ID: 1183540088

View in Genome Browser
Species Human (GRCh38)
Location 22:38424804-38424826
Sequence CTCCGGGCAGCAACCTACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183540088_1183540095 12 Left 1183540088 22:38424804-38424826 CCCTCGTAGGTTGCTGCCCGGAG No data
Right 1183540095 22:38424839-38424861 AATGTGATGCAGCCTATTGGAGG No data
1183540088_1183540094 9 Left 1183540088 22:38424804-38424826 CCCTCGTAGGTTGCTGCCCGGAG No data
Right 1183540094 22:38424836-38424858 AGGAATGTGATGCAGCCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183540088 Original CRISPR CTCCGGGCAGCAACCTACGA GGG (reversed) Intergenic
No off target data available for this crispr