ID: 1183548010

View in Genome Browser
Species Human (GRCh38)
Location 22:38465636-38465658
Sequence AGCCCCCACTGTGTGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183548010_1183548017 11 Left 1183548010 22:38465636-38465658 CCCCAACACACACAGTGGGGGCT No data
Right 1183548017 22:38465670-38465692 GGACAGATGTTTTCACCAAATGG No data
1183548010_1183548014 -10 Left 1183548010 22:38465636-38465658 CCCCAACACACACAGTGGGGGCT No data
Right 1183548014 22:38465649-38465671 AGTGGGGGCTGCTTCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183548010 Original CRISPR AGCCCCCACTGTGTGTGTTG GGG (reversed) Intergenic
No off target data available for this crispr