ID: 1183540091

View in Genome Browser
Species Human (GRCh38)
Location 22:38424820-38424842
Sequence CATTCCTTCATGGCGACTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183540091_1183540095 -4 Left 1183540091 22:38424820-38424842 CCCGGAGTCGCCATGAAGGAATG No data
Right 1183540095 22:38424839-38424861 AATGTGATGCAGCCTATTGGAGG No data
1183540091_1183540094 -7 Left 1183540091 22:38424820-38424842 CCCGGAGTCGCCATGAAGGAATG No data
Right 1183540094 22:38424836-38424858 AGGAATGTGATGCAGCCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183540091 Original CRISPR CATTCCTTCATGGCGACTCC GGG (reversed) Intergenic
No off target data available for this crispr