ID: 1183551635

View in Genome Browser
Species Human (GRCh38)
Location 22:38490695-38490717
Sequence TCCAGGATCTTGTAGGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183551630_1183551635 6 Left 1183551630 22:38490666-38490688 CCCTGTCTATGAGGTAGAAGCCT 0: 1
1: 0
2: 2
3: 12
4: 174
Right 1183551635 22:38490695-38490717 TCCAGGATCTTGTAGGACATTGG 0: 1
1: 0
2: 1
3: 7
4: 126
1183551631_1183551635 5 Left 1183551631 22:38490667-38490689 CCTGTCTATGAGGTAGAAGCCTT 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1183551635 22:38490695-38490717 TCCAGGATCTTGTAGGACATTGG 0: 1
1: 0
2: 1
3: 7
4: 126
1183551629_1183551635 7 Left 1183551629 22:38490665-38490687 CCCCTGTCTATGAGGTAGAAGCC 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1183551635 22:38490695-38490717 TCCAGGATCTTGTAGGACATTGG 0: 1
1: 0
2: 1
3: 7
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183551635 Original CRISPR TCCAGGATCTTGTAGGACAT TGG Intronic
900536884 1:3183093-3183115 GCCAGGATCATGTATGACTTTGG - Intronic
900856465 1:5189179-5189201 ACCATGACCTTGTAGGTCATGGG - Intergenic
902488483 1:16763724-16763746 TCCAGGAACATGTGGGGCATGGG - Intronic
903668995 1:25024530-25024552 TCCAGGGTCTTGGAGGAGCTGGG + Intergenic
908977876 1:69920152-69920174 TCCAGGACCTGGTGGGACATGGG - Intronic
910617512 1:89215802-89215824 TCCATGGTCTTATAGGAAATAGG - Intergenic
912895879 1:113588454-113588476 TAAAGCATCTTGTAGGTCATTGG + Intronic
912995784 1:114531397-114531419 TCCATTATCATGTAGGACCTTGG + Intergenic
917639220 1:176966436-176966458 TTCAAAAGCTTGTAGGACATGGG - Intronic
920157729 1:203968866-203968888 TCCAGGATCTGGTATAACAATGG - Intergenic
921987409 1:221327186-221327208 TACAGGATCTTATAGGAGATGGG - Intergenic
923947409 1:238903668-238903690 TCCAGGACCATTCAGGACATAGG + Intergenic
923952517 1:238974698-238974720 TCCAGGAGCTTGGAGGAGGTAGG - Intergenic
924268415 1:242306190-242306212 TCCAGGATCTTGTACAACCTTGG + Intronic
1064357570 10:14633449-14633471 TCCAAGATCTTCTAGTACTTTGG + Intronic
1065271004 10:24034018-24034040 GCCAGGATGAAGTAGGACATTGG + Intronic
1066054546 10:31668241-31668263 ACCAGGATGTTGAAGGAAATGGG - Intergenic
1070416967 10:76199760-76199782 TCCAGGATCTTGGCAGACACAGG + Intronic
1074477562 10:113786426-113786448 TCAAGAATCTGGTAGGACTTAGG + Intergenic
1079120850 11:17683889-17683911 GCCTGGATCTTGCAGGACACGGG - Intergenic
1083796817 11:65021706-65021728 TCCAGGACCTGGGAGGACAAAGG - Exonic
1084878558 11:72152870-72152892 TCCAGGATCTGGTATAAAATGGG - Intergenic
1085951547 11:81338454-81338476 TCCAGGGTCTTGCAGAATATAGG - Intergenic
1088417209 11:109602529-109602551 TCCAGGAGCTTGTACACCATTGG - Intergenic
1088924616 11:114288236-114288258 TCCAGGATGTTGAATGAAATTGG + Intronic
1089893668 11:121906109-121906131 TTCAGGATCTTGGAAGAAATAGG - Intergenic
1090279082 11:125440891-125440913 TCCAGGACCTTGGAGGAGAAAGG - Intergenic
1093600270 12:21013161-21013183 TTCATGGTCTTGTAGGTCATTGG + Intergenic
1094209034 12:27870919-27870941 TCCAGGATATTGAAGGAAACAGG - Intergenic
1096460757 12:51820543-51820565 TCCAGGTCCTTGTAGGAGAGGGG + Intergenic
1101081818 12:101194300-101194322 TGCTGGATCTTGTAGAAGATGGG - Intronic
1103138006 12:118524408-118524430 TCCTGGCTGGTGTAGGACATTGG + Intergenic
1103182425 12:118925228-118925250 TCCAGGAGCTTGAAGGAAAGAGG - Intergenic
1114672231 14:24417417-24417439 TCCAAGACCTTGAAGGACAGCGG - Exonic
1116551858 14:46250359-46250381 TCCAGACTCTTGATGGACATAGG + Intergenic
1121659613 14:95625005-95625027 TCCAGGCTATTGGAGGTCATGGG + Intergenic
1129522674 15:76195789-76195811 TTCAGGGTCTTATAGGTCATTGG - Intronic
1131394826 15:92077887-92077909 TGCAGGATCCTGCAGGACCTGGG + Intronic
1131623844 15:94097067-94097089 TTCAGGGCCTTGTAGGACAGAGG + Intergenic
1136091203 16:27921307-27921329 TCCAGGGTTTTGGAGGGCATGGG - Intronic
1137749773 16:50851632-50851654 CCCAGGCTATTGTAGCACATGGG - Intergenic
1140724236 16:77797724-77797746 CCCAGGAGCTTGGAGGTCATCGG - Intronic
1142249423 16:88984283-88984305 TCCAGAATGTTCTAGAACATTGG - Intergenic
1142619168 17:1154162-1154184 ACCAGGATCATGAAGGACCTGGG - Intronic
1143276917 17:5718438-5718460 TCCAAGATGTGGTAGGACGTGGG - Intergenic
1144169106 17:12641529-12641551 TCCAGTATCTTGTAGAGAATAGG - Intergenic
1144630824 17:16871554-16871576 TCCAGGATTTTGTGGAACGTGGG - Intergenic
1148483831 17:47977827-47977849 TCCAGGATCCTGGAGGTGATGGG + Exonic
1149810088 17:59660437-59660459 ATCAGGATTTTGTAGAACATTGG - Exonic
1151040154 17:70850169-70850191 TTCAGGATATTGTATGTCATAGG + Intergenic
1160367556 18:78340681-78340703 TCCAGGGTCTGTTAGGACATGGG - Intergenic
1162875311 19:13616924-13616946 TACAGGGTCTTGTGGGCCATAGG + Intronic
1163740593 19:19009521-19009543 GCCAGGATATAGCAGGACATGGG + Intronic
1164855628 19:31518392-31518414 TCCAGGCTCCTGCAGGCCATGGG - Intergenic
1165752782 19:38270963-38270985 AGGAGGATCTTGCAGGACATCGG - Intronic
1202702715 1_KI270713v1_random:516-538 TCCAGGAACATGTGGGGCATGGG + Intergenic
924962057 2:44868-44890 CACAGGATCTTGTAGCACTTTGG - Intronic
926800568 2:16656497-16656519 TCCAGGATCCTGAAGGCCTTTGG - Intronic
929139861 2:38657209-38657231 TCTTGGGTCTTGGAGGACATGGG + Intergenic
930494002 2:52114495-52114517 TCCAGGATCTTGTATTCTATTGG - Intergenic
931802175 2:65769137-65769159 TCCATATTCTTTTAGGACATTGG + Intergenic
933184078 2:79259580-79259602 CCCAGGATCCTGCAGGAGATAGG + Intronic
933668839 2:84987525-84987547 TGCAGGTTCTTGTAGTAAATTGG + Intronic
935037793 2:99395890-99395912 TCAAGGATCTTACAGGCCATGGG + Intronic
938405213 2:131028867-131028889 CCCAGGATCTTATAGCACACAGG + Intronic
938711849 2:133981844-133981866 CCAAGGATCAGGTAGGACATAGG + Intergenic
942545005 2:177054893-177054915 TCCAAGAGCTTTTAAGACATGGG - Intergenic
945041569 2:205747118-205747140 TCCAGGAGCTTGTAAGCCAGTGG + Intronic
945063139 2:205925794-205925816 TCCAGGATTGTGGAGGGCATGGG - Intergenic
948556830 2:238817857-238817879 AGCAGGATCTTTTAGGACCTGGG - Intergenic
948715134 2:239856355-239856377 TCCTGGATCTTGGAGGCCATAGG - Intergenic
1169828509 20:9796430-9796452 TCCAGGAAATTGGAAGACATGGG + Intronic
1175877630 20:62238033-62238055 TTCAGGATTTGGTAGGACAGTGG + Intronic
1178834207 21:36082823-36082845 GGCAGGATCTTGTTGGAGATTGG - Intergenic
1181394319 22:22608535-22608557 TCCATGTTCATGCAGGACATAGG + Intergenic
1182007677 22:26974868-26974890 GTCAGGGTCTTGGAGGACATAGG + Intergenic
1182778290 22:32847319-32847341 TGCAGGATCTTGACAGACATTGG + Intronic
1183377484 22:37473616-37473638 TCCAGGTGCTGGTAGGAGATGGG + Intronic
1183551635 22:38490695-38490717 TCCAGGATCTTGTAGGACATTGG + Intronic
949392586 3:3579068-3579090 TCCAGGCTCATTTAGGTCATTGG + Intergenic
950066576 3:10116375-10116397 GCCAGGATCTTGTAGGACCTTGG + Intronic
952816801 3:37453128-37453150 CCCAGGGTCTTGTAGGAGCTGGG - Intronic
954418769 3:50407523-50407545 TCCTGGTTCTAGTAGGACCTGGG + Intronic
963697208 3:148576602-148576624 TCCTAGATCTGGTAGGACCTTGG - Intergenic
963786480 3:149539668-149539690 TCCAGCATCTGGTAGGAATTTGG - Intronic
965983254 3:174719450-174719472 TCCATGAACTTATAGCACATAGG - Intronic
966086907 3:176079396-176079418 TCCAGGACCTTGCAGGACTAGGG + Intergenic
971575034 4:28262234-28262256 TCTAGGATCATCTGGGACATCGG - Intergenic
977136742 4:93314363-93314385 TGTTGGGTCTTGTAGGACATTGG - Intronic
981471624 4:145141847-145141869 TGCAGGCACGTGTAGGACATGGG + Intronic
995271391 5:110223342-110223364 TCCAGGGTCTTTGAGGACTTAGG + Intergenic
996308198 5:122075231-122075253 AACAGGATCTTGTAGTAGATGGG + Intronic
997786754 5:136720582-136720604 TCCTGGTTCTTGTAGGACAGAGG - Intergenic
1011276987 6:85642036-85642058 TGAAGGAAGTTGTAGGACATTGG - Intronic
1013790011 6:113825846-113825868 ACCAGGATGTTGTAGGGGATTGG - Intergenic
1014097543 6:117477238-117477260 TCCAGGATCTGGTATAAAATGGG - Intronic
1017043436 6:150325715-150325737 TGCAGGAACTTGTAGGATTTTGG + Intergenic
1018265410 6:162019334-162019356 TCCAGAACCATGTAAGACATGGG + Intronic
1020350184 7:7210741-7210763 TCCAGGAACATGTAGGGCAAGGG + Intronic
1020487834 7:8740557-8740579 TCCAGGAGCCTGTATTACATAGG - Intronic
1021636493 7:22699240-22699262 AGCAGGACCTTGCAGGACATGGG + Intergenic
1025096872 7:56102799-56102821 TCCTGGATCCTGTAGAACTTAGG - Intronic
1026656641 7:72262320-72262342 TCCAGGATCCTCTAAGACCTGGG - Intronic
1029202466 7:98848201-98848223 TCCGGGTTCTTGTCAGACATGGG + Exonic
1032508935 7:132456463-132456485 TCCAGCCTCTTCTAGGAAATTGG - Intronic
1032830424 7:135619408-135619430 TCCAGTATCTTAAAGGACAAGGG - Exonic
1032908451 7:136401179-136401201 TTCAGGTTATTGGAGGACATGGG + Intergenic
1033960234 7:146905215-146905237 TCCAAGATCTTCTAGGCCAGAGG - Intronic
1034851144 7:154495183-154495205 TTCAGTATCTGGTAGGAAATGGG + Intronic
1035039467 7:155917037-155917059 TTCTGGAGCTTGGAGGACATCGG - Intergenic
1035922884 8:3696986-3697008 CCCAGGATCCAGTAGGTCATGGG + Intronic
1036411983 8:8510689-8510711 TGCAGGATCCTGTAGGATCTTGG + Intergenic
1036684381 8:10899498-10899520 TCCTGGATCTTGTTGGCCTTGGG - Intronic
1042672674 8:71281936-71281958 TCCATGACCTTGTAGAATATTGG + Intronic
1045017150 8:98009887-98009909 TCCAGGAGCTTGCAGGCCAGTGG - Intronic
1045530981 8:102985235-102985257 TGCAGGATATTGTAGGTCTTAGG - Intergenic
1048017534 8:130511122-130511144 TTCAGGATTGTGTAGGGCATTGG - Intergenic
1048058361 8:130891264-130891286 TCCTGTGTCTTGTAGGACATAGG - Intronic
1048081244 8:131130140-131130162 TTCAGGATCTTCTAAAACATAGG + Intergenic
1049691936 8:143965351-143965373 GACAGGATCCTGTAGGACTTGGG - Intronic
1051138373 9:13950355-13950377 CCCAGTAGCTTGAAGGACATAGG + Intergenic
1051366019 9:16321996-16322018 GCCAGGATCTTGAAGGGCACAGG + Intergenic
1057416978 9:94872461-94872483 TCCAGAATCATGTGGGACTTGGG - Intronic
1058915378 9:109559669-109559691 TTGAGGATCTAGTAGGACACAGG - Intergenic
1186566799 X:10671885-10671907 TCCATGATCTTGTAGGCAGTAGG - Intronic
1187310086 X:18133372-18133394 TCCAGGAACTTTGAGGGCATTGG + Intergenic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1189178369 X:38980408-38980430 TCCAGGATCTAGAAGGTCTTTGG - Intergenic
1191847012 X:65554505-65554527 TCCAGACCCTTGTAGGACAAAGG - Intergenic
1192864762 X:75118868-75118890 TCCAGGATCTGGTATAAAATGGG + Intronic
1196021495 X:110995700-110995722 TTCAGGGTCTTCTAGGCCATGGG - Intronic
1196286501 X:113887102-113887124 TTCATGAGCTTGTTGGACATTGG + Intergenic
1196591729 X:117493412-117493434 TCCTAAATCTTGTAGGACCTTGG + Intergenic
1196748633 X:119094715-119094737 TCCAGGATCATTTATGACACAGG - Intronic
1196768847 X:119273324-119273346 TCCAGGATCCGGTAGGATAACGG + Intergenic