ID: 1183540094

View in Genome Browser
Species Human (GRCh38)
Location 22:38424836-38424858
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183540091_1183540094 -7 Left 1183540091 22:38424820-38424842 CCCGGAGTCGCCATGAAGGAATG No data
Right 1183540094 22:38424836-38424858 AGGAATGTGATGCAGCCTATTGG No data
1183540089_1183540094 8 Left 1183540089 22:38424805-38424827 CCTCGTAGGTTGCTGCCCGGAGT No data
Right 1183540094 22:38424836-38424858 AGGAATGTGATGCAGCCTATTGG No data
1183540084_1183540094 29 Left 1183540084 22:38424784-38424806 CCTTGCAGCTTCTACCTTTGCCC No data
Right 1183540094 22:38424836-38424858 AGGAATGTGATGCAGCCTATTGG No data
1183540088_1183540094 9 Left 1183540088 22:38424804-38424826 CCCTCGTAGGTTGCTGCCCGGAG No data
Right 1183540094 22:38424836-38424858 AGGAATGTGATGCAGCCTATTGG No data
1183540092_1183540094 -8 Left 1183540092 22:38424821-38424843 CCGGAGTCGCCATGAAGGAATGT No data
Right 1183540094 22:38424836-38424858 AGGAATGTGATGCAGCCTATTGG No data
1183540086_1183540094 15 Left 1183540086 22:38424798-38424820 CCTTTGCCCTCGTAGGTTGCTGC No data
Right 1183540094 22:38424836-38424858 AGGAATGTGATGCAGCCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183540094 Original CRISPR AGGAATGTGATGCAGCCTAT TGG Intergenic