ID: 1183545215

View in Genome Browser
Species Human (GRCh38)
Location 22:38451801-38451823
Sequence ACCCATCAGGGTCACAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 1, 2: 3, 3: 24, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183545215_1183545218 -7 Left 1183545215 22:38451801-38451823 CCATCACTGTGACCCTGATGGGT 0: 1
1: 1
2: 3
3: 24
4: 208
Right 1183545218 22:38451817-38451839 GATGGGTCTACTTCCCCCTCAGG 0: 1
1: 0
2: 1
3: 8
4: 79
1183545215_1183545224 22 Left 1183545215 22:38451801-38451823 CCATCACTGTGACCCTGATGGGT 0: 1
1: 1
2: 3
3: 24
4: 208
Right 1183545224 22:38451846-38451868 TTTCCACTTTTGTAAAACGAAGG 0: 1
1: 1
2: 9
3: 111
4: 794

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183545215 Original CRISPR ACCCATCAGGGTCACAGTGA TGG (reversed) Intronic
900986400 1:6075392-6075414 CTCCATCAGGAACACAGTGATGG + Intronic
901671309 1:10857879-10857901 ACCCACCAGGCCCACAGTGAGGG - Intergenic
901821669 1:11834374-11834396 CCCCATCATGGTCACACTGATGG + Exonic
902036927 1:13464668-13464690 ACCCATCAGAATGACAGTCATGG + Intergenic
902161154 1:14531462-14531484 ACCCATCAGGATCACGTTGTGGG + Intergenic
902711481 1:18243008-18243030 TCCCATCAGGCGCTCAGTGAAGG + Intronic
903963773 1:27073305-27073327 TCCAATCAGGGTCTCACTGAAGG + Intergenic
904675670 1:32197932-32197954 AGCCCTCAGGGCCACCGTGATGG - Exonic
904699057 1:32347499-32347521 ACCCATCAAGGCCACAGTCCTGG + Intergenic
905174210 1:36125853-36125875 TCCCATGAGGTGCACAGTGAGGG + Intergenic
907246525 1:53112734-53112756 ACCCAACAGGGTCACCCAGAGGG + Intronic
910384567 1:86666636-86666658 ACCCAGCACAGTCCCAGTGATGG + Intergenic
913326830 1:117635012-117635034 TCCCATCAGGGTCACAATTTCGG + Intergenic
915501819 1:156324310-156324332 ACCCACCTGGGCCAAAGTGATGG + Intronic
916055578 1:161067104-161067126 AGACAACAGGGTCACAGAGATGG + Intronic
918756416 1:188344019-188344041 ACCCAGCAGAGTCATAGTGTTGG - Intergenic
920859530 1:209694092-209694114 AGCCACCAGGGACAGAGTGAAGG - Intronic
922021565 1:221710105-221710127 ACCCATCAGGGTCATAGTTCAGG + Intronic
922183513 1:223254995-223255017 ACCCACCAGGGTCACAGGCAAGG + Intronic
922642356 1:227246445-227246467 ACCCAGCACAGTCCCAGTGATGG + Intronic
1065093111 10:22253469-22253491 ACATGTCAGGGTCACAGCGAAGG + Intergenic
1070746120 10:78935011-78935033 GCCCATCAGGATCACATGGATGG - Intergenic
1071137442 10:82468449-82468471 ACAGATCTGGGTCACATTGAAGG - Intronic
1076126660 10:127979351-127979373 AGCCATCAGCGTCGCAGTGTTGG + Intronic
1077044308 11:537711-537733 AGCCATCGGGGACCCAGTGATGG + Intronic
1077506127 11:2930719-2930741 GCCCTTCAGGGTCACTGTAAAGG + Intergenic
1077698599 11:4418602-4418624 ACCCCACAAGGTCACAGTGCAGG - Intergenic
1077912113 11:6580971-6580993 ACCCAGCATAATCACAGTGATGG + Intronic
1079476289 11:20833005-20833027 ACCCATAAGAGTCACTGGGAAGG - Intronic
1080084112 11:28258299-28258321 ACCCAGCATAGTCACAGTGGTGG - Intronic
1083756173 11:64792754-64792776 ACCCCAGAGAGTCACAGTGAAGG + Intronic
1087313277 11:96576566-96576588 ACCCAGCACCGTCCCAGTGATGG - Intergenic
1089103347 11:115982368-115982390 ACCCATCTGGGTCAGGTTGAGGG - Intergenic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1092684795 12:11030754-11030776 ACATAGCAGGGTCAGAGTGAAGG + Exonic
1092687103 12:11061713-11061735 AGATATCAGGGTCAGAGTGAAGG + Exonic
1092692840 12:11133663-11133685 AGATATCAGGGTCAGAGTGAGGG + Exonic
1097563551 12:61239288-61239310 ACCCAGCACAGTCATAGTGATGG - Intergenic
1097817885 12:64095607-64095629 ACCCCCTAGGGTCACAGGGAAGG - Intronic
1099616211 12:84938802-84938824 ACCCAGCACAGTCCCAGTGATGG + Intergenic
1101287405 12:103329197-103329219 ACCCATCAGGGACACAGAGAAGG + Intronic
1103062501 12:117870135-117870157 ACCCCTCAGGGGCAGAGAGAGGG + Intronic
1103755969 12:123207423-123207445 AAGCATCAGAGTCTCAGTGACGG - Intronic
1103861582 12:124019019-124019041 ACCCAAAAGGCTGACAGTGAAGG + Intronic
1104322727 12:127766986-127767008 ATCCATCATGGTCACAAAGAGGG + Intergenic
1105213985 13:18273854-18273876 GCCCATCAGGGTCACAAGGAAGG - Intergenic
1105586360 13:21748104-21748126 ATCCATAAGGTTCACAGTGAGGG + Intergenic
1106920720 13:34560723-34560745 ACCTATCAGGAATACAGTGAAGG + Intergenic
1108569017 13:51730922-51730944 GCCCAGCATGGTCTCAGTGATGG - Intronic
1111925845 13:94462579-94462601 ATCAATCAGGGTCACAATCATGG + Intronic
1111929795 13:94501931-94501953 ACCCAGCAAGGGCAGAGTGAGGG - Intergenic
1113244133 13:108376379-108376401 ACCCAGCAGAGTCACAGTGGGGG - Intergenic
1114917401 14:27285793-27285815 ACCCTGCAAAGTCACAGTGAAGG + Intergenic
1115319126 14:32059621-32059643 ACACAGCAGGGTGACTGTGAAGG + Intergenic
1115534998 14:34364580-34364602 AACCATCACGATCAGAGTGAAGG + Intronic
1116504739 14:45664818-45664840 ACCCAGCACAGTCACAGTGGTGG - Intergenic
1116762162 14:49027469-49027491 TCACATCCGGGTCACAGTGGTGG - Intergenic
1118956748 14:70489630-70489652 ACCCAACAAAGTCACAGTGGTGG + Intergenic
1119709025 14:76807918-76807940 TCACATCAGGGTCCCAGTGCTGG + Exonic
1120693731 14:87621311-87621333 ACCCTGCAGAGTCACAGTGATGG - Intergenic
1121759656 14:96434511-96434533 ACCCAGCACAGTCACAGTGGTGG - Intronic
1122110035 14:99493100-99493122 ACCCATTAGGATCACAGTTGAGG + Intronic
1122713581 14:103679178-103679200 ACCCCTCAGAGGAACAGTGATGG - Intronic
1124081275 15:26500722-26500744 ACCCAGCACGGTCCCAGTGGTGG - Intergenic
1127140487 15:55970490-55970512 ACCCAACACAGTCCCAGTGATGG + Intronic
1127493335 15:59485338-59485360 ACCCATCAGAGTCCCAATGGTGG + Intronic
1127994480 15:64145147-64145169 ACCCTGCAGGGTGACAGTGCTGG - Intronic
1130051589 15:80487976-80487998 GCACATAAGGTTCACAGTGAGGG - Intronic
1130577885 15:85108406-85108428 ACCCAGCAGGTGCACAGAGAAGG + Intronic
1131109445 15:89755993-89756015 ACCCATCAGGCTCACTGGGCTGG - Intergenic
1132730133 16:1356993-1357015 ACACATCAGGGTCTCTGGGATGG + Intronic
1133393382 16:5427103-5427125 ACACATCAGGATGACAGGGAAGG - Intergenic
1134379184 16:13708521-13708543 TCAAATCATGGTCACAGTGAAGG + Intergenic
1136057520 16:27701511-27701533 ACACAGCAGGGTCACGGTCAAGG - Intronic
1138143173 16:54586012-54586034 ACCCACCAAGGTGACAGAGAAGG - Intergenic
1138299158 16:55911994-55912016 ACCAAGCAAGGTGACAGTGATGG + Intronic
1138638188 16:58361208-58361230 ACCCAGCACAGTCACAGTGTTGG - Intronic
1138756265 16:59489936-59489958 TCCCATGAGCTTCACAGTGAGGG + Intergenic
1138809929 16:60137941-60137963 ACCCATCAGACTAACAGTGGAGG - Intergenic
1140037507 16:71382551-71382573 ACCCTTCAAGGTCACAGAGAAGG - Intronic
1140443372 16:75003831-75003853 ACCTCTCAGAGTCATAGTGAGGG + Intronic
1144394070 17:14826551-14826573 ATCCGTCAGGGTCACATTCATGG - Intergenic
1144621286 17:16820131-16820153 ACCCATCCTGACCACAGTGAGGG + Intergenic
1144955614 17:19017507-19017529 AGCCATCAGGGTCACCGGCATGG - Intronic
1146357184 17:32143838-32143860 ACCCCTCAGGGTCACCGTGATGG + Intronic
1147573261 17:41584445-41584467 ACCCATCCTGATCACAGCGAGGG + Intronic
1149157263 17:53647173-53647195 ACCCAGCAAAGTCATAGTGATGG - Intergenic
1152351218 17:79784976-79784998 CCTCATCACCGTCACAGTGAAGG + Exonic
1152487716 17:80605469-80605491 ACTCATCACGGACACAGTAACGG - Intronic
1154122441 18:11662943-11662965 GCCCATCAGGGGCAGTGTGAGGG + Intergenic
1159008729 18:63038587-63038609 TCCCAGCAGAGACACAGTGATGG + Intergenic
1159080707 18:63732064-63732086 ACCCACCACGGTCTCAGTGGTGG + Intergenic
1161075021 19:2281307-2281329 ACACATCAGGGGCCCAGAGAGGG - Intronic
1161075082 19:2281565-2281587 ACACATCAGGGGCCCAGAGAGGG - Intronic
1161245301 19:3248419-3248441 AGCCATCAGATTCACAGAGATGG - Intronic
1161796882 19:6392461-6392483 ACCCAGCAGAGTCACAGTTTAGG + Intronic
1164457029 19:28417541-28417563 ACTCAGCACAGTCACAGTGATGG - Intergenic
1164678433 19:30118498-30118520 ACCCATGAGCCTCACAGTCAGGG - Intergenic
1164868384 19:31623943-31623965 TCTCTTCAAGGTCACAGTGATGG + Intergenic
1165388987 19:35527632-35527654 GCCCACCATGGTCTCAGTGAGGG - Exonic
1165705423 19:37972947-37972969 ACTAATCAGGATCACAGGGAAGG - Intronic
1166413136 19:42570313-42570335 ACTCATCATGTTCCCAGTGAGGG + Intergenic
1168230175 19:55026141-55026163 TGCCCCCAGGGTCACAGTGAGGG - Intronic
925336502 2:3102576-3102598 ACCCATCAGGGTCAAACCCAGGG - Intergenic
927788597 2:25992004-25992026 ACCCATTAGGTTCTCAGTAAAGG - Intergenic
931246873 2:60499304-60499326 ACCCTTCTGGGCCACAGTGCTGG + Intronic
932740556 2:74287621-74287643 AGCCTTGAGGGACACAGTGAGGG - Intronic
933053721 2:77634183-77634205 ACCCATCATAGCCCCAGTGATGG - Intergenic
933341549 2:81033039-81033061 ACCCAACAGAGTCTCAGTGGTGG - Intergenic
934300339 2:91772895-91772917 GCCCATCAGGGTCACAAGGAAGG + Intergenic
934929097 2:98405446-98405468 ACCCAGCACAGTCTCAGTGATGG + Intergenic
941582261 2:167313738-167313760 ATCTGTCAGGATCACAGTGATGG - Intergenic
946131995 2:217613575-217613597 GCCAATCAAAGTCACAGTGATGG + Intronic
948428205 2:237901931-237901953 CCCCATCCTGGGCACAGTGATGG + Intronic
948429696 2:237911713-237911735 CACCAGCAGGGTCACCGTGATGG - Exonic
948887762 2:240892588-240892610 GGCCAGCAGGCTCACAGTGACGG + Intronic
948887775 2:240892642-240892664 GGCCAGCAGGCTCACAGTGACGG + Intronic
1169687619 20:8293131-8293153 GCCCATCAAGCTCACAGTGGTGG + Intronic
1170311583 20:14997820-14997842 ACCCAGCATAGTCCCAGTGACGG + Intronic
1171354964 20:24536856-24536878 ACCCAACAGAGCCCCAGTGATGG - Intronic
1172122654 20:32607944-32607966 GCCCAGGAGGGGCACAGTGAGGG + Intronic
1173431266 20:42988861-42988883 ACCCATGAGCATCACAATGATGG + Intronic
1174095872 20:48089111-48089133 ACCCAGCAGGTTCACACAGATGG - Intergenic
1174759773 20:53195623-53195645 ACCCGTCAGGGTCACTGTCCTGG - Intronic
1175106668 20:56620068-56620090 ACAGATCTGAGTCACAGTGAGGG + Intergenic
1179894668 21:44354813-44354835 ACCCCTCAGGGCCTCAGTGAAGG + Intronic
1181439520 22:22928608-22928630 AGGCCTCAGGGTCACTGTGAGGG - Intergenic
1181698693 22:24608028-24608050 GCCCATCAGGGTCCCAAGGAAGG + Intronic
1183248778 22:36713597-36713619 ACCCATCAGGGTCCAGGAGATGG - Intergenic
1183545194 22:38451705-38451727 ACCCATGAGGGTCACAGTGATGG - Intronic
1183545215 22:38451801-38451823 ACCCATCAGGGTCACAGTGATGG - Intronic
1184581730 22:45422533-45422555 GCCCATCAGGGTCTCTGTCAGGG - Intronic
1184973135 22:48042211-48042233 GCCCATCAGGGTAACAGAGGAGG - Intergenic
950632116 3:14289039-14289061 ACCACCCAGGGTCACAGTGGGGG + Intergenic
950652468 3:14415859-14415881 ACACACCAGGGCCAGAGTGAGGG - Intronic
952008794 3:28875421-28875443 ACCCAGCACAGTCCCAGTGATGG - Intergenic
952453144 3:33449858-33449880 ACATATCAGGGGCTCAGTGAGGG - Intergenic
952553473 3:34505074-34505096 ACCAATCAGGAACACAGTGAGGG + Intergenic
953867216 3:46594911-46594933 AGCCTTCAGGGGCACAGAGAGGG - Intronic
955203452 3:56873893-56873915 CCCCATCAAGGTCACTTTGAAGG + Intronic
956146607 3:66197301-66197323 AGGCATCAGGGACATAGTGACGG + Intronic
956249941 3:67225351-67225373 GACCAGCAGGGTCACAGAGATGG - Intergenic
959834097 3:110898055-110898077 AGACATCAGGGTCACATGGAGGG + Intergenic
962465247 3:135651398-135651420 ACAGGTCAGGGACACAGTGAAGG + Intergenic
963259418 3:143177624-143177646 GCCCCTCAGGGTCACAGGGGTGG + Intergenic
964945232 3:162214592-162214614 ACTCACAAGGGTCACAATGAAGG - Intergenic
965264397 3:166522224-166522246 ACGCAGCACAGTCACAGTGATGG - Intergenic
965577580 3:170233691-170233713 ACCCATCAGAGACTCAATGAAGG - Intronic
967453700 3:189655836-189655858 ACCCATCAGGTTCTCACTGTAGG + Intronic
968309163 3:197668477-197668499 ACTCATCAGGGTCTCCGGGAAGG - Intergenic
969838946 4:9866488-9866510 AATCAACAGGGTCAAAGTGAAGG - Intronic
970100420 4:12515074-12515096 ACCCTGCAGAGCCACAGTGAGGG + Intergenic
971567735 4:28167490-28167512 ACCCAGCATAGTCACAGTGGTGG - Intergenic
972207881 4:36799396-36799418 ACCCAGCACAGTCACAGTGGTGG + Intergenic
973796240 4:54429796-54429818 TCCCATCAGGGTAACTGTCATGG - Intergenic
974267044 4:59598774-59598796 ACCCAACACGGTCCCAGTGGTGG + Intergenic
974414882 4:61594682-61594704 ACCCAGCACAGTCCCAGTGATGG - Intronic
975035188 4:69670519-69670541 ACCCAGCACAGTCACAGTGGTGG + Intergenic
975095220 4:70449870-70449892 ACCCAGCATGGTCATAGTGGTGG - Intronic
976444209 4:85111182-85111204 ATCCAGCACGGTCCCAGTGATGG + Intergenic
977396616 4:96479029-96479051 ACCCTGCAGAGTCACAGGGATGG + Intergenic
980660706 4:135854900-135854922 ACCCAGCGCGGTCACAGTGGTGG - Intergenic
983399998 4:167250713-167250735 ACTCAGCAAGGTGACAGTGAAGG - Intergenic
984189801 4:176592114-176592136 ATCCCTCAGGGTGACAATGAAGG + Intergenic
984872137 4:184335220-184335242 AGACATCAGTGTCACAGTCATGG - Intergenic
986544339 5:8879532-8879554 ACCCAGCACAGTCACAGTGGTGG - Intergenic
992003051 5:72453713-72453735 ACCCAGCAGGGTGACACTGATGG + Intronic
994229480 5:97297485-97297507 ACCCAACAGGGTCCCAGTCATGG - Intergenic
994974201 5:106780692-106780714 ACCCAGCAGAGTCCCAGTGTTGG + Intergenic
1001628876 5:173159971-173159993 CCCCATGAGGCTCTCAGTGATGG - Exonic
1001935426 5:175700182-175700204 ACCCTTGAGGGAGACAGTGAGGG - Intergenic
1003638522 6:7856951-7856973 ACCCATCAAGGTCACAATGCCGG - Intronic
1003899545 6:10641395-10641417 ACCCATCAGGGTGACACTGAAGG - Intergenic
1005171653 6:22992755-22992777 ACTCATCAGAGTCACAGAAAAGG - Intergenic
1006186855 6:32186355-32186377 GCCCCTCAGGGTCACAGGGGTGG - Exonic
1007281314 6:40714403-40714425 ACCTCACAGGGTCATAGTGAAGG + Intergenic
1007294547 6:40812053-40812075 TCCCAAGAGGGTCAGAGTGATGG - Intergenic
1007507789 6:42349675-42349697 ACCAGGGAGGGTCACAGTGATGG + Intronic
1007559147 6:42791593-42791615 ACCCATCAGGGTCTCAAACAAGG - Intronic
1007712425 6:43833262-43833284 ACCCATCAGAGTCAGAGGCAAGG - Intergenic
1010502293 6:76615620-76615642 ACCCAGCACAGTCCCAGTGATGG + Intergenic
1012940576 6:105410388-105410410 ACCCAGCAGTGTCCCAGTGGTGG + Intergenic
1014215177 6:118746144-118746166 ACCCTGCAGGGATACAGTGATGG + Intergenic
1016108227 6:140188817-140188839 ACCCATCAGAGCCACAGGGGTGG + Intergenic
1018927938 6:168219741-168219763 ACCCACCAGGTTCACAGTTCAGG - Intergenic
1019075957 6:169388286-169388308 TCCCATCAGGATCACAGGAATGG - Intergenic
1019133075 6:169891440-169891462 CTCCATGAGGCTCACAGTGATGG - Intergenic
1019133135 6:169891830-169891852 CTCCATGAGGCTCACAGTGATGG - Intergenic
1019133253 6:169892586-169892608 CTCCACCAGGCTCACAGTGATGG - Intergenic
1021034902 7:15785523-15785545 ACCCAGCACAGTCCCAGTGATGG + Intergenic
1022042715 7:26595608-26595630 GCTCATCAGAGTCACAGTGAGGG - Intergenic
1024561952 7:50652314-50652336 TCCCATCAGGGCCACGGTTATGG + Intronic
1028631744 7:92942607-92942629 ATCCATCATGGTCACAGAGTGGG - Intergenic
1029506647 7:100967100-100967122 ACCTGTCAGAGTCACAGTGAGGG - Exonic
1030088888 7:105840126-105840148 GCCCACAAGGGCCACAGTGAGGG + Intronic
1031256588 7:119458537-119458559 GGCCATCAAGTTCACAGTGATGG - Intergenic
1034037265 7:147837807-147837829 TCACATCCGGGTCACACTGATGG + Intronic
1034890109 7:154832259-154832281 TCCCAGCATTGTCACAGTGAAGG - Intronic
1035665435 8:1376647-1376669 TCCCACCGGGGTCAGAGTGAGGG - Intergenic
1036289412 8:7474093-7474115 ACCCATCTGAATCACAGTGGAGG + Intronic
1036332067 8:7837439-7837461 ACCCATCTGAATCACAGTGGAGG - Intronic
1036397820 8:8383935-8383957 ACCCATCAGCGTCCCAGGAAGGG - Intronic
1036430530 8:8685621-8685643 CCTCAGCAGCGTCACAGTGATGG + Intergenic
1038027693 8:23606785-23606807 ACCCATCAGGGTCAGGGGCATGG - Intergenic
1040440115 8:47432658-47432680 ACTCACCAGGGAGACAGTGATGG + Intronic
1043945900 8:86252447-86252469 ACCCAGCACAGTCACAGTGGTGG - Intronic
1044124360 8:88438746-88438768 ACCCAGTACGGTCCCAGTGATGG + Intergenic
1044476612 8:92633693-92633715 ACCCATCAGGGTCTCATAGCTGG - Intergenic
1048646756 8:136429009-136429031 ACCCAGCACAGTCACAGTGATGG + Intergenic
1050248272 9:3714329-3714351 ACCCAGCACGGTCCCAGTGGTGG + Intergenic
1051434986 9:17021302-17021324 CCCCATCTGGGCCACAGTGCAGG + Intergenic
1052880399 9:33598236-33598258 ACTCACTAGGGTCACAGTCAGGG + Intergenic
1053495577 9:38545982-38546004 ACTCACTAGGGTCACAGTCAGGG - Intronic
1056211144 9:84366808-84366830 ACCCAGCACAGTCACAGTGGTGG - Intergenic
1057187500 9:93065083-93065105 ACCCACCAGGGTCCCAGGGAAGG - Intronic
1058307670 9:103463743-103463765 ACACATCCAGGTCACACTGATGG + Intergenic
1060801301 9:126547481-126547503 GCCCAACAGGGTCCCAGGGAAGG - Intergenic
1061546870 9:131309533-131309555 GTCCATCAGCATCACAGTGAGGG - Intergenic
1186875503 X:13812561-13812583 ATCCATCACAGTCACAGAGAGGG + Intronic
1187254192 X:17627260-17627282 ATCCATCAGGAGCTCAGTGAGGG + Intronic
1189870122 X:45372296-45372318 ACCCAGCACAGTCCCAGTGATGG + Intergenic
1191636534 X:63383951-63383973 AAACATCAGTGTCACAGTCATGG - Intergenic
1191780463 X:64858674-64858696 AGCCATCAAGGTCACGGTGATGG - Intergenic
1192785643 X:74332250-74332272 ACATATCAGTGTCACAGTCATGG + Intergenic
1193204759 X:78735779-78735801 AACCAGCAGAGTCACAGTGCTGG - Intergenic
1193529643 X:82641691-82641713 ACCCAGCAGAGTCCCAGTGGTGG - Intergenic
1193925146 X:87475622-87475644 ACCCAGCACAGTCATAGTGATGG - Intergenic
1194285584 X:92007028-92007050 ACCCAGCAGGGTCATAGTGGTGG - Intronic
1194595260 X:95848866-95848888 ACCCAGCAGAGTCACAGTGGTGG + Intergenic
1195115869 X:101697083-101697105 ACCCAGCACAGTCCCAGTGATGG + Intergenic
1195136306 X:101909999-101910021 ACCCAGCATAGTCACAGTGGTGG + Intronic
1195333821 X:103830618-103830640 TCCCATCAGGGTCTCAGTCTTGG + Intronic
1197113032 X:122798354-122798376 ACCCAGCACAGTCACAGTGGTGG + Intergenic
1199304029 X:146245740-146245762 ACCCAGCAAAGTCACAGTGATGG + Intergenic
1200555324 Y:4630697-4630719 ATCCAGCATAGTCACAGTGATGG - Intergenic
1200603152 Y:5231566-5231588 ACCCAGCAGGGTCATAGTGGTGG - Intronic
1202024018 Y:20501391-20501413 ACCCAGCATAATCACAGTGATGG - Intergenic