ID: 1183536717

View in Genome Browser
Species Human (GRCh38)
Location 22:38406057-38406079
Sequence CTTAGGAAGGCCAAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183536717_1183536723 -8 Left 1183536717 22:38406057-38406079 CCGTCCACCTTGGCCTTCCTAAG No data
Right 1183536723 22:38406072-38406094 TTCCTAAGTGCTGGGATGACAGG 0: 3
1: 191
2: 15055
3: 316704
4: 264949
1183536717_1183536725 11 Left 1183536717 22:38406057-38406079 CCGTCCACCTTGGCCTTCCTAAG No data
Right 1183536725 22:38406091-38406113 CAGGCGTGAGCCACCGCGTCCGG 0: 551
1: 27272
2: 68868
3: 125687
4: 165186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183536717 Original CRISPR CTTAGGAAGGCCAAGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr