ID: 1183536717 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:38406057-38406079 |
| Sequence | CTTAGGAAGGCCAAGGTGGA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1183536717_1183536723 | -8 | Left | 1183536717 | 22:38406057-38406079 | CCGTCCACCTTGGCCTTCCTAAG | No data | ||
| Right | 1183536723 | 22:38406072-38406094 | TTCCTAAGTGCTGGGATGACAGG | 0: 3 1: 191 2: 15055 3: 316704 4: 264949 |
||||
| 1183536717_1183536725 | 11 | Left | 1183536717 | 22:38406057-38406079 | CCGTCCACCTTGGCCTTCCTAAG | No data | ||
| Right | 1183536725 | 22:38406091-38406113 | CAGGCGTGAGCCACCGCGTCCGG | 0: 551 1: 27272 2: 68868 3: 125687 4: 165186 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1183536717 | Original CRISPR | CTTAGGAAGGCCAAGGTGGA CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||