ID: 1183551488

View in Genome Browser
Species Human (GRCh38)
Location 22:38489450-38489472
Sequence TTACCCGAACCCAGGTTCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 66}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183551488_1183551495 18 Left 1183551488 22:38489450-38489472 CCGGAGAACCTGGGTTCGGGTAA 0: 1
1: 0
2: 1
3: 4
4: 66
Right 1183551495 22:38489491-38489513 CGCCTCCCCCAAGGATAATTGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1183551488_1183551494 17 Left 1183551488 22:38489450-38489472 CCGGAGAACCTGGGTTCGGGTAA 0: 1
1: 0
2: 1
3: 4
4: 66
Right 1183551494 22:38489490-38489512 ACGCCTCCCCCAAGGATAATTGG 0: 1
1: 0
2: 1
3: 8
4: 83
1183551488_1183551496 19 Left 1183551488 22:38489450-38489472 CCGGAGAACCTGGGTTCGGGTAA 0: 1
1: 0
2: 1
3: 4
4: 66
Right 1183551496 22:38489492-38489514 GCCTCCCCCAAGGATAATTGGGG 0: 1
1: 0
2: 0
3: 7
4: 73
1183551488_1183551491 9 Left 1183551488 22:38489450-38489472 CCGGAGAACCTGGGTTCGGGTAA 0: 1
1: 0
2: 1
3: 4
4: 66
Right 1183551491 22:38489482-38489504 GTCCTCCAACGCCTCCCCCAAGG 0: 1
1: 0
2: 0
3: 14
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183551488 Original CRISPR TTACCCGAACCCAGGTTCTC CGG (reversed) Intronic
902077825 1:13801762-13801784 TTTCCCGAAACCAGGTTCAGTGG - Intronic
906809421 1:48811025-48811047 TTCCCCCATCCCTGGTTCTCTGG + Intronic
907147938 1:52253578-52253600 TTGCCAAAACTCAGGTTCTCAGG - Intronic
910723085 1:90309248-90309270 TGCCCCCAACCCAAGTTCTCAGG - Intergenic
913026260 1:114844483-114844505 TCACCCGAACCCAGGAGGTCGGG - Intergenic
915442956 1:155957732-155957754 TGACCCGGATCCAGGTGCTCCGG + Exonic
919778517 1:201208776-201208798 CTCCCCGAACCCATATTCTCAGG - Exonic
923341348 1:233009793-233009815 TTAGGAGACCCCAGGTTCTCTGG - Intronic
1064427875 10:15245873-15245895 GTAGCAGAACCCAGGTTTTCAGG + Intronic
1070166107 10:73899229-73899251 TTCCCAGAACCCAGGCTCTCTGG + Intergenic
1070667309 10:78354347-78354369 TTACCCCATCTCTGGTTCTCTGG - Intergenic
1076475164 10:130746607-130746629 TTCCCCCAACCCTGGTGCTCTGG + Intergenic
1076475173 10:130746639-130746661 TTCCCCCAACCCTGGTGCTCTGG + Intergenic
1076611074 10:131726184-131726206 TTGCCCGGAGCCAGGTTCTCAGG + Intergenic
1081804527 11:45883278-45883300 TTACCAAAACCCTGGTTCCCAGG - Intergenic
1081850026 11:46269098-46269120 TTACTGGAATCCAGGGTCTCAGG - Intergenic
1083863137 11:65436573-65436595 TTACACATACACAGGTTCTCTGG - Intergenic
1086667203 11:89497331-89497353 ATACCCGAATCCATGTTTTCTGG + Intronic
1088028062 11:105210693-105210715 TTACCCTACCCCAGACTCTCAGG + Intergenic
1091819308 12:3463032-3463054 TAACCCAACCCCAGGTTCTAGGG - Intronic
1110259091 13:73465128-73465150 TCACACAACCCCAGGTTCTCTGG + Intergenic
1110602842 13:77395688-77395710 TTACCTGAACCCAGGAGGTCGGG + Intergenic
1111101851 13:83598261-83598283 ATACCCATACCCAGGTTCCCTGG - Intergenic
1117048119 14:51833466-51833488 TTACCCTACTCCAGGTTCTAAGG - Intronic
1119744554 14:77034645-77034667 TTACTGGAAACCAGGTTCCCTGG + Intergenic
1121908683 14:97769710-97769732 ACATCAGAACCCAGGTTCTCTGG - Intergenic
1122116137 14:99528214-99528236 CTACCTGAAGCCAGCTTCTCGGG + Intronic
1130857090 15:87849689-87849711 TGACCCAATCCCAGCTTCTCAGG - Intergenic
1131302214 15:91209736-91209758 TTACCTAAACCCAAATTCTCAGG + Intronic
1132111326 15:99104456-99104478 TTACTCGAACCCAGGAGTTCAGG - Intronic
1133036244 16:3035881-3035903 TTCCCAGAACCCAGGTTCTCAGG + Intronic
1135496913 16:22960788-22960810 TTACCTGAACACAGATTGTCAGG + Intergenic
1145806008 17:27730729-27730751 TGACCAGAACCTGGGTTCTCAGG + Intergenic
1146176885 17:30670827-30670849 TTACCTGAACTCAGGATCTTAGG + Intergenic
1146350349 17:32086927-32086949 TTACCTGAACTCAGGATCTTAGG + Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1162412047 19:10512184-10512206 TTTCCAGAACCCAGGAGCTCAGG - Intergenic
1166046945 19:40235382-40235404 CTGCCCGAACCCAGCTGCTCCGG - Intronic
925890767 2:8432640-8432662 TTACCAGAACCCAAATTCTGTGG + Intergenic
926058830 2:9792699-9792721 TATCCCGAAGCCAGGTTCGCAGG - Intergenic
926306054 2:11637895-11637917 TTACCTGAACCTGGGATCTCAGG + Exonic
934778300 2:96952695-96952717 TACCCCAAACCCAGGCTCTCTGG - Intronic
946712231 2:222517872-222517894 TTAACCAGCCCCAGGTTCTCTGG + Intronic
1178951500 21:36989822-36989844 GCGCGCGAACCCAGGTTCTCAGG + Intronic
1180634895 22:17256458-17256480 TTTCCCAAACCCAGATTCCCTGG - Intergenic
1181969859 22:26681757-26681779 TTACGCTTTCCCAGGTTCTCAGG + Intergenic
1183551488 22:38489450-38489472 TTACCCGAACCCAGGTTCTCCGG - Intronic
1184646188 22:45896713-45896735 GAGCCTGAACCCAGGTTCTCAGG - Intergenic
1185051027 22:48554045-48554067 CTTCCAGAACCCAGGTCCTCGGG + Intronic
958073307 3:88642571-88642593 TTACCGGTACCCAAGTTCCCAGG - Intergenic
958616248 3:96496385-96496407 TTACCCCAACCCTGGTTCTTTGG + Intergenic
961117939 3:124347807-124347829 TCACACGAAGGCAGGTTCTCTGG - Intronic
968841488 4:3009767-3009789 TTACCTGAAGCCATGTTCTCAGG - Intronic
983112053 4:163763399-163763421 TTACCAAAACTCAGTTTCTCTGG + Intronic
984560688 4:181265382-181265404 TTACCCGAACCCAAGTGCCTAGG + Intergenic
984803329 4:183733939-183733961 TTATCTTAGCCCAGGTTCTCTGG - Intergenic
985874769 5:2586279-2586301 TTTCCCCAACACAGGCTCTCAGG - Intergenic
988400819 5:30757877-30757899 TGATCCCAACCCAGGTTCCCAGG - Intergenic
1000148360 5:158475331-158475353 TTAACTGAATCCAGGTTTTCAGG - Intergenic
1006911335 6:37565580-37565602 TTACCCTACCCCAGGGCCTCTGG - Intergenic
1008613259 6:53203644-53203666 TCACCGGACTCCAGGTTCTCAGG + Intergenic
1011431384 6:87290483-87290505 TTTCCCAAACCCAGGATCTGTGG + Intronic
1013393049 6:109705961-109705983 TTACACTAACCCAGCTTTTCTGG - Intronic
1025024945 7:55508759-55508781 TTACCAGAAACCACCTTCTCTGG + Intronic
1035236011 7:157498106-157498128 TTTCCCACACCCAGGTGCTCGGG + Intergenic
1039918453 8:41876326-41876348 TTGTCCCCACCCAGGTTCTCTGG + Intronic
1041173792 8:55172127-55172149 TCACTTGAACCCAGGTTGTCGGG + Intronic
1043846923 8:85174213-85174235 TTGCCTGAACCCAGGAACTCAGG - Intergenic
1049176329 8:141194725-141194747 TTACCCGAACCACCCTTCTCAGG - Exonic
1190844651 X:54181298-54181320 TTTCCCCAACCAAGGTTCTTGGG - Intronic
1192542918 X:71990389-71990411 TTCCCCCAACCCATGTCCTCTGG + Intergenic
1195879526 X:109577967-109577989 TCTCCCCACCCCAGGTTCTCAGG - Intergenic