ID: 1183540088 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:38424804-38424826 |
Sequence | CTCCGGGCAGCAACCTACGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1183540088_1183540095 | 12 | Left | 1183540088 | 22:38424804-38424826 | CCCTCGTAGGTTGCTGCCCGGAG | No data | ||
Right | 1183540095 | 22:38424839-38424861 | AATGTGATGCAGCCTATTGGAGG | No data | ||||
1183540088_1183540094 | 9 | Left | 1183540088 | 22:38424804-38424826 | CCCTCGTAGGTTGCTGCCCGGAG | No data | ||
Right | 1183540094 | 22:38424836-38424858 | AGGAATGTGATGCAGCCTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1183540088 | Original CRISPR | CTCCGGGCAGCAACCTACGA GGG (reversed) | Intergenic | ||