ID: 1183540084 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:38424784-38424806 |
Sequence | GGGCAAAGGTAGAAGCTGCA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1183540084_1183540090 | 9 | Left | 1183540084 | 22:38424784-38424806 | CCTTGCAGCTTCTACCTTTGCCC | No data | ||
Right | 1183540090 | 22:38424816-38424838 | GCTGCCCGGAGTCGCCATGAAGG | No data | ||||
1183540084_1183540094 | 29 | Left | 1183540084 | 22:38424784-38424806 | CCTTGCAGCTTCTACCTTTGCCC | No data | ||
Right | 1183540094 | 22:38424836-38424858 | AGGAATGTGATGCAGCCTATTGG | No data | ||||
1183540084_1183540087 | -5 | Left | 1183540084 | 22:38424784-38424806 | CCTTGCAGCTTCTACCTTTGCCC | No data | ||
Right | 1183540087 | 22:38424802-38424824 | TGCCCTCGTAGGTTGCTGCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1183540084 | Original CRISPR | GGGCAAAGGTAGAAGCTGCA AGG (reversed) | Intergenic | ||