ID: 1183552469

View in Genome Browser
Species Human (GRCh38)
Location 22:38498670-38498692
Sequence CACTTTGGAGAGATGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183552469_1183552475 29 Left 1183552469 22:38498670-38498692 CCCAGCTTCATCTCTCCAAAGTG 0: 1
1: 0
2: 1
3: 25
4: 271
Right 1183552475 22:38498722-38498744 AACTCACTGTTAGCTTCTAAGGG 0: 1
1: 0
2: 0
3: 9
4: 134
1183552469_1183552474 28 Left 1183552469 22:38498670-38498692 CCCAGCTTCATCTCTCCAAAGTG 0: 1
1: 0
2: 1
3: 25
4: 271
Right 1183552474 22:38498721-38498743 CAACTCACTGTTAGCTTCTAAGG 0: 1
1: 0
2: 1
3: 4
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183552469 Original CRISPR CACTTTGGAGAGATGAAGCT GGG (reversed) Intronic
901351006 1:8596755-8596777 CACTTTGGGGAGTTGGAGATGGG - Intronic
902252089 1:15160663-15160685 CAATTTGGAGAGAAGCAGTTAGG + Intronic
903099430 1:21015529-21015551 CACTTTGGAGGGATCAAGACAGG + Intronic
903203361 1:21761889-21761911 CACTGTGGGGAGAAGAAGCTAGG + Intronic
903270336 1:22184423-22184445 CAGCTTGTAGAGAAGAAGCTGGG + Intergenic
904671450 1:32169119-32169141 CACTTTGGGGAGGTCAAGGTGGG + Intronic
905303531 1:37001929-37001951 AACTAGGGAGAGAGGAAGCTGGG + Intronic
905875456 1:41429218-41429240 CAGCTGGGAGAGATGAACCTGGG + Intergenic
907592160 1:55685644-55685666 CACTTTGCAGAAAGAAAGCTTGG + Intergenic
907785243 1:57605078-57605100 CACTCTGGGGAGATGATGTTTGG + Intronic
909323274 1:74317432-74317454 CACTTTAGAAATAAGAAGCTGGG + Intronic
909795282 1:79727778-79727800 CACATTTGATAGATGAAGATTGG + Intergenic
911857273 1:102895328-102895350 CAATCTGGAGAGATGAAAGTAGG + Intronic
911876663 1:103173240-103173262 CCCTCTTGAGAGATGAAGCTGGG + Intergenic
912757763 1:112338674-112338696 CACTTTGGGAAGCTGAGGCTTGG + Intergenic
913254914 1:116944658-116944680 CACTGCGGAGAGAGAAAGCTAGG - Exonic
914453777 1:147816628-147816650 AGCTTGAGAGAGATGAAGCTTGG - Intergenic
915011221 1:152687872-152687894 CACTTTGAGGAACTGAAGCTAGG - Intergenic
919564167 1:199162762-199162784 CAATTTGGAGAGATGAGCCAAGG - Intergenic
921475218 1:215598902-215598924 CATTTTGGAGAAATGAAAATGGG + Intronic
924052948 1:240095125-240095147 CACTTTTGATAGAAGAAGATTGG + Intronic
924774010 1:247103242-247103264 CACTTAGGAAAGATGAAGAGAGG + Intronic
1065502884 10:26399183-26399205 CACTTTGGAAGGCTGAAGCAAGG - Intergenic
1067917147 10:50412272-50412294 CAGTTTGGAGAATTGAAGTTAGG - Intronic
1068130195 10:52886965-52886987 CACTTTGGAGACATGATGTGAGG - Intergenic
1070316513 10:75318423-75318445 CACTTTGGGCAGCTGAAGCAGGG + Intergenic
1070445457 10:76496392-76496414 CAGTTTGCTGAGATGGAGCTGGG - Intronic
1070674800 10:78405202-78405224 CACATTGCACAGATGAAACTCGG + Intergenic
1070765977 10:79056663-79056685 CCCTTTGGAGAGGAGAAGGTCGG + Intergenic
1071744772 10:88404671-88404693 TACTGTGGAAAAATGAAGCTTGG + Intronic
1073007431 10:100335455-100335477 CACTTTGGAGATTTGCAGATAGG - Intergenic
1073329104 10:102659367-102659389 CACTGCGGGGAGAGGAAGCTGGG + Intergenic
1073336323 10:102713439-102713461 CAGTTTGGAGAACTCAAGCTAGG + Intronic
1073582868 10:104683652-104683674 CAGCTTGGAGAGGGGAAGCTAGG + Intronic
1075326689 10:121538348-121538370 CACTTTACACAGATGACGCTTGG + Intronic
1075589335 10:123680057-123680079 CAGGTTGGAGGGATGCAGCTCGG - Intronic
1075684584 10:124354599-124354621 CACTGAGGACAGGTGAAGCTGGG + Intergenic
1076616974 10:131761527-131761549 CACTGTGGGGAGAAGAAGATGGG + Intergenic
1077597730 11:3548257-3548279 CAGTTGGGATAGATGGAGCTGGG - Intergenic
1080426519 11:32159808-32159830 CACTCTGGGAGGATGAAGCTGGG + Intergenic
1080638559 11:34144668-34144690 CACTCTGCAGATAAGAAGCTTGG - Intronic
1081444143 11:43113864-43113886 CACTTGGGAGAGAAGGAGCGAGG - Intergenic
1081885327 11:46490673-46490695 CTTTTTGCAGGGATGAAGCTTGG - Intronic
1081941491 11:46946132-46946154 TACTTTGGAGAAATGGAGGTAGG - Intronic
1082091988 11:48097781-48097803 CACTTTGGGGGGCTGAGGCTGGG - Intronic
1083363528 11:62127952-62127974 CTCTTTGTAGAGATGAGGCTAGG + Intronic
1084630995 11:70349382-70349404 CACTTTGGAGAGGCCAAGGTGGG + Intronic
1085005601 11:73086160-73086182 CACTTTTGAGAGATAGAGGTGGG + Intronic
1086958563 11:92958843-92958865 GACTTTGGAAGGAAGAAGCTGGG - Intergenic
1087278832 11:96187486-96187508 CACTTTGGATAAATGATGCTGGG - Intronic
1088423663 11:109676366-109676388 CAATTAGGAGAGATATAGCTGGG - Intergenic
1089330558 11:117686166-117686188 CTATGTGGAGAGATGGAGCTGGG + Intronic
1089499552 11:118924439-118924461 CTCTCTGGAGCAATGAAGCTAGG - Intronic
1093775461 12:23068584-23068606 CACTTTGCAGAGAAGGAGATTGG + Intergenic
1097299567 12:58003882-58003904 AACTTTGGAAAGGTGAAGCAGGG - Intergenic
1101603508 12:106231040-106231062 CACTTTGAAGACAAGAAGCCTGG + Intergenic
1102019901 12:109675103-109675125 CTCTGTGCAGAGAAGAAGCTGGG + Intergenic
1102155444 12:110723754-110723776 CACTTTGGAGAGGCCAAGCCAGG - Intronic
1102184511 12:110937226-110937248 CAGTTTGGAGAAATGCAGCGCGG - Intergenic
1103378229 12:120473446-120473468 CACTTTGGGGAGGTCAAGGTGGG + Intronic
1104341912 12:127958244-127958266 CACTTTGCTGAGATGACCCTAGG + Intergenic
1106353555 13:28957321-28957343 AACTTTGGAGAGAAGAACCATGG - Intronic
1106448829 13:29861563-29861585 CACTCTGAAGAGAAGAAGCTTGG - Intergenic
1106892173 13:34257534-34257556 CAATTAGTAGAGATCAAGCTTGG + Intergenic
1108507220 13:51123337-51123359 CAATCTGTTGAGATGAAGCTTGG - Intergenic
1110711709 13:78657905-78657927 CAATTTGGAGAGATCAAGGATGG - Intronic
1110983780 13:81938122-81938144 CACTTTGTAGTGATGAGGATGGG + Intergenic
1111152535 13:84275223-84275245 CACTGAGGAGGGAGGAAGCTGGG - Intergenic
1111492833 13:89006091-89006113 CAATTTGTATAAATGAAGCTTGG - Intergenic
1112336400 13:98520686-98520708 CACCTTGGAGAGCTGTGGCTGGG - Intronic
1112854150 13:103745798-103745820 CACTGTGGAATGATGAAGCAAGG - Intergenic
1115012276 14:28563493-28563515 CACTTGGGAGACATTATGCTAGG + Intergenic
1115348740 14:32370124-32370146 CACTTTGGCCATATGATGCTTGG + Intronic
1115365755 14:32555244-32555266 CACTTGCTAGAGATGGAGCTGGG + Intronic
1116403456 14:44538655-44538677 CACTTTGTAGATATGAAGATTGG + Intergenic
1117846373 14:59915697-59915719 CAATTGGGATAGATGAAGTTTGG - Intergenic
1118656488 14:67955856-67955878 GAATTTGGACAGATGAAGATGGG + Intronic
1118681556 14:68246615-68246637 CACTGAGGAGAGATTAAACTTGG - Intronic
1119736550 14:76986246-76986268 CACTTTGCAGGGATGCAGCCTGG + Intergenic
1120020909 14:79528898-79528920 CATTAATGAGAGATGAAGCTGGG - Intronic
1120387494 14:83864587-83864609 CCATTTGAAGAGAGGAAGCTAGG - Intergenic
1120721386 14:87892972-87892994 CACTCTAGAGAGATGATCCTTGG - Intronic
1121646305 14:95519552-95519574 TACTTTGGAGAGAAAAAGATTGG - Intergenic
1202928580 14_KI270725v1_random:17742-17764 CAGCTTGGAGAGAGGAAGCCAGG + Intergenic
1124426551 15:29568104-29568126 CACTTTGCAGAAATGATGATTGG - Intronic
1124960264 15:34388757-34388779 CTCTTTGGAAAGTAGAAGCTTGG + Intronic
1124976893 15:34534978-34535000 CTCTTTGGAAAGTAGAAGCTTGG + Intronic
1126140939 15:45438061-45438083 CACTTTGGAAGGGTGAGGCTGGG + Intronic
1127724818 15:61739129-61739151 CCCTTTGAAGATTTGAAGCTAGG + Intergenic
1128502092 15:68233736-68233758 TACTTTGGAGAGAGGCAGCCAGG + Intronic
1129109370 15:73328764-73328786 CCCCAGGGAGAGATGAAGCTGGG + Intronic
1129434440 15:75526959-75526981 CCCTTGTGAGAGCTGAAGCTGGG - Intronic
1129488314 15:75899012-75899034 CACTTTGGGGAGGTGGAGGTGGG + Intronic
1131859251 15:96635074-96635096 CACTGTGTAGTGATGAAGTTCGG - Intergenic
1132379878 15:101358946-101358968 CACTGTGGAGAGATGCTGGTGGG + Intronic
1133243118 16:4427888-4427910 CACTTTGGGAAGCTGAAGCAAGG - Intronic
1134462066 16:14438078-14438100 CACTCTGGAGAAGTGAAGATGGG + Intronic
1135970158 16:27066632-27066654 GACTTGGGAGAGAAGAAACTCGG + Intergenic
1137614003 16:49836315-49836337 CACTTGGGAGAGAAGCAGCTTGG - Intronic
1137626096 16:49909731-49909753 CACAGTGGAGAGAGGAAGCTGGG + Intergenic
1140645611 16:77026697-77026719 CACTTTTGAGAGATTGAGGTTGG - Intergenic
1140894035 16:79309376-79309398 CCTTCTGGAGAGATGAAGGTGGG - Intergenic
1141879454 16:86848093-86848115 CACTCTGGTGAGAAGATGCTGGG - Intergenic
1142771509 17:2100790-2100812 CACTTTGGGAAGCTGAAGCAGGG - Intronic
1143377882 17:6478095-6478117 CACCTGGAAGAGATGCAGCTGGG + Exonic
1144644901 17:16965703-16965725 CACTTGGGAGAGAGGATTCTTGG + Intronic
1146249231 17:31323621-31323643 AAGTTTTGAGAGATAAAGCTGGG - Intronic
1146472308 17:33134393-33134415 CACTTTGGAGAGTGAAAGCAAGG + Intronic
1147279104 17:39343539-39343561 CACTTTATAGATAGGAAGCTTGG + Intronic
1147304366 17:39553123-39553145 CACTTTGGAGAAAAGAGACTAGG + Intronic
1147666204 17:42150128-42150150 CACTTTGGAAGGCTGAGGCTGGG - Intronic
1148134613 17:45284282-45284304 CATGTTGGGGACATGAAGCTTGG - Intronic
1149495783 17:57116468-57116490 CACTTTTGAAGGATGATGCTGGG - Intronic
1150448391 17:65245286-65245308 CACTTTGAAAAAATGAATCTGGG + Intergenic
1151339962 17:73464816-73464838 TTCTAAGGAGAGATGAAGCTGGG - Intronic
1153752257 18:8244895-8244917 CACTTTGGTGAGTTCAAGGTCGG + Intronic
1154947997 18:21181259-21181281 TACTTTGGAAAGGTGAACCTTGG + Intergenic
1157157940 18:45285937-45285959 CAATTAGGTGAGAAGAAGCTGGG - Intronic
1158321446 18:56268536-56268558 TTCTTTGAAGAGATGGAGCTGGG - Intergenic
1160149848 18:76390695-76390717 TCCTTTGGAGAGGAGAAGCTGGG + Intronic
1160323902 18:77922673-77922695 CAGTTTGGAGAGATAAAAGTAGG - Intergenic
1160890469 19:1375341-1375363 TAGTTTGGAAAGATGAAGTTCGG - Intronic
1161948131 19:7451659-7451681 CACTTTGGAGAGACCGAGGTGGG - Intronic
1164650567 19:29888075-29888097 CACTTTGGGAAGTTGAAGCCAGG + Intergenic
1167001821 19:46749961-46749983 CACTTTGGGAGGATGAGGCTGGG - Intronic
925328481 2:3040578-3040600 CACTTTGGAGTCAGGAATCTAGG - Intergenic
925717523 2:6797955-6797977 GTCTTTGGAGAGAGGACGCTGGG - Intergenic
926098695 2:10099498-10099520 CACTTTGGAAAGGTGAAGGTGGG - Intergenic
926830445 2:16956630-16956652 AGCTTTGAAGTGATGAAGCTGGG - Intergenic
930920521 2:56748001-56748023 CACTTTGGAGAGAAGAAAATGGG - Intergenic
931231003 2:60374914-60374936 CACTTTGGGGAGAAGAAGAGGGG - Intergenic
933346177 2:81088479-81088501 GACTGTAGAGAGATGGAGCTGGG + Intergenic
933708838 2:85310539-85310561 CACATTTGAGACAGGAAGCTGGG - Intergenic
933731286 2:85458187-85458209 CAATTTGGAGCATTGAAGCTTGG + Intergenic
933829089 2:86191984-86192006 CACTTTGGGGAGGAGAAGGTGGG + Intronic
934524529 2:95043439-95043461 CCATTTGCAGAGAGGAAGCTGGG + Intronic
935037408 2:99391967-99391989 CACTTTGGGGAGATCAAGGTGGG - Intronic
935368835 2:102323569-102323591 CACATGGGAGAGAAGAAGCAAGG + Intronic
936161541 2:110087204-110087226 AACTATTGAGAGATGAAGCAGGG - Intronic
936183122 2:110284150-110284172 AACTATTGAGAGATGAAGCAGGG + Intergenic
940120947 2:150265194-150265216 CACTTTTGAGAGGTCAAGGTCGG + Intergenic
940398890 2:153223711-153223733 CACTTTGGGAGGCTGAAGCTGGG + Intergenic
940778842 2:157911909-157911931 TAATTAGGAGAGATGATGCTTGG - Intronic
941200166 2:162498547-162498569 CCCATTGCAGAGATGAAGATAGG - Intronic
941860613 2:170275516-170275538 TATTTTTGAGAGATGAATCTAGG + Intronic
944282067 2:197909557-197909579 GACTTTGCAGAGATGAATCAAGG + Intronic
944493684 2:200284301-200284323 CACTGTGGACAATTGAAGCTTGG - Intergenic
945307230 2:208269787-208269809 CACTTTGGAGAGATCAACTGGGG + Intronic
946595677 2:221303329-221303351 CAGGTTGGAGAGCTGAGGCTGGG + Intergenic
946678376 2:222186950-222186972 CATTTTGGAGAGATGCATTTTGG - Intergenic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
947768501 2:232652869-232652891 CACTTTGAAGAGAGAAAGATAGG + Intronic
947858567 2:233341821-233341843 CACTTTAAAATGATGAAGCTGGG + Intronic
1170648664 20:18219315-18219337 CACTTTGGAGGGCTGAAGTGGGG + Intergenic
1173470283 20:43318404-43318426 CACTTTGGATAGGAGAGGCTGGG - Intergenic
1176590602 21:8646325-8646347 CAGCTTGGAGAGAGGAAGCCAGG + Intergenic
1177336901 21:19740531-19740553 CACCTTGAAGTGATGAAGCTAGG + Intergenic
1177664631 21:24138687-24138709 CTATTTGGAGATTTGAAGCTTGG - Intergenic
1178671752 21:34596794-34596816 CACTGTGGAGTGAAGGAGCTCGG + Intronic
1178929468 21:36805028-36805050 CATTGTGGAGAGATTAAGCAAGG + Intronic
1179307403 21:40167479-40167501 CTCTTTGGAAACATGAATCTTGG + Intronic
1179420087 21:41228545-41228567 CACATGGGAGAGAGGAAGCAAGG + Intronic
1179635718 21:42707440-42707462 CACTGTGGAGCAAAGAAGCTGGG - Intronic
1179816937 21:43912325-43912347 CACTTGGGAGAGATGAGGAAGGG - Intronic
1180273431 22:10623359-10623381 CAGCTTGGAGAGAGGAAGCCAGG + Intergenic
1181828075 22:25535942-25535964 CACTTTGGGAAGCTGAAGCCAGG + Intergenic
1182291861 22:29286260-29286282 CACTTTGGAAGGCTGAGGCTGGG - Intronic
1183359636 22:37376774-37376796 CACTTTGGGAAGATGATACTGGG - Intronic
1183552469 22:38498670-38498692 CACTTTGGAGAGATGAAGCTGGG - Intronic
1183786936 22:40034896-40034918 CACTTAGGACAGATGAAGAAAGG - Exonic
1184161653 22:42700742-42700764 CACTTTGGAGGGATGGAGGGAGG + Intronic
1184854691 22:47140032-47140054 CACTTTGGAGATGTGTAGCTAGG + Intronic
949136670 3:575353-575375 CAGCTTGGAGAGAGGAAGCCAGG - Intergenic
949516505 3:4812281-4812303 CACTTTGGGAAGCTAAAGCTGGG - Intronic
949916332 3:8967481-8967503 CACTTTGGAAGGCTGAGGCTGGG - Intergenic
950538386 3:13594966-13594988 CACTCTGGAGCCATGCAGCTGGG + Intronic
952902452 3:38119255-38119277 CACTTTGGACAGATTGAGTTTGG - Intronic
953225276 3:41013310-41013332 ATCTTTGGAGAGAGGAAGTTTGG - Intergenic
953957083 3:47240022-47240044 GACTTGGGAGAGATGGAGCAGGG - Intronic
954085844 3:48243201-48243223 CACTTTGGAAGGCTGAGGCTAGG + Intronic
954289215 3:49640435-49640457 CACTATGGAGAAAATAAGCTGGG + Intronic
954415516 3:50391439-50391461 CACTTAGGATAGATGAAGAGGGG - Intronic
954930400 3:54276221-54276243 CACACTGGAAAGATGAAGATGGG + Intronic
960199216 3:114811667-114811689 CACTTTAATGAGATGAAGTTTGG - Intronic
960819651 3:121715462-121715484 CACTTTGGGGAGGTCAAGGTGGG - Intronic
961968679 3:130935077-130935099 CACTTTGGGGAGGTCAAGGTGGG - Intronic
962164203 3:133032086-133032108 CACTTTGAAGGAAAGAAGCTGGG + Intergenic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
963319383 3:143797023-143797045 AACTTGGCAGAGATGAAGGTAGG + Intronic
965272415 3:166635796-166635818 CACATTAGAGTGATGATGCTGGG + Intergenic
965272796 3:166639341-166639363 CCCTTTGGAGAGCTGAGACTTGG + Intergenic
966855033 3:184188034-184188056 CAATTTGGAGAGGTGAAACGGGG + Intronic
967801976 3:193672158-193672180 TTCTTTGGAGAGATGAAGATTGG + Intronic
969388771 4:6875092-6875114 TCCTTAGGAGAGATGAAGCCAGG + Intronic
970023759 4:11598235-11598257 GTCTTGGGAGAGATGAACCTGGG - Intergenic
971775408 4:30957497-30957519 CACTTTGGTGAGGATAAGCTTGG + Intronic
973866308 4:55117366-55117388 CAGTCTTGAGAGATGCAGCTCGG - Intronic
974055712 4:56980740-56980762 CACTGTGGAGAGTTCAAACTGGG - Intronic
975573785 4:75843252-75843274 CAATTTGAAGGGATGGAGCTGGG + Intergenic
976979806 4:91213392-91213414 AACTTTGTAGACTTGAAGCTGGG - Intronic
977414720 4:96718583-96718605 CATTCCTGAGAGATGAAGCTTGG - Intergenic
980977838 4:139628188-139628210 CACTTAGGAGGGATGTAGCTTGG - Intergenic
981034645 4:140156837-140156859 CATTTTGGAGAGATGAAAGACGG - Intergenic
981914888 4:150022994-150023016 GACATTGGAGATATGCAGCTAGG - Intergenic
982486963 4:155977715-155977737 TAATTTGGGGAGAAGAAGCTCGG + Intergenic
985341287 4:188957274-188957296 CACTGTGGGCAGATGAAGCGGGG + Intergenic
986486541 5:8243716-8243738 CCCTTTGGAGAGATGTAGCAGGG - Intergenic
986824635 5:11507376-11507398 TACTTTGTAGAGATAAGGCTGGG + Intronic
987825113 5:23021025-23021047 CATTTTGGATAGATGAATTTGGG - Intergenic
988899327 5:35715160-35715182 CACTTTGGAAGGCTGAAGCGGGG - Intronic
991461860 5:66867004-66867026 CACTTTGGAAGGCTGAAGTTGGG - Intronic
991567815 5:68022834-68022856 AACTTTGGAGAGATTAAGGCTGG + Intergenic
991706389 5:69362540-69362562 CACTTTTGAGAGGTCAAGGTGGG + Intronic
992522368 5:77567864-77567886 CACTATGGTGGGATGAGGCTGGG - Intronic
992800077 5:80288100-80288122 CACTTTGGGAAGCTGAAGCAGGG + Intergenic
994972016 5:106752123-106752145 CATTTAGGAGTGAAGAAGCTGGG + Intergenic
995375390 5:111468546-111468568 TACTTAGGAGACTTGAAGCTGGG + Intronic
997661975 5:135596050-135596072 CACTTAGGAGATCTGAGGCTAGG + Intergenic
997891093 5:137677627-137677649 CACTTTCCAGAGGTGATGCTAGG - Exonic
998494053 5:142571584-142571606 CCCTGTGGAGAAATGAAGCAAGG - Intergenic
999268977 5:150285411-150285433 CACGTTGGAGAGAGGACACTGGG - Intronic
1000962660 5:167618662-167618684 GTGTTTGGGGAGATGAAGCTGGG + Intronic
1001110445 5:168891643-168891665 CACTATGGAGATAAGATGCTTGG + Intronic
1001779828 5:174358261-174358283 CATTTTGTAGATGTGAAGCTGGG - Intergenic
1005820884 6:29598230-29598252 CACTTTGGGAGGCTGAAGCTGGG - Intronic
1006934773 6:37709810-37709832 CACTGTGGGGAGCTGGAGCTCGG - Intergenic
1007427606 6:41757552-41757574 TACTCTGGGGAGATCAAGCTGGG - Intergenic
1008675988 6:53819224-53819246 CATTTTGGAGAAAGGAAGTTCGG + Intronic
1008976372 6:57431684-57431706 CATTTTTGAGAGATAAACCTAGG + Intronic
1009164894 6:60328835-60328857 CATTTTTGAGAGATAAACCTAGG + Intergenic
1009376761 6:62980766-62980788 TAATTTGTGGAGATGAAGCTGGG + Intergenic
1010205299 6:73317090-73317112 CACTTCTGTGATATGAAGCTTGG + Intergenic
1010761948 6:79733692-79733714 CACTGTGGAGAAGTGAAGGTGGG + Intergenic
1010903388 6:81455424-81455446 CACTTTGCCTATATGAAGCTTGG - Intergenic
1012290620 6:97451475-97451497 CACTTTGGGAAGCTGAAGCAGGG + Intergenic
1015004122 6:128257245-128257267 CACCTGGGAGATAGGAAGCTGGG + Intronic
1016926439 6:149354130-149354152 CACTTTGGATAGCAGAAGCTGGG - Intronic
1017137515 6:151161374-151161396 CACTTTGGAGAGAAGGAACAGGG - Intergenic
1017202604 6:151772309-151772331 AACTTTGGAGAGATTCAGATTGG - Intronic
1017305688 6:152915839-152915861 GACTTTGGAGAGTGGAAGGTAGG + Intergenic
1018745675 6:166760217-166760239 CGATTTGGAGAGAGGAAGGTGGG + Intronic
1020128492 7:5546362-5546384 CACTTTGGGGAGGTGAAGGAGGG + Intronic
1021064050 7:16150479-16150501 CACTTTGAAAATATGAAGCATGG + Intronic
1021465242 7:20935561-20935583 CACTTTGAAAACATGAAGGTAGG - Intergenic
1022116965 7:27269610-27269632 CACTTTGGCGACGTGCAGCTGGG + Intergenic
1022245686 7:28556964-28556986 GACTCAGGAGAGAGGAAGCTGGG - Intronic
1023462062 7:40409199-40409221 CACTTTGGAGAGGCCAAGGTGGG - Intronic
1024607520 7:51034562-51034584 CCCTTTGGAGAGAAGTAGATGGG - Intronic
1026006876 7:66607002-66607024 CACTTTGGCGACACGCAGCTGGG + Intergenic
1026508092 7:71003691-71003713 CACTTTGGAAAGTGGTAGCTGGG - Intergenic
1027302370 7:76853416-76853438 CACTTTGACGAAACGAAGCTAGG + Intergenic
1028140087 7:87263822-87263844 CACTTAGGTGAGCTGAAGCAGGG - Intergenic
1028348951 7:89819534-89819556 CTATTGGGAGAGATGGAGCTGGG - Intergenic
1030454150 7:109751646-109751668 CACTTTGGGGAGAACAAGTTGGG + Intergenic
1030789687 7:113708290-113708312 CACTCTGCAGATATGCAGCTGGG + Intergenic
1031809075 7:126343701-126343723 AGCATTGGAGAGATGAAACTTGG - Intergenic
1034980951 7:155475951-155475973 CACTTTGGACACATACAGCTAGG + Intronic
1035024884 7:155818813-155818835 CTCCTTGGAGAGATGAGGTTGGG - Intergenic
1035158286 7:156932201-156932223 CACCAGGGAGAGACGAAGCTTGG + Intergenic
1035892137 8:3356943-3356965 CACTTTGGAGAGAGCATTCTGGG + Intronic
1036118911 8:5993020-5993042 CACTTTGGGGTGATGAATTTCGG + Intergenic
1037085226 8:14840596-14840618 CATTTTGGAGAAATGAGACTTGG - Intronic
1037469426 8:19193039-19193061 CACTTTTGAGAAAAGAAGCAGGG - Intergenic
1038744390 8:30244508-30244530 CACTTTGGAAGGATGAGGCAGGG + Intergenic
1039558460 8:38494198-38494220 CACTTTGGGAAGCTGAAGTTGGG + Intergenic
1039948739 8:42152163-42152185 CACTTTGGTGAAATGGAGCGTGG - Intergenic
1041517864 8:58721946-58721968 CACTTTGGAGATATGCAGCAGGG + Intergenic
1043361487 8:79477735-79477757 CACTTTGGAAATTTGAAGGTGGG + Intergenic
1045079555 8:98610412-98610434 CACTTTGGTAAAATGAAGCTAGG - Intronic
1047846810 8:128815027-128815049 CACTTTGACCTGATGAAGCTGGG - Intergenic
1047979114 8:130161719-130161741 CATTTGGGAGAGATGAGGCATGG + Intronic
1049315462 8:141964651-141964673 CAGCTGGGAGAGATGAGGCTGGG + Intergenic
1050265146 9:3882105-3882127 CATTTGGCAGACATGAAGCTAGG + Intronic
1050533367 9:6609629-6609651 GACTTTGGATAGATGTGGCTGGG - Intronic
1050658046 9:7851097-7851119 AACTTTGGAGACTTGAACCTTGG + Intronic
1051121479 9:13756855-13756877 GCCTTTTGAGAGGTGAAGCTGGG + Intergenic
1052243365 9:26302495-26302517 AACTTTGGAGAGAGGAATCTTGG + Intergenic
1053596189 9:39563938-39563960 CGCTCTGGAGAAGTGAAGCTAGG + Intergenic
1053732472 9:41072688-41072710 CACTTGGGATTGATGAAGTTTGG - Intergenic
1053854157 9:42320579-42320601 CACTCTGGAGAAGTGAAGCTAGG + Intergenic
1054570067 9:66801079-66801101 CGCTCTGGAGAAGTGAAGCTAGG - Intergenic
1054695959 9:68358887-68358909 CACTTGGGATTGATGAAGTTTGG + Intronic
1055962674 9:81835217-81835239 CACTTTGGGAAGCTGAAGCAAGG + Intergenic
1056783937 9:89574631-89574653 CCTTTGGGAGAGATGAAGGTTGG - Intergenic
1060787294 9:126460665-126460687 CATGTTGGGGAGATGATGCTGGG + Intronic
1062531866 9:137005238-137005260 CACTTTGGAAGGCTGAGGCTGGG + Intergenic
1203620615 Un_KI270749v1:125050-125072 CAGCTTGGAGAGAGGAAGCCAGG + Intergenic
1186882740 X:13882441-13882463 CACTTTGGAGAGGTCAAGGTGGG + Intronic
1186882845 X:13883609-13883631 CACTTTGGAGAGGTCAAGGTGGG + Intronic
1187043805 X:15625619-15625641 AACTTGTGAGAGATGAAGATAGG + Intergenic
1187185061 X:16976629-16976651 CACTTTGGAGAGTAGAAGGGGGG + Intronic
1188327603 X:28824613-28824635 GACTTAGGAGATATGAATCTGGG - Intronic
1188681468 X:33013175-33013197 TAAATAGGAGAGATGAAGCTAGG - Intronic
1189259997 X:39671534-39671556 CACTTTGGGAGGCTGAAGCTGGG + Intergenic
1192478896 X:71468008-71468030 CACTTTTGAGAGGTCAAGGTGGG + Intronic
1194740646 X:97569464-97569486 CACCTTGGAGAGATGAACTTTGG - Intronic
1198103048 X:133438452-133438474 CACTTTGGGGGGCTGAGGCTAGG - Intergenic
1201920561 Y:19229290-19229312 TACTTTGGAAAGCTGAAGCAGGG + Intergenic