248959-39248981 GTGGCCACAGCCGTGGGGGATGG + Intergenic
1183741535 22:39671092-39671114 CTGGGCACTGCAGTGGGAGGAGG + Intronic
1183967001 22:41447890-41447912 GTGGCCAGAGCCGGGGGAGGGGG - Intergenic
1184784810 22:46666563-46666585 GTGGCCAGCGGTGTGGGAGAGGG - Intronic
1184959216 22:47917073-47917095 GCGGACAGAGGACTGGGAGGAGG - Intergenic
1185150514 22:49161264-49161286 GGGGCCACAGGTGTTGCAGGGGG - Intergenic
1185267005 22:49909642-49909664 GAGGCCACAAGAGTGGAGGGCGG - Intronic
1185288605 22:50013274-50013296 GTGCCCTCCGGAGTGGGGGGGGG - Intergenic
1185333665 22:50262272-50262294 GTGGCCACAGGAGTGGGGTTGGG - Intergenic
949790537 3:7787173-7787195 GTGCCCAGAGGAATGGAAGGAGG - Intergenic
949881360 3:8663548-8663570 GGGGCCACAGCAGTGGGGCGGGG + Intronic
950477797 3:13224760-13224782 GTGGTCACGGGAGTTGGCGGGGG - Intergenic
951912226 3:27763017-27763039 GTGGCCACAGCTGTAGGAGAAGG + Intergenic
953010330 3:39019268-39019290 GGGGTCACAGGAGTGGTTGGTGG - Intergenic
953700269 3:45190283-45190305 GGGGCCAAAGGGGTGGGCGGAGG + Intergenic
953823482 3:46230389-46230411 GTGGCCTGAGGGGTGGGTGGTGG - Intronic
954003810 3:47577586-47577608 GTAGCCTCAGGAATGGCAGGGGG + Exonic
954125161 3:48523904-48523926 GTAGCTGCAGGAGTGGAAGGTGG - Intronic
954536223 3:51361365-51361387 TTGGCCACAGATGTGGAAGGAGG + Intronic
954800643 3:53185195-53185217 GGGACCACAGGAGTGGGTGTTGG + Intronic
955871317 3:63441680-63441702 GTGGCCACAGGGGAGTGGGGAGG + Intronic
955977141 3:64490043-64490065 GGGGCCACAGAAGTGGGGTGGGG - Intergenic
958550876 3:95610161-95610183 GGGGCCACAGGAGGGGTTGGTGG - Intergenic
958839856 3:99191031-99191053 GTGGCCACTGCCATGGGAGGAGG - Intergenic
960005537 3:112777423-112777445 CTGTACGCAGGAGTGGGAGGAGG - Intronic
960235637 3:115279102-115279124 GTGGCCGCAGTAGTGGCAAGAGG + Intergenic
961622958 3:128239181-128239203 GGGTCCACAGGAGTTGGGGGAGG + Intronic
961942729 3:130654961-130654983 GGGGCCACAGGAGTGGTTGGTGG + Intronic
962373944 3:134844841-134844863 GTGGCTAGAGCAGAGGGAGGAGG - Intronic
962414060 3:135166748-135166770 CTGCCCACAGGAGTGAGTGGTGG + Intronic
962445581 3:135461099-135461121 GTGGCAAGAGGAGTGGGAGAAGG + Intergenic
964321316 3:155500658-155500680 GGGGCCTCAGGAGTGTGAGTAGG + Intronic
965783033 3:172307825-172307847 TTGGGCAAAGGGGTGGGAGGAGG + Intronic
966020504 3:175203221-175203243 GTGGCCAGAGGAGTGGGGTGAGG - Intronic
967142334 3:186571203-186571225 TTGCCCAGAGGAGTGGGAGTTGG + Intronic
967619017 3:191609170-191609192 GTGTCCACAGGAGTGAGAAGAGG - Intergenic
967768778 3:193311574-193311596 CTGGCCACAGGGGTGAGAGAAGG + Intronic
968649078 4:1753345-1753367 GTCTCCACAGGAGTGGGTGCGGG - Intergenic
968809528 4:2793536-2793558 GGGGGCTCAGGGGTGGGAGGCGG + Intronic
969069574 4:4524443-4524465 GTGGCAACAGGAGTGGATTGAGG + Intronic
969246108 4:5933885-5933907 TTGGGGAGAGGAGTGGGAGGAGG + Intronic
969533548 4:7742099-7742121 GTGGCCTCTGGAGTGGGGAGGGG - Exonic
971201579 4:24514022-24514044 GTTGCCACAGCAGGGGGAGAGGG + Intergenic
972840204 4:42921889-42921911 GTGGACACAGGAAGGGGAGGAGG - Intronic
973590524 4:52436442-52436464 GGGGACTCAGGAGTGGGTGGTGG - Intergenic
973880832 4:55269623-55269645 GTAGACCCAGGAGAGGGAGGAGG + Intergenic
975778413 4:77815421-77815443 AGAGTCACAGGAGTGGGAGGGGG - Intronic
976478374 4:85510773-85510795 GGGGCTAGAGGAGGGGGAGGAGG - Intronic
976786432 4:88826699-88826721 GTGGGAACAGGAGTGGTAGGTGG - Intronic
978301247 4:107270957-107270979 GTGGCCACAGAAGTGGTTGTGGG - Intronic
978523536 4:109641048-109641070 GAGGCCCCAGGAGAGGGAGATGG + Intronic
978961798 4:114688580-114688602 GTGACGACAGAAGTGGGAAGAGG - Intergenic
979140106 4:117162204-117162226 GTGGGCACAGGTCTGGGGGGTGG - Intergenic
979965633 4:127073720-127073742 GTGGCCAAGGGAGTGGCATGTGG - Intergenic
980187060 4:129475452-129475474 GTGGCCACTGGGCTGGGCGGTGG + Intergenic
982174685 4:152694608-152694630 GGGGCCAGGGGAGTGGGAAGGGG - Intronic
982213050 4:153056478-153056500 GTGGCTATAGGAGTGGGGGTGGG + Intergenic
984257053 4:177401644-177401666 GTAGAAACAGGAGAGGGAGGAGG - Intergenic
984769603 4:183425943-183425965 GAGGACACAGGAGGGGGAGGGGG - Intergenic
984865979 4:184281266-184281288 AGGGGCACAGGAGTGGGAGAAGG - Intergenic
985574296 5:666415-666437 GTGGCCCCGGGAGGAGGAGGTGG - Intronic
985826195 5:2193306-2193328 GTACCCCCAGGAGTGGGATGTGG - Intergenic
985890463 5:2711626-2711648 GTGGTCACAGGACACGGAGGCGG - Intergenic
986095566 5:4550470-4550492 GGAGCCACAGGGTTGGGAGGAGG + Intergenic
986597813 5:9441712-9441734 GTGGCATCAGGAGTGTGTGGAGG + Intronic
986658317 5:10036976-10036998 GTGGTCACAGTGGTAGGAGGAGG - Intergenic
988771712 5:34439382-34439404 GTGGCCCACTGAGTGGGAGGGGG - Intergenic
989608410 5:43268493-43268515 GGGGCCACAGGAGTGGTTGGTGG + Intronic
991086263 5:62650870-62650892 GTCCCCTCAGGAGTTGGAGGTGG - Intergenic
991291907 5:65041600-65041622 TTGGAAACAAGAGTGGGAGGAGG + Intergenic
991608207 5:68424226-68424248 GTGGCCCCAGAAGTGGGAAAAGG - Intergenic
991675939 5:69089985-69090007 GGGGCCACAGAAGTGGTAGTTGG + Intergenic
995544192 5:113214062-113214084 ATGGGGACAGGGGTGGGAGGAGG - Intronic
997423805 5:133789157-133789179 ATGGAGCCAGGAGTGGGAGGTGG + Intergenic
997424820 5:133796047-133796069 GTGGTTGGAGGAGTGGGAGGGGG - Intergenic
998165264 5:139838968-139838990 GGGGCCACAGCTGTGGCAGGTGG + Intronic
998390291 5:141783091-141783113 CTGGCCACAGGGGCAGGAGGTGG - Intergenic
998528069 5:142860691-142860713 GTGACAGCAGGGGTGGGAGGAGG - Intronic
999745787 5:154590757-154590779 TTGGACAAAGGAGGGGGAGGGGG - Intergenic
1000786294 5:165548581-165548603 CTGGAAACAGGAGTGGAAGGTGG + Intergenic
1001267707 5:170286806-170286828 TAGGCCAAAGGAGTAGGAGGTGG - Intronic
1001564853 5:172693319-172693341 GTGGTAGCAGGAGTGGGAGCTGG + Intergenic
1002000701 5:176194921-176194943 GTCGCCACAGGAGCGGGGCGCGG + Intergenic
1002043336 5:176529486-176529508 GTGTTCAGAGGGGTGGGAGGTGG + Intronic
1002253641 5:177944066-177944088 GTCGCCACAGGAGCGGGGCGCGG - Intergenic
1002297757 5:178240748-178240770 GAGGCCAGAGGTCTGGGAGGGGG + Intronic
1002601583 5:180356810-180356832 GATCCCACAGGAGTTGGAGGAGG - Intergenic
1002641754 5:180633719-180633741 GTGGGCACCGGAGTGGGTGGTGG + Intronic
1003054572 6:2806622-2806644 GGGGCCACAGGAGGGGTTGGTGG - Intergenic
1003125936 6:3356042-3356064 GTGGACAGGGGAGGGGGAGGAGG + Intronic
1003143872 6:3493582-3493604 GTGGGCACAGGGGTTGGGGGAGG + Intergenic
1003187965 6:3849365-3849387 GTGGACACAGGAAGTGGAGGCGG - Exonic
1003318549 6:5033077-5033099 GGGGCCACGGGAGTGGGGGAGGG - Intergenic
1003364229 6:5457247-5457269 CTGACCATAGGGGTGGGAGGTGG - Intronic
1004474523 6:15959017-15959039 GGGGCCACAGGAGTGGTTAGTGG + Intergenic
1004744840 6:18499463-18499485 GTGGCCAAAGGTGTGGGAATGGG + Intergenic
1004868210 6:19875202-19875224 GTGGCCACCAGTGTTGGAGGTGG + Intergenic
1005089616 6:22042998-22043020 CTGGCCACAGGTTTGGGAGCTGG + Intergenic
1005106390 6:22228769-22228791 CTGGCCACAGGAGTGAGGGTTGG + Intergenic
1005132269 6:22522962-22522984 GTGGCAACAGGCATGGGTGGAGG - Intergenic
1005495396 6:26383554-26383576 GTGGCCCGAGAAGTGGGAAGAGG + Intronic
1006063695 6:31444963-31444985 CTGGCATCAGGAGTGGGAGGGGG + Intergenic
1006717752 6:36130985-36131007 GAGGCCCCAAGAGGGGGAGGTGG + Intronic
1006782183 6:36639489-36639511 GAGGCCGGAGGAGTGGCAGGAGG - Intergenic
1007228911 6:40334550-40334572 ATGCACACAGGAGTGAGAGGAGG - Intergenic
1007685286 6:43663574-43663596 GTGGCCTGAGGAGAGGGAGAGGG + Intronic
1007797731 6:44363944-44363966 GTTACCACTGGAGTTGGAGGAGG - Intronic
1007902178 6:45422531-45422553 GTGGCCGGGGGAGGGGGAGGAGG - Intronic
1008982396 6:57500037-57500059 GTGGCTACAGAAGAGGAAGGTGG - Intronic
1009170461 6:60392875-60392897 GTGGCTACAGAAGAGGAAGGTGG - Intergenic
1010246644 6:73665844-73665866 GTGGCCACAGTTGTGGAAGATGG - Intergenic
1010256577 6:73765115-73765137 TTGGGCATGGGAGTGGGAGGTGG + Intronic
1010571035 6:77475014-77475036 GTGGCCATTAGGGTGGGAGGAGG - Intergenic
1010750860 6:79614788-79614810 GTGGCCACAGGAGAGGAAAGGGG + Intergenic
1010991453 6:82484809-82484831 GTGGCCACTGGGGTTGGGGGTGG - Intergenic
1012415211 6:99005615-99005637 GTGTCCAGAGTAGTGGAAGGAGG - Intergenic
1012490761 6:99780342-99780364 GTGGCCACAGGGGCTGGAGCTGG + Intergenic
1012913298 6:105140930-105140952 GTTGCCAGGGGTGTGGGAGGAGG - Intergenic
1013060096 6:106625288-106625310 TTGCCCACAGGAGTGGGTGCGGG - Intronic
1015045714 6:128774084-128774106 GGGGACACAGGAGTGGGTGAAGG - Intergenic
1016838538 6:148503711-148503733 GTGACTAGAGGAGTTGGAGGAGG + Intronic
1017300776 6:152855430-152855452 TTGGGAACAGGAGTAGGAGGAGG - Intergenic
1018049520 6:159996987-159997009 GTGCCCACAGCAGTGGGTAGAGG + Intronic
1018602563 6:165560797-165560819 GTGGCCCCAGGTGTTAGAGGTGG + Intronic
1018858838 6:167696204-167696226 GGGGCCACACTACTGGGAGGGGG - Intergenic
1019481835 7:1270481-1270503 GATGCCACTGGAGTGGGCGGCGG - Intergenic
1019632969 7:2059407-2059429 GTGGCCAGAGGAGAGGCACGGGG + Intronic
1019658102 7:2208766-2208788 TCGGGCACAGGAGGGGGAGGAGG - Intronic
1019705096 7:2493820-2493842 GTGGCCCCAAGAAGGGGAGGAGG - Intergenic
1020267760 7:6572709-6572731 ATGTCCACAGGAGTAGGAGGAGG - Intergenic
1021577100 7:22114797-22114819 GTGGGCACAGGACAGGGAAGGGG + Intergenic
1021751858 7:23808895-23808917 GTAGCCACAGGACTGGGAAGAGG - Intronic
1022128267 7:27378616-27378638 GTGGCCACAGTGGTGGGAGGTGG + Intergenic
1023253466 7:38290323-38290345 GTGGGCACAGGCCTGGGAGTGGG - Intergenic
1023287773 7:38636988-38637010 GTGGCCTCTGGAGAGGGAAGAGG - Intergenic
1023881436 7:44323807-44323829 CTGGCCACTGGAGGGGCAGGTGG - Intronic
1023951296 7:44848090-44848112 TTGGCCACAGCAGCGCGAGGCGG - Intergenic
1024246122 7:47471735-47471757 GTGGACACCCGAGGGGGAGGTGG - Intronic
1024249629 7:47496341-47496363 GGGGCCACATGTGTGGAAGGAGG + Intronic
1024606864 7:51028703-51028725 GTGGGCACAGGGGTGGAGGGGGG + Exonic
1025296993 7:57783166-57783188 GTGGGGAGAGGAGTGGGTGGAGG + Intergenic
1025978675 7:66390012-66390034 GTGGGCAGAGAAGGGGGAGGTGG - Intronic
1026843450 7:73683699-73683721 GTGGCCGCAGAAGTGGGGAGAGG - Intronic
1027204262 7:76084715-76084737 GTGGGCAGAGAAGGGGGAGGTGG - Intergenic
1027242935 7:76345024-76345046 TTGGCTGCAAGAGTGGGAGGAGG - Intronic
1029085347 7:98007029-98007051 GATGGCACAGGAGAGGGAGGGGG - Intergenic
1029211299 7:98910245-98910267 GGGGTCACAGGGGTGGCAGGTGG - Exonic
1029578109 7:101417438-101417460 ATGGTCACAGGAGTGGGTGCTGG - Intronic
1032399903 7:131617449-131617471 GGAGCCACAGGAGTGAGAAGAGG + Intergenic
1032512132 7:132480731-132480753 GTGGCCACAGGGAGGGGAGGAGG - Intronic
1032791731 7:135247420-135247442 ATAGCCACAGGAGCCGGAGGAGG - Intronic
1033686115 7:143642812-143642834 GTGGCCTCAGTAGTGTGTGGGGG + Intronic
1033689623 7:143724503-143724525 GTGGCCTCAGTAGTGTGTGGGGG - Exonic
1033698498 7:143814809-143814831 GTGGCCTCAGTAGTGTGTGGGGG - Intergenic
1034537682 7:151736002-151736024 GTGGCCACAGGAGTGGCGACAGG + Intronic
1034720762 7:153290154-153290176 GTGGGAAGAGGAGGGGGAGGAGG + Intergenic
1034917879 7:155056091-155056113 GAGGCCCCAGGACTGGGAGCAGG - Intergenic
1035029865 7:155849908-155849930 TTGGGCCCAGGGGTGGGAGGTGG + Intergenic
1035269659 7:157711923-157711945 CAGGCCACATGAGTGGGGGGAGG + Intronic
1035269702 7:157712027-157712049 CAGGCCACATGAGTGGGGGGAGG + Intronic
1035374808 7:158400997-158401019 TTGGCCACAGGAGGCGGAGCAGG - Intronic
1035522936 8:290007-290029 GTGCACACATGAGTGGGATGGGG - Intergenic
1035822200 8:2605550-2605572 GTGGGGTCAGCAGTGGGAGGGGG - Intergenic
1036569899 8:9971197-9971219 GAGGCCAAAGGAGGGGGGGGGGG - Intergenic
1036752460 8:11451890-11451912 GTGCCCACAGAATTGGCAGGAGG - Intronic
1037131330 8:15411061-15411083 GGGGCCTCAGGAGTGGATGGCGG - Intergenic
1037861756 8:22410285-22410307 GAGGCCAGAGGAGTGAGAGGTGG - Intronic
1037935661 8:22913532-22913554 GTGGCCGCAGGGGCTGGAGGGGG - Intronic
1039558561 8:38494961-38494983 GTGCCCGCAGGGGTGGAAGGTGG + Intergenic
1039864127 8:41486284-41486306 GTGGCCAGGAGGGTGGGAGGAGG - Intergenic
1039870342 8:41540466-41540488 GTGGCCTCAGAAGAGGGAGCAGG + Intronic
1040512243 8:48105668-48105690 GTGGCCACAGGTGTGCGCCGGGG + Intergenic
1040663659 8:49604701-49604723 ATAGGCACAGGATTGGGAGGTGG - Intergenic
1041986972 8:63933385-63933407 GTGGTCACAGGGGCTGGAGGGGG - Intergenic
1042338196 8:67650863-67650885 GAGGCTGCAGGAGTGGGAGTAGG + Intronic
1045160006 8:99529202-99529224 GTGGCCACAGGGTAAGGAGGTGG - Intronic
1045322076 8:101089680-101089702 CGGACCACAGAAGTGGGAGGCGG + Intergenic
1045383290 8:101647863-101647885 GTCCCCCCAGGATTGGGAGGAGG + Intronic
1045383331 8:101648083-101648105 GAGGCCACATCACTGGGAGGAGG + Intronic
1045894505 8:107197979-107198001 GTGGCTACAAGAGAGGGAAGTGG - Intergenic
1046498391 8:115043345-115043367 GTGGCCAGAGGAGCGGAGGGGGG + Intergenic
1046581546 8:116099148-116099170 GTCTCCACAGGAGGGTGAGGTGG + Intergenic
1048581305 8:135731710-135731732 GTGACCAAAAGGGTGGGAGGAGG + Intergenic
1048586175 8:135776159-135776181 GAGGCCAGAGGAGGGGGAGGGGG + Intergenic
1048842302 8:138576752-138576774 AGGGCCACAGGGGTTGGAGGTGG + Intergenic
1049157601 8:141076369-141076391 GTGGCAATGGGAGGGGGAGGAGG + Intergenic
1049175985 8:141193019-141193041 GCGGCCACATGAGCGGGTGGGGG - Intronic
1049222361 8:141433911-141433933 GTGGACACGGGAGGGGAAGGCGG + Intergenic
1049236616 8:141515355-141515377 GTGGGCAGATGAGTGGGTGGAGG - Intronic
1049277212 8:141725869-141725891 GTGGCAACAGCAGTGGTAGCCGG - Intergenic
1049379585 8:142305338-142305360 GAGGGCGCAGGGGTGGGAGGGGG + Intronic
1049403458 8:142441154-142441176 GTGCCAACAGGAGTGGGGGCTGG - Intergenic
1049771228 8:144382977-144382999 GTGCACACAGGAGTGAGACGTGG + Intronic
1049828810 8:144686931-144686953 GTGGTCACAGGGGTGGGAAATGG - Intergenic
1049879249 8:145051358-145051380 GGGGACACAGGAGTGGAAAGCGG - Intergenic
1051360779 9:16279828-16279850 GTAGCCAGAGGAGAAGGAGGAGG + Intergenic
1051362612 9:16294504-16294526 GTGGCCAGAGGAGGGGTGGGGGG + Intergenic
1051890097 9:21932546-21932568 GGGGCCACAGGAGTGGTTGGTGG - Intronic
1051996918 9:23228259-23228281 GGGGCCACAGGAGTGGTTGGTGG + Intergenic
1053442296 9:38126454-38126476 CTGGACACAGAAGTGAGAGGAGG - Intergenic
1055121243 9:72663259-72663281 GGGGCCACAGGACTGGTTGGTGG + Intronic
1056714207 9:89014714-89014736 GTGGCCACATTAGTGGAAGCAGG - Intronic
1057176294 9:93002813-93002835 GGGGCCACAGGGGTGGCAGGAGG - Intronic
1057391374 9:94643913-94643935 GGGGCCACAGGAGCTGGGGGAGG - Intergenic
1057876118 9:98755751-98755773 GTGTCCACAGGGGTGGAATGTGG - Intronic
1057949285 9:99356900-99356922 GTGGGCAGAGGAGAGGGAGGTGG + Intergenic
1058449293 9:105081124-105081146 GTGGCCACAGGACTGGTTGGTGG - Intergenic
1058648562 9:107153793-107153815 GTGGCCACGGGAAGGTGAGGAGG - Intergenic
1058653025 9:107194884-107194906 ATGACTAGAGGAGTGGGAGGAGG + Intergenic
1058811536 9:108644295-108644317 TTAGCCAGAGGAATGGGAGGAGG - Intergenic
1059837736 9:118175624-118175646 ATGGCCACAGGAGTGGGCAGTGG - Intergenic
1060494014 9:124104818-124104840 GTGGCCCCTGGAGGGGGATGTGG - Intergenic
1060785312 9:126448003-126448025 CTGGCCAGAGCAGAGGGAGGAGG - Intronic
1060933115 9:127501166-127501188 GTGGCCACAGGCAGGGCAGGCGG - Intronic
1060962585 9:127691544-127691566 GTGGACACAGGCTGGGGAGGGGG - Exonic
1060966901 9:127716625-127716647 TTGACCACAGGAGAGGGAGAAGG + Exonic
1061034534 9:128106289-128106311 GTGGGCACAGGACTGGGGAGAGG + Intronic
1061188612 9:129069377-129069399 GTGGCCACAGGGCTGGCAGCTGG + Intronic
1061195796 9:129106499-129106521 GTGGCCCCGTGAGTGGAAGGAGG + Intronic
1061202650 9:129146549-129146571 GTGGCCAAAGGTGTGGGAGGAGG + Intronic
1061324228 9:129853122-129853144 GTGGGCACAGGGGTGAGAGAAGG - Intronic
1061567643 9:131454035-131454057 GTTGCCACAGGATTAGGAGGTGG - Intronic
1061723412 9:132567765-132567787 GAGCCCACAGGAGCTGGAGGAGG - Intronic
1061924687 9:133800251-133800273 GGGGCCACAGGGGTGGGCTGGGG - Intronic
1061939471 9:133876358-133876380 GTGGAGACAAGAGTGGTAGGGGG + Intronic
1062144728 9:134982731-134982753 GTGGCCTTAGGAGGGGAAGGGGG - Intergenic
1062454271 9:136628429-136628451 GTGGCCACAGCGGCCGGAGGTGG + Intergenic
1062561940 9:137145602-137145624 GTGGGGACAGGGGTGGGAGGAGG + Intronic
1062576599 9:137211787-137211809 TTGGCCACGGGAAGGGGAGGTGG + Intronic
1062689156 9:137832533-137832555 GGGGCCACATGGGTGGGTGGGGG - Intronic
1062702445 9:137914375-137914397 GTAGGCAGAGGAGTGGGATGTGG - Intronic
1062728935 9:138097706-138097728 GGGGGCAGAGGAGTGCGAGGGGG - Intronic
1202628893 M:305-327 GTGGCCAGAAGCGGGGGAGGGGG - Intergenic
1185683516 X:1908434-1908456 GAGCCCCCAGGAGTGGGAAGAGG - Intergenic
1186108006 X:6227074-6227096 CTGCCCACTGGAGTGGGAAGGGG + Intronic
1186287965 X:8065870-8065892 GTTGACACTGGAGTGGGAGGGGG - Intergenic
1186352809 X:8757284-8757306 GTGGCTACATCACTGGGAGGAGG - Intergenic
1188007205 X:25023274-25023296 GAGGCAGAAGGAGTGGGAGGAGG + Intergenic
1189262899 X:39690278-39690300 GTGGCCACTGTGGTGGGAGCTGG - Intergenic
1189321601 X:40090566-40090588 GTGGCCACAGTAGGCGGGGGTGG - Intronic
1191838248 X:65488404-65488426 GGGGCGACAGGAGCGGGTGGGGG + Intronic
1192173015 X:68868383-68868405 GGGGAGACAGGAGGGGGAGGAGG - Intergenic
1192557651 X:72103206-72103228 GTGGCCACAGTGGAGGGAGTGGG + Intergenic
1192901794 X:75507009-75507031 GTGTATACAGGAGTGGGAGCCGG + Intronic
1193648158 X:84093874-84093896 CTGGCCACAGGAGTGGAGTGGGG + Intronic
1194318453 X:92411896-92411918 GAGGGAAGAGGAGTGGGAGGAGG + Intronic
1195046451 X:101058772-101058794 GGGACCACAGGAGTGGTTGGTGG - Intergenic
1195086594 X:101419110-101419132 GTGAACTAAGGAGTGGGAGGAGG - Intronic
1195112757 X:101664145-101664167 GTGGCCAAAGAAGGTGGAGGAGG + Intergenic
1196679247 X:118453996-118454018 GTGGCAATGGGAGTGGAAGGTGG + Intergenic
1197129352 X:122986754-122986776 GAGGCCCCAGGAGAGGGAGAGGG + Intergenic
1197662999 X:129193982-129194004 GTGGCTTCTGGAGTTGGAGGTGG + Intergenic
1197899687 X:131356912-131356934 GTGGCAAAAGGAGTGAGAAGAGG + Intronic
1200213105 X:154355614-154355636 GTGCAGACAGGAGTGGGAGCGGG + Intronic
1200626622 Y:5525186-5525208 GAGGGAAGAGGAGTGGGAGGAGG + Intronic
1201610737 Y:15840248-15840270 GTGGCCACAGGATGGGGATGGGG + Intergenic