ID: 1183554660

View in Genome Browser
Species Human (GRCh38)
Location 22:38515873-38515895
Sequence GTGAGGTCCAAGAACTCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183554657_1183554660 -6 Left 1183554657 22:38515856-38515878 CCCAAATTCTTTCTTGGGTGAGG No data
Right 1183554660 22:38515873-38515895 GTGAGGTCCAAGAACTCTCTCGG No data
1183554656_1183554660 -5 Left 1183554656 22:38515855-38515877 CCCCAAATTCTTTCTTGGGTGAG No data
Right 1183554660 22:38515873-38515895 GTGAGGTCCAAGAACTCTCTCGG No data
1183554659_1183554660 -7 Left 1183554659 22:38515857-38515879 CCAAATTCTTTCTTGGGTGAGGT No data
Right 1183554660 22:38515873-38515895 GTGAGGTCCAAGAACTCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183554660 Original CRISPR GTGAGGTCCAAGAACTCTCT CGG Intergenic
No off target data available for this crispr