ID: 1183547217

View in Genome Browser
Species Human (GRCh38)
Location 22:38460885-38460907
Sequence TAGAAGTTCCCCACTAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183547217_1183547225 6 Left 1183547217 22:38460885-38460907 CCTTACTTAGTGGGGAACTTCTA No data
Right 1183547225 22:38460914-38460936 CAGGGCAGAGGGTAAGGAGGAGG No data
1183547217_1183547220 -6 Left 1183547217 22:38460885-38460907 CCTTACTTAGTGGGGAACTTCTA No data
Right 1183547220 22:38460902-38460924 CTTCTACAACCACAGGGCAGAGG No data
1183547217_1183547226 9 Left 1183547217 22:38460885-38460907 CCTTACTTAGTGGGGAACTTCTA No data
Right 1183547226 22:38460917-38460939 GGCAGAGGGTAAGGAGGAGGTGG No data
1183547217_1183547222 0 Left 1183547217 22:38460885-38460907 CCTTACTTAGTGGGGAACTTCTA No data
Right 1183547222 22:38460908-38460930 CAACCACAGGGCAGAGGGTAAGG No data
1183547217_1183547221 -5 Left 1183547217 22:38460885-38460907 CCTTACTTAGTGGGGAACTTCTA No data
Right 1183547221 22:38460903-38460925 TTCTACAACCACAGGGCAGAGGG No data
1183547217_1183547230 27 Left 1183547217 22:38460885-38460907 CCTTACTTAGTGGGGAACTTCTA No data
Right 1183547230 22:38460935-38460957 GGTGGCAGGCAGGTGGATGAAGG No data
1183547217_1183547224 3 Left 1183547217 22:38460885-38460907 CCTTACTTAGTGGGGAACTTCTA No data
Right 1183547224 22:38460911-38460933 CCACAGGGCAGAGGGTAAGGAGG No data
1183547217_1183547229 20 Left 1183547217 22:38460885-38460907 CCTTACTTAGTGGGGAACTTCTA No data
Right 1183547229 22:38460928-38460950 AGGAGGAGGTGGCAGGCAGGTGG No data
1183547217_1183547231 28 Left 1183547217 22:38460885-38460907 CCTTACTTAGTGGGGAACTTCTA No data
Right 1183547231 22:38460936-38460958 GTGGCAGGCAGGTGGATGAAGGG No data
1183547217_1183547228 17 Left 1183547217 22:38460885-38460907 CCTTACTTAGTGGGGAACTTCTA No data
Right 1183547228 22:38460925-38460947 GTAAGGAGGAGGTGGCAGGCAGG No data
1183547217_1183547227 13 Left 1183547217 22:38460885-38460907 CCTTACTTAGTGGGGAACTTCTA No data
Right 1183547227 22:38460921-38460943 GAGGGTAAGGAGGAGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183547217 Original CRISPR TAGAAGTTCCCCACTAAGTA AGG (reversed) Intergenic
No off target data available for this crispr