ID: 1183547227

View in Genome Browser
Species Human (GRCh38)
Location 22:38460921-38460943
Sequence GAGGGTAAGGAGGAGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183547215_1183547227 21 Left 1183547215 22:38460877-38460899 CCAGAAATCCTTACTTAGTGGGG No data
Right 1183547227 22:38460921-38460943 GAGGGTAAGGAGGAGGTGGCAGG No data
1183547217_1183547227 13 Left 1183547217 22:38460885-38460907 CCTTACTTAGTGGGGAACTTCTA No data
Right 1183547227 22:38460921-38460943 GAGGGTAAGGAGGAGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183547227 Original CRISPR GAGGGTAAGGAGGAGGTGGC AGG Intergenic
No off target data available for this crispr