ID: 1183541019

View in Genome Browser
Species Human (GRCh38)
Location 22:38429518-38429540
Sequence CCCCGTAGGTCCCATGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183541019_1183541026 -7 Left 1183541019 22:38429518-38429540 CCTACCTCATGGGACCTACGGGG 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1183541026 22:38429534-38429556 TACGGGGACAGCAGGTGCTGGGG 0: 1
1: 0
2: 1
3: 24
4: 249
1183541019_1183541025 -8 Left 1183541019 22:38429518-38429540 CCTACCTCATGGGACCTACGGGG 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1183541025 22:38429533-38429555 CTACGGGGACAGCAGGTGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 159
1183541019_1183541024 -9 Left 1183541019 22:38429518-38429540 CCTACCTCATGGGACCTACGGGG 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1183541024 22:38429532-38429554 CCTACGGGGACAGCAGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183541019 Original CRISPR CCCCGTAGGTCCCATGAGGT AGG (reversed) Intronic
901741572 1:11345343-11345365 CCCCGCAGGTCCTGTGAGGCTGG - Intergenic
906124092 1:43415975-43415997 CCCAGTAGGTCCCCTGAGTCTGG - Exonic
915522745 1:156457371-156457393 CCCCGCAGGTCACATGAGGGCGG + Intergenic
915562818 1:156697334-156697356 CCCTACAGGTCCCATGAGGGTGG + Intergenic
917852449 1:179077077-179077099 GCCCGTGGGTCACCTGAGGTCGG + Intergenic
1077225532 11:1437666-1437688 CTCTGTGGGCCCCATGAGGTGGG - Intronic
1078486148 11:11725185-11725207 CCCAGAAGGTACCAGGAGGTGGG + Intergenic
1080614644 11:33935425-33935447 CCTCGGAGGCCCCATGAGGCAGG + Intergenic
1084901859 11:72315729-72315751 CCCCATGGGTACCATGAGGATGG - Intronic
1093544340 12:20328727-20328749 CCCAGCAGGTTCCATGATGTTGG + Intergenic
1102421208 12:112804323-112804345 CCCGGTGGATCCCATCAGGTGGG + Intronic
1113607706 13:111622251-111622273 CCCCGCAGGTCCCAGGGGCTGGG - Intronic
1121074896 14:91060161-91060183 CCCCGGGGGTCCCGGGAGGTGGG - Intronic
1121786120 14:96662396-96662418 CCCCGTTGGTCCCTGGAGGCGGG + Intergenic
1124012312 15:25848824-25848846 TCCCTTAGGTCCCATGAGAAAGG - Intronic
1127225105 15:56919360-56919382 CCCCGGCGGGCCCAGGAGGTCGG - Intronic
1135094891 16:19556439-19556461 GCCCGTAGGTCCCTTGTGGTTGG + Intronic
1137552958 16:49453090-49453112 CCCCCAAGTTCCCCTGAGGTGGG + Intergenic
1141075894 16:81006621-81006643 GCCCGTCGGCCCCAGGAGGTGGG - Intronic
1141837899 16:86554887-86554909 GCCCGTGGGCCCCTTGAGGTCGG - Intronic
1141969532 16:87471639-87471661 CCCCAGAGGTCCCATGTGGTTGG - Intronic
1142656741 17:1399690-1399712 CCCAGAAGCTCCCATGAGGGTGG + Intronic
1143030144 17:3963379-3963401 CCTTGGAGGTCCCATGAGGGTGG - Intronic
1143498388 17:7325190-7325212 CCCAGTATGGCCCATGGGGTGGG - Exonic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1151566579 17:74901838-74901860 CCCCAGAGATCCAATGAGGTGGG - Intergenic
1152491806 17:80639969-80639991 GCCCTTCTGTCCCATGAGGTGGG + Intronic
1159232967 18:65633301-65633323 CACCTTAGGTCCCATGAGTAGGG - Intergenic
1160521420 18:79510456-79510478 CCACGCAGGTGCCATCAGGTAGG - Intronic
1160982161 19:1821442-1821464 CTCCGCAGGTCCCATGTGGCCGG + Intronic
1161316145 19:3618592-3618614 CCCCGTGGCTCCCATAAGGCCGG + Intronic
926176122 2:10593816-10593838 CACTGTAGGTCACAAGAGGTTGG - Intronic
933273726 2:80261574-80261596 CCCCGTAGGGTCCACGTGGTTGG + Intronic
933643095 2:84785234-84785256 CCCCTGATGTCCCATGACGTGGG - Intronic
933950284 2:87323202-87323224 CCCAGAAGGTGCCATGAGGGTGG - Intergenic
936329904 2:111538394-111538416 CCCAGAAGGTGCCATGAGGGTGG + Intergenic
936463122 2:112726036-112726058 CCCCGTAGGCCCCATGGGACAGG - Intronic
938812101 2:134863040-134863062 CCCCCTACCTCCCAGGAGGTCGG - Intronic
939373828 2:141338190-141338212 GACCTTAGGTCCCAAGAGGTTGG - Intronic
945064285 2:205935594-205935616 GCCCTCAGGTCCTATGAGGTTGG + Intergenic
1169689670 20:8316520-8316542 ACCCGGAGTTCCCATGAGATTGG + Intronic
1175656610 20:60776400-60776422 CCCCGTAGGTCCCATCCGACGGG - Intergenic
1175656621 20:60776433-60776455 CCCCGTAGGTCCCATCCGATGGG - Intergenic
1175656632 20:60776466-60776488 CCCCGTAGGTCCCATCCGATGGG - Intergenic
1175656643 20:60776499-60776521 CCCCGTAGGTCCCATCCGATGGG - Intergenic
1175656654 20:60776532-60776554 CCCCGTAGGTCCCATCCTATGGG - Intergenic
1182430713 22:30297382-30297404 CCTAGCAGTTCCCATGAGGTAGG + Intronic
1183541019 22:38429518-38429540 CCCCGTAGGTCCCATGAGGTAGG - Intronic
1184113376 22:42408460-42408482 CCCCGAAGGTCCCCGGAGGGTGG + Intronic
949125969 3:445552-445574 CCCAGTGGGTCCCTAGAGGTGGG - Intergenic
961402026 3:126654586-126654608 CCCCGGTCGTCCCCTGAGGTGGG - Intronic
971375993 4:26056232-26056254 CCCCCTAGGTCCCAGGCTGTTGG - Intergenic
971766734 4:30842030-30842052 GACCGTTGGTCCCATGAGCTGGG + Intronic
978107134 4:104916738-104916760 CCCCTCAGGCCCCTTGAGGTAGG + Intergenic
982055821 4:151547978-151548000 CCCCTGTAGTCCCATGAGGTAGG + Intronic
984316524 4:178137998-178138020 CCCTTTTTGTCCCATGAGGTGGG - Intergenic
984735284 4:183102430-183102452 TCCCGTTGGTCCTGTGAGGTAGG + Intronic
986195476 5:5533631-5533653 GCCCATAGGTCACATCAGGTGGG - Intergenic
997661884 5:135595338-135595360 CCTCCTAGAGCCCATGAGGTTGG - Intergenic
1004728465 6:18334143-18334165 CCAAGGAGGACCCATGAGGTTGG - Intergenic
1005832339 6:29680915-29680937 CCCCGGAGGACCCCAGAGGTTGG + Intronic
1018920369 6:168168195-168168217 CCCCCTGGGTCCCCTGAGGCTGG - Intergenic
1019427474 7:984341-984363 CCCCTTAGGTCCCCTCAGGCCGG - Intronic
1024226703 7:47330899-47330921 CCCTGTAGGACCCGTGAGGCTGG - Intronic
1024606911 7:51029021-51029043 CCTCGTTGGTGCCATGATGTTGG + Exonic
1034695995 7:153054187-153054209 CCACATAGGACCCATGAGATGGG - Intergenic
1042966100 8:74354230-74354252 CACTGTAAGTACCATGAGGTTGG + Intronic
1055012016 9:71577535-71577557 CCCACTAGGTCTCATGAGGTAGG - Intergenic
1200249138 X:154542897-154542919 GCACATAGGTCCCATGAGGAGGG + Intronic