ID: 1183540087

View in Genome Browser
Species Human (GRCh38)
Location 22:38424802-38424824
Sequence TGCCCTCGTAGGTTGCTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183540083_1183540087 2 Left 1183540083 22:38424777-38424799 CCGGAGACCTTGCAGCTTCTACC No data
Right 1183540087 22:38424802-38424824 TGCCCTCGTAGGTTGCTGCCCGG No data
1183540084_1183540087 -5 Left 1183540084 22:38424784-38424806 CCTTGCAGCTTCTACCTTTGCCC No data
Right 1183540087 22:38424802-38424824 TGCCCTCGTAGGTTGCTGCCCGG No data
1183540080_1183540087 24 Left 1183540080 22:38424755-38424777 CCAAGTTCAAGGGGCTAGGCCTC No data
Right 1183540087 22:38424802-38424824 TGCCCTCGTAGGTTGCTGCCCGG No data
1183540082_1183540087 5 Left 1183540082 22:38424774-38424796 CCTCCGGAGACCTTGCAGCTTCT No data
Right 1183540087 22:38424802-38424824 TGCCCTCGTAGGTTGCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183540087 Original CRISPR TGCCCTCGTAGGTTGCTGCC CGG Intergenic
No off target data available for this crispr