ID: 1183540082

View in Genome Browser
Species Human (GRCh38)
Location 22:38424774-38424796
Sequence AGAAGCTGCAAGGTCTCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183540082_1183540085 -6 Left 1183540082 22:38424774-38424796 CCTCCGGAGACCTTGCAGCTTCT No data
Right 1183540085 22:38424791-38424813 GCTTCTACCTTTGCCCTCGTAGG No data
1183540082_1183540087 5 Left 1183540082 22:38424774-38424796 CCTCCGGAGACCTTGCAGCTTCT No data
Right 1183540087 22:38424802-38424824 TGCCCTCGTAGGTTGCTGCCCGG No data
1183540082_1183540090 19 Left 1183540082 22:38424774-38424796 CCTCCGGAGACCTTGCAGCTTCT No data
Right 1183540090 22:38424816-38424838 GCTGCCCGGAGTCGCCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183540082 Original CRISPR AGAAGCTGCAAGGTCTCCGG AGG (reversed) Intergenic
No off target data available for this crispr