ID: 1183540091 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:38424820-38424842 |
Sequence | CATTCCTTCATGGCGACTCC GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1183540091_1183540094 | -7 | Left | 1183540091 | 22:38424820-38424842 | CCCGGAGTCGCCATGAAGGAATG | No data | ||
Right | 1183540094 | 22:38424836-38424858 | AGGAATGTGATGCAGCCTATTGG | No data | ||||
1183540091_1183540095 | -4 | Left | 1183540091 | 22:38424820-38424842 | CCCGGAGTCGCCATGAAGGAATG | No data | ||
Right | 1183540095 | 22:38424839-38424861 | AATGTGATGCAGCCTATTGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1183540091 | Original CRISPR | CATTCCTTCATGGCGACTCC GGG (reversed) | Intergenic | ||