ID: 1183532916

View in Genome Browser
Species Human (GRCh38)
Location 22:38373845-38373867
Sequence ACTGGGCTGTTTCGCAGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 1, 2: 5, 3: 11, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183532910_1183532916 -4 Left 1183532910 22:38373826-38373848 CCTTGCCAGGGGTGGGCTCACTG 0: 3
1: 0
2: 1
3: 26
4: 242
Right 1183532916 22:38373845-38373867 ACTGGGCTGTTTCGCAGGGTAGG 0: 1
1: 1
2: 5
3: 11
4: 113
1183532913_1183532916 -9 Left 1183532913 22:38373831-38373853 CCAGGGGTGGGCTCACTGGGCTG 0: 4
1: 2
2: 12
3: 43
4: 330
Right 1183532916 22:38373845-38373867 ACTGGGCTGTTTCGCAGGGTAGG 0: 1
1: 1
2: 5
3: 11
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183532916 Original CRISPR ACTGGGCTGTTTCGCAGGGT AGG Intronic
900705011 1:4075029-4075051 ACTGGGCTTTTGGGAAGGGTGGG + Intergenic
904446947 1:30581440-30581462 CCAGGGCTGGTTGGCAGGGTCGG - Intergenic
906070645 1:43013864-43013886 ACTAAACTGTTTCCCAGGGTGGG - Intergenic
909076421 1:71054593-71054615 ACTGGGGTGTCCCGCGGGGTGGG + Intergenic
909473632 1:76057540-76057562 ACTGGGGCCTGTCGCAGGGTGGG - Intergenic
917243590 1:172975834-172975856 ACTGGGCTATTACGAAGGATTGG - Intergenic
920615166 1:207485173-207485195 ACTGGGACCTTTCACAGGGTTGG + Intronic
924644104 1:245861124-245861146 ACTGGGGTGTTTTGCAGGAAAGG - Intronic
1065008607 10:21402222-21402244 ACTGGGGTGTGTTGCAGGTTGGG + Intergenic
1067202977 10:44190332-44190354 ACTGGGGCCTGTCGCAGGGTTGG + Intergenic
1068598105 10:58925604-58925626 ACTGGGCTGTTTCCCAAGTGGGG - Intergenic
1074281518 10:112056158-112056180 ACTGGTCTACTTCACAGGGTAGG - Intergenic
1075471929 10:122697522-122697544 GCTGGGCTGTTGCTGAGGGTGGG + Intergenic
1076926045 10:133488397-133488419 ACCAGGCTGTTTCTCAGGTTGGG + Intergenic
1076926077 10:133488559-133488581 ACAGGGCTGTTTCTCAGGCCTGG + Intergenic
1077362021 11:2145016-2145038 AATGGGCTGTTTTTCATGGTGGG - Intronic
1078006316 11:7535092-7535114 ACTGAGCTGTTTCCCAGGGGAGG + Intronic
1078065430 11:8075939-8075961 ACTGGGCTGTTTTTGTGGGTTGG + Intronic
1079893163 11:26083655-26083677 ACTGGGGACTGTCGCAGGGTGGG + Intergenic
1083477283 11:62922641-62922663 ACTGGGCTGTGTCGAAGTCTTGG + Intergenic
1090156964 11:124448604-124448626 GCTGGGCTGTTTCTCAGGTTAGG - Intergenic
1090238663 11:125166663-125166685 TCTGGGCTGTGGCCCAGGGTAGG + Intronic
1091605235 12:1945869-1945891 ACTGGGGTCTGTCGCGGGGTGGG + Intergenic
1097628347 12:62029477-62029499 ACTGTGCTGTTTACTAGGGTTGG - Intronic
1099734704 12:86551722-86551744 ATTAGGCTGTTTCTCAGGTTGGG - Intronic
1101734883 12:107455740-107455762 ACTGGGCTCTCTCACAGGTTAGG + Intronic
1105337338 13:19486366-19486388 ACTGGGCTGTTTCTCAGGGTAGG + Intronic
1105807861 13:23967888-23967910 ACTGGGGCCTGTCGCAGGGTGGG - Intergenic
1106430145 13:29673244-29673266 ACTGGGGCCTGTCGCAGGGTCGG + Intergenic
1107344578 13:39445163-39445185 ACTGGGCTGTTCTGGAGGTTGGG - Intronic
1108511717 13:51162335-51162357 ATGGGTCTGTTCCGCAGGGTGGG - Intergenic
1108654085 13:52510780-52510802 TCTGGACTGTTTCTCAGGGTAGG - Intergenic
1112736763 13:102430014-102430036 GCTGGGCTGTTTCTCAGATTAGG + Intergenic
1112773565 13:102819589-102819611 ACTGGGCCCTGTCGCGGGGTGGG + Intronic
1117902587 14:60550773-60550795 ATGGGGCTGTTTCTCAGGCTGGG + Intergenic
1120171021 14:81247434-81247456 ACAGGGCTGTTTCTCAGGTCTGG + Intergenic
1122157517 14:99759134-99759156 ACTGGGCTGGTAGTCAGGGTGGG + Intronic
1122931386 14:104934183-104934205 TGTGGGCTGTTGTGCAGGGTGGG + Exonic
1127697795 15:61468971-61468993 ACTGGGCTGTATTTGAGGGTTGG - Intergenic
1128707253 15:69845685-69845707 ACAGGGCTGCTGCGCTGGGTGGG - Intergenic
1131756783 15:95572739-95572761 ACTGGGCTTTTTCTCAGGCCTGG + Intergenic
1132375810 15:101327462-101327484 CCTGGGCCGTTTCCCAGCGTAGG - Intronic
1133201768 16:4208123-4208145 ATTGGTCAGTTTCACAGGGTTGG + Intronic
1134144726 16:11751146-11751168 AATGGGCTGTTTCACAGGCCTGG - Exonic
1134376143 16:13676054-13676076 ACTGGGGCCTTTCGGAGGGTCGG - Intergenic
1134781746 16:16904378-16904400 ACTGGGCTGGCTCTCAGGGTAGG + Intergenic
1135693480 16:24565407-24565429 ACTGGTCTGTGGCCCAGGGTTGG - Intronic
1135970637 16:27069636-27069658 ACTGGGGTCTATCGGAGGGTGGG - Intergenic
1140611550 16:76605628-76605650 ACTGGGGCCTTTCGGAGGGTAGG + Intronic
1143815295 17:9507548-9507570 GTTGGGCTGTTTCTCAGGTTTGG - Intronic
1147361845 17:39935830-39935852 ACTGGGCAGTTTCGCGGAGAGGG - Intergenic
1149423182 17:56530442-56530464 CCTGGGCTGTTTCTCAAGGCAGG - Intergenic
1149658009 17:58320358-58320380 ACTGGCCTATTTCTCAGGGTGGG - Intronic
1150260630 17:63787502-63787524 ACTGGGCTGTTGCTCACTGTGGG + Intronic
1150826601 17:68481584-68481606 ACTGGTCTGTAGCCCAGGGTTGG + Intergenic
1150965171 17:69959933-69959955 GCTGAGCTGGTTTGCAGGGTTGG - Intergenic
1152362027 17:79837231-79837253 ACTGGGCTGTTTGGCAGGGCAGG - Intronic
1155024478 18:21928877-21928899 ACTGAGCTGTATTGCAGAGTTGG + Intergenic
1156073215 18:33237943-33237965 ACTGGGCTGTTTCTCAGATCAGG - Intronic
1158128359 18:54126456-54126478 ACTGGGCCGCTTCACAGTGTGGG - Intergenic
1159002454 18:62986578-62986600 ACTGTGCTGTTTTGCTGAGTTGG + Intergenic
1160757204 19:764068-764090 ACTGGATGGTTTCCCAGGGTTGG - Exonic
1162058368 19:8079481-8079503 ACAGGGTTGTTTTGGAGGGTAGG - Intronic
1162649491 19:12076109-12076131 ACAGGGCTTTTTCCCAGAGTGGG - Exonic
1163247507 19:16106148-16106170 ACTGGGCTGATTCAGATGGTTGG + Intergenic
925130919 2:1493523-1493545 GCTGGGCAGTGTCACAGGGTGGG + Intronic
925918254 2:8622701-8622723 GCTGGGCTGTGGCGCAGGGCTGG - Intergenic
929294151 2:40227550-40227572 ACTGGGGTCTTTTGGAGGGTGGG + Intronic
934873194 2:97887066-97887088 ATGGGGCTGTTTCTCAGGGTGGG + Intronic
936818030 2:116484474-116484496 ACTTGGCTGCTTGGCAGGGGAGG - Intergenic
937014296 2:118589416-118589438 ACTGGTCTGTGGCCCAGGGTTGG + Intergenic
937603343 2:123767279-123767301 ACTGGGCTGATTTTCAGGATGGG + Intergenic
941116797 2:161480774-161480796 ACTGGGCTGTTTCTCAGGTTAGG - Intronic
947318540 2:228891750-228891772 ACTGGGGTATTTTGGAGGGTGGG - Intronic
947474897 2:230435724-230435746 ACTTGGGTGTTTCAGAGGGTGGG - Intronic
1169731458 20:8789695-8789717 GCAGAGCTGTTTCACAGGGTGGG + Intronic
1171820515 20:29832876-29832898 CCTGGGCTTTTTCGAGGGGTTGG - Intergenic
1173090664 20:39967863-39967885 GCTGGACTGTTTCACATGGTTGG - Intergenic
1173717200 20:45218791-45218813 CATGGGCTGTTTCTCAGGTTTGG + Intergenic
1174696039 20:52560233-52560255 GCTGGGCTGTTTCTCAGGTCAGG + Intergenic
1183250184 22:36725033-36725055 ACTGGACTGTGCCACAGGGTAGG - Intergenic
1183532916 22:38373845-38373867 ACTGGGCTGTTTCGCAGGGTAGG + Intronic
1183712094 22:39510971-39510993 AGAGGGCTGTTTTGCATGGTGGG + Intronic
951139851 3:19147446-19147468 ACAGGGCTGTGCCGCAGGCTTGG + Intergenic
951625812 3:24662497-24662519 GCTGGGCTGTTTCTCAGGTCGGG + Intergenic
958803320 3:98781314-98781336 ACTGGGGCCTGTCGCAGGGTTGG + Intronic
959559821 3:107767038-107767060 ACTGGGATCTGTCGCAGGATAGG + Intronic
964269574 3:154940450-154940472 ACAGGGCTGTTTCTCAGGCCTGG - Intergenic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
969663372 4:8543353-8543375 CCTGGGCTGCTTCGCAGGCTGGG - Intergenic
970185991 4:13454685-13454707 GCTGGGCTGTTTCTCAGGTCAGG + Intronic
972496342 4:39638608-39638630 ACAGGGCTGTTTCTCGGGCTTGG - Intronic
976475212 4:85475388-85475410 ACTGGGCTGCTCCGCAGCGCGGG - Exonic
978429244 4:108616634-108616656 ACTGGGCTGCTTCAAAGGCTGGG - Intergenic
982324483 4:154115415-154115437 ACGGGGCTGTGTCTCAGGCTGGG + Intergenic
982659332 4:158188535-158188557 ACTCGGCTGTATCAAAGGGTTGG - Intergenic
989081729 5:37630125-37630147 ACTGGGCTGTCTCTTAGGTTGGG + Intronic
991938442 5:71827261-71827283 ACTGGGCTGTTTCTCAGGTTAGG + Intergenic
994850496 5:105049388-105049410 ACTGGGGTCTGTCACAGGGTGGG - Intergenic
996640183 5:125742594-125742616 ACTGGGCCCTGTCACAGGGTGGG + Intergenic
1003318269 6:5030696-5030718 ACTGGGCTGCTTCCCAGTCTTGG + Intergenic
1004162370 6:13225927-13225949 AAAGGGCTGCTTTGCAGGGTGGG + Intronic
1004811621 6:19269607-19269629 ACAGGGCTGTTTCTCAGGCCTGG - Intergenic
1007222787 6:40292287-40292309 ACTGGGCTGTTCTGCAGGTTAGG + Intergenic
1011423509 6:87200934-87200956 ACTGGGCCGTTTGCCAGGGATGG + Intronic
1012135837 6:95554598-95554620 ACTGGGGCCTTTCGGAGGGTGGG - Intergenic
1013393225 6:109708145-109708167 ACTGGGGTCTTTTGGAGGGTGGG - Intronic
1015396898 6:132744934-132744956 ACTGGTCTGTTTCACGGAGTGGG + Intronic
1019062233 6:169264850-169264872 ACTGAGTTGTTTCACAGGGATGG + Intergenic
1020003476 7:4768846-4768868 ACTGGGCTGTTTCTCAGGGCAGG - Exonic
1021831533 7:24617715-24617737 ACTGGGCTGTTTCTCAGGTCAGG + Intronic
1031224713 7:119021375-119021397 ACTGGGCTGTTTTTCAGGCTAGG - Intergenic
1031585533 7:123528557-123528579 ACTGTGCTGTATCTCAGTGTAGG + Intronic
1032394203 7:131577481-131577503 ACTAGGCTGTGGAGCAGGGTGGG - Intergenic
1033161728 7:139002773-139002795 GCTGGGCTGTTTTGCAAAGTGGG - Intergenic
1036765901 8:11549177-11549199 CCTGGGCTGTTAGGCAGGGCAGG + Intronic
1039023285 8:33230573-33230595 ACTGGGGTGATTCCCAGGGCTGG - Intergenic
1047751603 8:127885134-127885156 CCTGGGCTGCTTCCCAGGGCTGG + Intergenic
1050127143 9:2368550-2368572 ACCAGGCTGTTTCTCAGGTTAGG - Intergenic
1052541631 9:29817719-29817741 ACTGGGCTGTTTCTCAGGTCAGG - Intergenic
1055225171 9:73986368-73986390 ATTGGGCTCTCTAGCAGGGTTGG - Intergenic
1060461912 9:123864411-123864433 ACAGGGCAGTTTCCCAGGGGTGG + Intronic
1189340525 X:40201372-40201394 GCTGGGGTGGTTCGAAGGGTGGG + Intergenic
1190236060 X:48616676-48616698 ACTGGGCAGTGTCACAGGGCAGG + Intergenic
1191675354 X:63786771-63786793 AATGGGCTGGTTGGCAGGGGAGG - Intergenic
1192626064 X:72730006-72730028 ACTGGGGTGTGTTGGAGGGTGGG - Intergenic
1193908765 X:87277038-87277060 ACTGGGTCCTGTCGCAGGGTGGG - Intergenic
1198435793 X:136615748-136615770 ACTGGACTGTACCGAAGGGTTGG - Intergenic
1198958460 X:142157839-142157861 ACTGGGGCGTGTCGGAGGGTTGG + Intergenic
1201066190 Y:10097008-10097030 CCTGGGCTTTTTCGGGGGGTTGG + Intergenic
1202594523 Y:26522173-26522195 ACAGGGCTGTTTCTCAGGGTAGG - Intergenic